16482 Federal Register /Vol. 86, No. 58/Monday, March 29 ...
Targeting mitochondrial dynamics by regulating Mfn2 for ...Department of Physiology and...
Transcript of Targeting mitochondrial dynamics by regulating Mfn2 for ...Department of Physiology and...
Targeting mitochondrial dynamics by regulating Mfn2 for
therapeutic intervention in diabetic cardiomyopathy
Lang Hu1†
, Mingge Ding2†
, Daishi Tang3†
, Erhe Gao4, Congye Li
1, Kaiyan Wang
5,
Bingchao Qi1, Jihuan Qiu
1, Huishou Zhao
1, Pan Chang
6, Feng Fu
5*and Yan Li
1*
1Department of Cardiology, Xijing Hospital, Fourth Military Medical University,
Xi’an, 710032, China;2Department of Cardiology, Xi’an Central Hospital, Xi’an
Jiaotong University, Xi’an, 710003, China;3Department of Endocrinology, Affiliated
Zhongshan Hospital of Dalian University, Dalian, 116000, China; 4Center for
Translational Medicine, Temple University School of Medicine, Philadelphia, PA,
USA.; 5Department of Physiology and Pathophysiology, Fourth Military Medical
University, Xi’an, 710032, China; 6Department of Cardiology, The Second Affiliated
Hospital of Xi’an Medical University, Xi’an 710038, China;
†These authors contributed equally to this work.
Correspondence to:
*Yan Li, M.D., Ph.D., E-mail: [email protected]
Department of Cardiology, Xijing Hospital, Fourth Military Medical University
Tel:86-29-84775183, Fax: 86-29-84775183
Or
*Feng Fu, M.D., Ph.D., E-mail: [email protected]
Department of Physiology and Pathophysiology, Fourth Military Medical University
Tel: 86-29-81862307, Fax: 86-29-84774520
1
Abstract 1
Increasing evidence has implicated the important role of mitochondrial pathology in 2
diabetic cardiomyopathy (DCM), while the underlying mechanism remains largely 3
unclear. The aim of this study was to investigate the role of mitochondrial dynamics in 4
the pathogenesis of DCM and its underlying mechanisms. 5
Methods: Obese diabetic (db/db) and lean control (db/+) mice were used in this 6
study. Mitochondrial dynamics were analyzed by transmission electron microscopy in 7
vivo and by confocal microscopy in vitro. 8
Results: Diabetic hearts from 12-week-old db/db mice showed excessive 9
mitochondrial fission and significant reduced expression of Mfn2, while there was no 10
significant alteration or slight change in the expression of other dynamic-related 11
proteins. Reconstitution of Mfn2 in diabetic hearts inhibited mitochondrial fission and 12
prevented the progression of DCM. In an in-vitro study, cardiomyocytes cultured in 13
high-glucose and high-fat (HG/HF) medium showed excessive mitochondrial fission 14
and decreased Mfn2 expression. Reconstitution of Mfn2 restored mitochondrial 15
membrane potential, suppressed mitochondrial oxidative stress and improved 16
mitochondrial function in HG/HF-treated cardiomyocytes through promoting 17
mitochondrial fusion. In addition, the down-regulation of Mfn2 expression in HG/HF-18
treated cardiomyocytes was induced by reduced expression of PPARα, which 19
positively regulated the expression of Mfn2 by directly binding to its promoter. 20
Conclusion: Our study provides the first evidence that imbalanced mitochondrial 21
dynamics induced by down-regulated Mfn2 contributes to the development of DCM. 22
Targeting mitochondrial dynamics by regulating Mfn2 might be a potential 23
2
therapeutic strategy for DCM. 24
25
Keywords: Diabetic cardiomyopathy, Mitochondrial dynamics, Mitochondrial 26
dysfunction, Mfn2, PPARα 27
28
3
1. Introduction 29
Diabetes mellitus (DM) is a major threat to human health worldwide, and the 30
prevalence of DM will continue to rise during the next 10 years. It is estimated that 31
more than 353 million people worldwide will suffer from DM by 2030[1, 2]. 32
Cumulative evidence reveals that diabetes is associated with abnormal cardiac 33
structure and function, leading to diabetic cardiomyopathy (DCM)[3]. Models of 34
DCM can be typically classified as type 1 or 2, with the latter representing over 90% 35
of the human diabetic population[4]. Nowadays, specific strategies for preventing 36
type 2 DCM in numerous diabetic patients have not been clarified yet. Mitochondria 37
are the primary organelles for reactive oxygen spices (ROS) generation and energy 38
production in cardiomyocytes. Emerging evidence has suggested that mitochondrial 39
dysfunction may play a pivotal role in the pathogenesis of DCM[5-7]. For example, 40
impaired respiratory function and increased ROS production are observed in 41
mitochondria isolated from atrial tissue of diabetic patients[8]. Moreover, it is 42
essential to control mitochondrial ROS production and to protect mitochondria from 43
losing their ability to generate energy in order to prevent DCM[9]. However, despite 44
increasing evidence implicating the important role of mitochondrial pathology in 45
DCM, the underlying mechanism is still largely unclear. 46
The crucial role of mitochondrial morphological alteration in mitochondrial 47
homeostasis has been highlighted in recent studies. Mitochondrial morphological 48
alteration, also known as mitochondrial dynamics, mainly comprises mitochondrial 49
fusion and fission. Mitochondria continually adapt their shapes through fusion and 50
4
fission in response to changes in energy demand and supply. The constant cycle of 51
fusion and fission not only determines mitochondrial morphology but also regulates 52
various mitochondrial functions, including energy production, oxidative stress and 53
apoptosis[10, 11]. Mitochondrial fusion seems to have beneficial effects because it is 54
associated with enhanced mitochondrial function and increased ATP production [12]. 55
In contrast, excessive mitochondrial fission is considered to be detrimental because it 56
causes mitochondrial dysfunction and increased ROS[13-15]. Importantly, several 57
studies have reported that impaired mitochondrial dynamics is observed in the cardiac 58
tissues from both DCM animals and patients[16, 17]. However, whether targeting 59
mitochondrial dynamics is an effective strategy to prevent the development of DCM 60
remains largely unknown. 61
A series of GTPases are involved in the regulation of mitochondrial dynamics. 62
Mitochondrial fission is driven by Dynamic-related protein1 (Drp1) and 63
mitochondrial fission 1 protein (Fis1)[18-20]. Drp1 exists largely in a cytosolic pool 64
and is recruited by Fis1 from the cytosol to the mitochondria for fission reactions. The 65
fusion of the mitochondrial outer membrane is controlled by mitofusin 1 and 2 (Mfn1 66
and Mfn2), and the fusion of inner membrane is governed by optic atrophy 1(Opa1). 67
These proteins work together to maintain the homeostasis of mitochondrial dynamics. 68
An imbalance between mitochondrial fission and fusion regulatory proteins has been 69
shown to contribute to many cardiac pathologies including myocardial 70
ischemia/reperfusion and heart failure[21, 22]. Nevertheless, it is still largely unclear 71
how these fission/fusion proteins are changed in diabetic hearts, especially in type 2 72
5
diabetic hearts. Moreover, the mechanisms by which diabetes regulate the expression 73
of mitochondrial dynamics proteins in cardiomyocytes remain to be defined. 74
In this study, we identified down-regulated Mfn2 as a pivotal factor contributing 75
to imbalanced mitochondrial dynamics and mitochondrial dysfunction in type 2 DCM. 76
Moreover, Mfn2 overexpression effectively alleviated DCM by promoting 77
mitochondrial fusion and improving mitochondrial function. These findings suggest 78
that targeting mitochondrial dynamics by regulating Mfn2 might be a potential 79
therapeutic strategy for DCM. 80
81
6
Materials and Methods 82
Animals 83
All animal experiments were performed in accordance with the National 84
Institutes of Health guidelines for the use of laboratory animals and were approved by 85
the Fourth Military Medical University Animal Use and Care Committee. Leptin 86
receptor-deficient (db/db) mice and lean control mice (db/+) were provided by 87
Changzhou Cavens Laboratory Animal Co. Ltd. (Jiangsu, China). 88
89
Primary culture of neonatal rat cardiomyocytes 90
All experimental procedures were approved by the Fourth Military Medical 91
University Animal Use and Care Committee. Primary cardiomyocytes were prepared 92
from neonatal rat hearts as previously described[23]. Thereafter, the cardiomyocytes 93
were subjected to low-glucose (LG) medium (5.5 mmol/L glucose), osmolarity 94
control (OC) medium (5.5 mmol/L glucose and 19.5mmol/L mannitol), high-glucose 95
(HG) medium (25 mmol/L glucose), HG+ oleate acid (HG+OA) medium(25 mmol/L 96
glucose and 500 μmol/L oleate), HG+ palmitate acid (HG+PA) medium (25 mmol/L 97
glucose and 500 μmol/L palmitate) or HG+PA+OA (25 mmol/L glucose, 500 μmol/L 98
palmitate and 500μmol/L oleate) for 24 hours. 99
100
Echocardiography 101
Echocardiography was performed in M-mode with a VEVO 2100 102
echocardiography system (VisualSonics Inc., Toronto, Canada). During the procedure, 103
7
mice were anaesthetized using 2.5% isoflurane. Anesthesia was maintained with 2% 104
isoflurane. Continuous electrocardiogram monitoring system was used to measure 105
mouse heart rate under conscious or anesthetic condition. M-mode echocardiography 106
was obtained to record the left ventricular systolic and diastolic motion profile. The 107
left ventricular internal diameter at end-systole (LVIDs) and left ventricular internal 108
diameter at end-diastole (LVIDd) were measured. Left ventricular end-diastolic 109
volume (LVEDV) and end systolic volume (LVESV) were calculated using computer 110
algorithms. Left ventricle ejection fraction (LVEF) and left ventricle fractional 111
shortening (LVFS) were calculated as LVEF (%) = (LVEDV-LDESV)/LVEDV×100 112
and LVFS (%) = (LVIDd–LVIDs)/ LVIDd×100, respectively. Analysis of Doppler 113
echocardiography was performed to determine diastolic trans-mitral blood flow 114
velocities for peak early (E) and late (A) fillings, the ratio of E wave to A wave (E/A). 115
Pulse wave Doppler of the mitral E-wave and A-wave velocities were taken from the 116
four chambers view and E/A ratio were measured to assess diastolic function. All the 117
echocardiographic images were analyzed using Vevo 2100 software. 118
119
Transmission electron microscopy (TEM) 120
Heart samples from the left ventricular free wall were isolated and fixed with 121
2.5% glutaraldehyde in a 0.1 M phosphate buffer (pH 7.4, 4℃) for 24 hours, rinsed 122
several times with 0.1 M phosphate buffer (pH 7.4) and then post-fixed with 1% 123
osmium tetroxide in deionized water. Subsequent procedures were performed as 124
previously described[24]. All images were obtained by a technician blinded to the 125
8
treatment with one transmission electron microscope (JEM-1230, JEOL Ltd., Tokyo, 126
Japan) at 300 kV. Mitochondrial images were analyzed by a technician blinded to the 127
treatment using Image J software. The number of mitochondria combined with mean 128
mitochondrial size were used for the analysis of mitochondrial morphology as 129
previously described[25, 26]. At least 300 mitochondria in a minimum of 8 images per 130
mice were analyzed. The number of mitochondria was calculated in an area bigger 131
than 800 µm2 in 8 images. 132
133
Down-regulation and up-regulation of target genes 134
Empty adenoviral vectors (Ad-EV) and recombinant adenoviral vectors 135
expressing Mfn2 (Ad-Mfn2), PPARα (Ad-PPARα) or Mfn2-specific small hairpin 136
RNA (Ad-shMfn2) were constructed by Hanbio Biotechnology Ltd (Shanghai, 137
China). The titre of the adenoviruses used in this study was about 1.2*1010
PFU/ml. 138
For intramyocardial injection of adenoviruses, mice were anaesthetized using 2.5% 139
isoflurane, intubated and maintained under anesthesia with 2% isoflurane during the 140
surgical procedure. After the hearts were exposed, adenovirus was injected (using a 50 141
µl needle, Hamilton, 705RN, USA) into the left ventricle free wall (10 µl at each of 142
four sites). 143
PPARα siRNA (#sc-38885) was purchased from Santa Cruz Biotechnology 144
(USA). For siRNA transfection, Lipofectamine™ RNAiMAX Transfection Reagent 145
(Invitrogen, #13778030) was used. Briefly, two tubes were prepared before 146
transfection. One tube contained Dulbecco's modified Eagle's medium (DMEM) and 147
9
RNAiMAX Transfection Reagent. Another tube contained DMEM and siRNA. Then, 148
the contents of the two tubes were gently mixed together and incubated at room 149
temperature for 5 min. After 48h transfection of PPARα siRNA, the cells were 150
subjected to HG or HG/HF medium. For adenovirus transfection, cardiomyocytes 151
were cultured in serum-free DMEM containing adenovirus (10 µl/ml, MOI: 100:1) for 152
6-8 hours. Then, the medium was replaced, and the cells were subjected to HG or 153
HG/HF medium for another 24 hours. 154
155
Histological Analysis 156
Mice hearts were fixed in 4% paraformaldehyde (pH 7.4) overnight, embedded 157
in paraffin, then serially sectioned (5-mm-thick slices) for histological analysis. 158
Standard hematoxylin and eosin staining was performed following standard 159
procedures. Cardiac collagen content was assessed using Masson trichrome staining. 160
161
Immunohistochemistry 162
Immunohistochemistry was performed on mouse hearts as previously 163
described[27]. Briefly, myocardial tissue sections were treated with 3% hydrogen 164
peroxide for 20 min to block endogenous peroxidase. Primary antibody anti-Mfn2 165
(1:300, Abcam, USA) was used to incubate with tissue sections at 4 ℃ for overnight. 166
Tissues were washed with PBS and then horseradish peroxidase (HRP)-conjugated 167
secondary antibody was incubated for 1 h. Diaminobenzidine (DAB) solution was 168
used to visualize the reaction. For immune histochemical, at least 10 fields per heart 169
10
were randomly chosen and analyzed. 170
171
Wheat germ agglutinin (WGA) staining 172
For WGA staining, hearts were arrested in diastole with 2 M KCl and fixed in 173
4% paraformaldehyde (pH 7.4) overnight. Later, hearts were embedded in paraffin 174
and serially sectioned (5-mm-thick slices). Wheat germ agglutinin (green, Thermo 175
Fisher) was diluted 1:100 (10 µg/mL) in the required buffer. Incubation time was one 176
hour protected from light. The sections were washed and then cover slipped with a 177
water-soluble anti-fading mounting medium. Images were captured using the 178
fluorescence microscope and the cardiomyocyte size was calculated using ImageJ 179
software. 180
181
Cell apoptosis assay 182
For analysis of apoptosis in heart tissues, a terminal deoxynucleotidyl 183
transferased UTP nick end labelling (TUNEL) assay kit (Roche Applied Science, 184
Swiss) was used to determine myocardial apoptosis following the manufacturer’s 185
instructions as previously described[28]. Only TUNEL- and DAPI-positive nuclei 186
located within heart tissues were considered as apoptotic nuclei. For TUNEL staining, 187
at least 10 fields per heart were randomly chosen and analyzed. Apoptosis rate in 188
primary cardiomyocytes was analyzed by flow cytometry analysis using PE-Annexin 189
V Apoptosis Detection Kits (#559763; BD Biosciences) according to the 190
manufacturer’s instructions. 191
11
192
Mitochondrial membrane potential measurement 193
To measure mitochondrial membrane potential, mitochondrial membrane 194
potential assay kits with JC-1(#C2006) were obtained from Beyotime Biotechnology 195
(Jiangsu, China). All procedures were performed according to the manufacturer’s 196
protocol as previously described[28]. 197
198
Assessment of mitochondrial morphology in cells 199
To view mitochondrial morphology, primary cardiomyocytes were stained with 200
100 mM MitoTracker™ Red CMXRos probe (M7512, Thermo Fisher Scientific, 201
USA) at 37℃ for 30 min. Images were acquired with a confocal laser-scanning 202
microscope (Nikon A1R MP+ Confocal Microscope, Nikon, Japan). The number and 203
morphology of mitochondria were analyzed and quantified as previously 204
described[24]. Percentage of cells with fragmented mitochondria (small and round) 205
was counted. 206
207
Measurement of ROS production in isolated heart mitochondria 208
Mitochondrial ROS generation was measured spectrophotometrically (560-nm 209
excitation and 590-nm emission) in 125 µg/ml of mitochondrial protein as previously 210
described[29]. Mitochondria were isolated from mouse hearts with Tissue 211
Mitochondria Isolation Kits (C3606, Beyotime Biotechnology, Jiangsu, China) in 212
strict accordance with the manufacturer’s instructions. The mitochondria was 213
12
incubated in a solution containing: 20 mM Tris, 250 mM sucrose, 1 mM EGTA, 1 214
mM EDTA, and 0.15% bovine serum albumin adjusted to pH 7.4 at 25°C with 215
continuous stirring. ROS was measured with the H2O2-sensitive dye amplex red 216
reagent (10 µM) (Thermo Fisher, Waltham, MA) according to the manufacturer’s 217
instructions using a Bio-tek plate reader every 2 min for total 20 min. Aliquots of 218
H2O2 were used for calibration and the rates were determined with linear regressions. 219
220
Detection of mitochondrial ROS (mitoROS) and total ROS in primary 221
cardiomyocytes and mice hearts 222
MitoROS and total ROS were detected using the fluorescent probe MitoSOX 223
(#M36008, Thermo Fisher, USA) and Fluorometric Intracellular ROS Kits (#S0033, 224
Beyotime Biotech, China) respectively. Images were obtained with a confocal laser-225
scanning microscope (Nikon A1R MP+ Confocal Microscope, Nikon, Japan). 226
Dihydroethidium (DHE) staining was used to determine the intracellular 227
superoxide anion levels in mouse heart tissue. The images were analyzed with 228
ImagePro Plus image analysis software. MnSOD activity and MDA levels were 229
measured using Mn-SOD Assay Kits (S1013, Beyotime Biotechnology, Jiangsu, 230
China) and Lipid Peroxidation MDA Assay Kits (S0131, Beyotime Biotechnology, 231
Jiangsu, China) according to the protocols provided by the manufacturer. For DHE 232
staining, at least 10 fields per heart were randomly chosen and analyzed. 233
234
Measurement of mitochondrial oxygen consumption rate (OCR) 235
13
An XF24 Extracellular Flux Analyser (AgilentSeaHorse Bioscience, USA) 236
recorded oxygen consumption rate (OCR) as previously described[30]. Primary 237
cardiomyocytes were cultured with the medium as indicated in an Agilent Seahorse 238
XF24 Cell Culture Microplate (V7-PS, 100777-004, Agilent). OCR was recorded after 239
equilibration and after FCCP (0.5 μM) and antimycin (1.5 μM) treatments, these 240
values were used to calculate basal and maximal OCR. All OCR measurements were 241
normalized with well-by-well haemocytometer cell counts. 242
243
Western blotting and quantitativereal-time (RT)-PCR 244
Mouse heart tissue and primary cardiomyocytes were analyzed by western 245
blotting as previously described[27]. For mitochondrial protein isolation, 246
mitochondria were isolated from primary cardiomyocytes with Cell Mitochondria 247
Isolation Kits (C3601, Beyotime Biotechnology, Jiangsu, China) in strict accordance 248
with the manufacturer’s instructions. Primary antibodies against the following 249
proteins were used: β-actin (Proteintech, China, #20536-1-AP), Mfn1 (Abcam, 250
#ab57602), Mfn2 (Abcam, #ab56889), Opa1 (Abcam, #ab42364), Fis1 (Genetex, 251
USA, #GTX111010), Drp1 (Cell signaling, USA, #8570), PPARα (Novus, #NBP1-252
04676), cytochrome C (Abcam, #ab133504), caspase-3 (Cell signaling technology, 253
#9662), cleaved caspase-3 (Cell signaling technology, #9664) and Nox4 (Abcam, 254
#ab133303). 255
RNA was extracted with RNAisoPlus (#9189Q, Takara, Japan), cDNA was 256
synthesized with aPrimeScript™ RT Reagent Kit with gDNA Eraser (#RR047Q, 257
14
Takara), and quantitative RT-PCR was performed with SYBR® Premix Ex Taq™ II 258
(#RR820L, Takara). All procedures were performed strictly following the 259
manufacturers’ protocols. The primer sequences are as follows: Mfn2 forward 260
CTTGAAGACACCCACAGGAACA, Mfn2 reverse 261
GGCCAGCACTTCGCTGATAC; Actin forward GTCCCTCACCCTCCCAAAAG, 262
and actin reverse GCTGCCTCAACACCTCAACCC. 263
264
Chromatin immunoprecipitation (ChIP) assay 265
ChIP was performed using a Simple ChIP Plus Enzymatic Chromatin IP Kit 266
(#9003, Cell signaling technology, Danvers, USA) following the protocol provided by 267
the manufacturer. In brief, the cells were fixed with formaldehyde, and the chromatin 268
was sheared. Then, the fragmented chromatin was incubated with a PPARα antibody 269
(#NBP1-04676, Novus, USA) and protein G magnetic beads. DNA released from the 270
precipitates was analyzed by PCR. The primer sequences specific to the PPARα 271
binding region within the Mfn2 promoter region were as follows: Mfn2 promoter 272
forward: 5´-TGATCCGGAAAGGAAAACAG-3´ and reverse: 5´- 273
CACCGAAAGGCCACAGTAAT-3´. IgG was employed as the negative control. 274
275
Luciferase reporter assay 276
To analyze the PPARα-dependent transcriptional regulation of Mfn2, full length 277
(-2000/0, see supporting information) and fragments (-1200/0, -1000/0, -800/0, -278
600/0) from the 2kb promoter sequence 5’ upstream of the transcription start site of 279
15
rat Mfn2 were cloned into the PGL3.0-Basic vector upstream of luciferase cassette. 280
The PGL3.0-Basic plasmid was provided by HanBio technology (Shanghai, China). 281
All constructs were verified by sequencing. A dual-luciferase reporter assay system 282
was used to assess the luciferase activity. Briefly, HEK-293T cells were transfected 283
with various promoter constructs and co-transfected with the Renilla luciferase 284
reporter plasmid (pRL-TK). Meanwhile, the cells were co-infected with the PPARα or 285
empty adenovirus for 24 h. Cells were then lysed and processed according to the 286
manufacturer’s instructions. The luciferase activity was measured using a GloMax96 287
plate reader (Biotek, USA). For each sample, the pGL3.0-firefly luciferase activity 288
was normalized to Renilla luciferase activity of the pRL-TK control. 289
290
Statistical analysis 291
All values were presented as the mean ± standard error (SEM). All data were 292
subjected to one-way ANOVA or two-way repeated measures ANOVA followed by 293
Bonferroni post hoc test correction where appropriate using GraphPad Prism 6.0 294
software (GraphPad Software, La Jolla, USA). A value of P<0.05 was considered 295
statistically significant. 296
297
16
Results 298
Excessive mitochondrial fission and reduced Mfn2 expression were observed in 299
diabetic hearts of db/db mice 300
Compared with those of db/+ control mice, body weight, blood glucose and 301
serum lipids including triglyceride(TG) and total cholesterol(TC) in db/db mice were 302
significantly increased at the beginning of 8-week-old (Figure S1). Serial 303
echocardiography was performed in db/+ and db/db mice at 8, 12 and 16 weeks of 304
age. Compared with db/+ mice, db/db mice showed impaired cardiac function at 12 305
and 16 weeks of age, as evidenced by decreased LVEF and LVFS (Figure 1A, Cand 306
D). Moreover, diabetic hearts from db/db mice exhibited excessive mitochondrial 307
fission at 12-week-old and 16-week-old compared with control hearts. As shown by 308
Figure 1B, E and F, mean mitochondrial size was decreased and the number of 309
mitochondria per μm2 was increased in diabetic hearts. To investigate the key proteins 310
underlying the excessive mitochondrial fission in diabetic hearts, the levels of the 311
main mitochondrial dynamics-related proteins (Drp1, Fis1, Mfn1, Mfn2, and Opa1) 312
were determined. Compared with control hearts of db/+ mice, Mfn2 expression was 313
significantly down-regulated in diabetic hearts of db/db mouse at the beginning of 12-314
week-old (Figure1G and H), while other dynamic-related protein expression remained 315
unchanged (Drp1, Fis1, Mfn1 and Opa1). Phospho-Ser-616-Drp1 was slightly 316
increased in the hearts of 16-week-old db/db mice, while Phospho-Ser-637-Drp1 was 317
slightly decreased in diabetic hearts of db/db mice at 16-week-old. The down-318
regulation of Mfn2 was even more obvious in the hearts of 16-week-old db/db mice. 319
17
Reduced protein expression of Mfn2 in db/db mouse hearts was confirmed by 320
immunohistochemical staining (Figure 1L). A consistent pattern of mRNA expression 321
was observed by quantitative RT-PCR (Figure 1K), suggesting that the expression of 322
Mfn2 in diabetic hearts is mainly down-regulated at the transcriptional level. 323
Collectively, these data indicate that there are excessive mitochondrial fission in the 324
development of DCM. Moreover, although there was altered phosphorylated 325
modification of Drp1 at Ser616 or Ser637 in diabetic hearts, the change of Mfn2 326
expression was earlier and more evident. 327
328
Reconstitution of Mfn2 prevented mitochondrial fission and DCM in db/db mice 329
To determine whether the reconstitution of Mfn2 protects the heart against DCM, 330
adenoviral vectors encoding Mfn2 were intramyocardially injected into 12-week-old 331
db/db mice or wild type (WT) C57 mice. Mfn2 expression was determined at 1 week 332
and 4 weeks after injection, and cardiac function was measured at 4 weeks after 333
injection (Figure 2 and S3). As shown in Figure 2B and 2C, myocardial Mfn2 334
expression was increased by ~2.2 fold in db/db mice hearts at 1 week after Mfn2-335
expressing adenovirus (Ad-Mfn2) injection compared with Ad-EV injection. Four 336
weeks after injection, Mfn2 expression was slightly lower but remained ~1.8-fold 337
higher than that of Ad-EV (Figure 2B and C). Immunohistochemical staining further 338
confirmed the increased expression of Mfn2 in almost all the area of left ventricular at 339
4 weeks after injection, suggesting intramyocardially adenovirus injection did achieve 340
transmural expression of Mfn2 in mouse hearts (Figure 2E and S2). Ad-Mfn2 341
18
injection also significantly increased the expression of Mfn2 in the hearts of WT mice 342
(Figure S3A). Overexpression of Mfn2 by adenovirus infection did not have 343
significant effects on mitochondrial morphology and cardiac function in WT hearts 344
(Figure S3B-G). Reconstitution of Mfn2 efficiently prevented mitochondrial fission as 345
evidenced by the increased mean size of mitochondria and decreased number of 346
mitochondria per μm2
(Figure 2D, F and G). Moreover, reconstitution of Mfn2 347
significantly enhanced cardiac function in diabetic db/db mice as evidenced by 348
increased LVEF and LVFS (Figure 2H-J). Heart rate was measured in conscious or 349
anesthetic mice. As shown in Figure 2K, heart rate was significantly lower in db/db 350
mice under conscious or anesthetic condition compared with db/+ mice, while 351
reconstitution of Mfn2 partly recovered heart rate in db/db mice. Furthermore, 352
Doppler echocardiography indicated that Mfn2 reconstitution also alleviated diastolic 353
dysfunction in 16-week-old db/db mice, as evidenced by elevated E/A ratio after 354
Mfn2-expressing adenovirus injection (Figure 2L and M). Taken together, these data 355
indicate that reconstitution of Mfn2 prevents mitochondrial fission and improves 356
cardiac function in diabetic db/db mice. 357
Cardiac hypertrophy and fibrosis are common features in DCM. Four weeks after 358
adenovirus injection, cardiac hypertrophy and fibrosis were determined in 16-week-359
old db/db and control db/+ mice. As shown in Figure 3, db/db mice showed 360
significant cardiac hypertrophy and fibrosis compared with control mice as evidenced 361
by enlarged hearts, increased cardiomyocyte cross-sectional area, elevated ratios of 362
heart weight to tibia length and increased interstitial fibrosis. These pathological 363
19
changes were efficiently ameliorated in the hearts of db/db mice receiving Ad-Mfn2. 364
365
Reconstitution of Mfn2 inhibited apoptosis and oxidative stress in diabetic hearts 366
Compared with the control hearts of db/+ mice, the expression of cleaved 367
caspase-3 and apoptotic index were increased in the diabetic hearts of db/db mice. 368
Reconstitution of Mfn2 significantly reduced apoptotic index and decreased the 369
expression of cleaved caspase-3 in diabetic hearts (Figure 4A-C). Excessive oxidative 370
stress is closely associated with the induction of apoptosis[9, 31]. Nox4-derived ROS 371
is the major source of oxidative stress in diabetic hearts[32]. As expected, myocardial 372
Nox4 expression and superoxide anion production (stained by DHE) and MDA levels 373
were significantly increased in diabetic hearts compared with control hearts (Figure 374
4D-G), while MnSOD activity of diabetic hearts was decreased (Figure 4H). 375
Furthermore, heart mitochondria was isolated and mitochondrial ROS production was 376
measured with H2O2-sensitive dye amplex red reagent. As shown in Figure 4I and J, 377
mitochondria-derived ROS production was significantly increased in db/db mice 378
hearts. Up-regulated Mfn2 markedly inhibited myocardial oxidative stress in db/db 379
mice, as evidenced by reduced Nox4 expression and mitochondria derived ROS 380
production, decreased MDA levels and increased MnSOD activity (Figure 4D-J). 381
Overexpression of Mfn2 by adenovirus infection did not have significant effects on 382
myocardial apoptosis and oxidative stress in WT hearts (Figure S3H-K). Taken 383
together, these data indicate that reconstitution of Mfn2 reduces cardiomyocyte 384
apoptosis and suppresses mitochondrial oxidative stress in diabetic hearts. 385
20
386
Mfn2 overexpression prevented HG/HF-induced mitochondrial fission, whereas 387
Mfn2 knockdown caused mitochondrial fission in cardiomyocytes 388
Mito-tracker red, phalloidin and DAPI have been used to stain the mitochondria, 389
cytoskeleton and nuclear respectively in our preliminary experiment. As shown in 390
Figure S4, there is a cluster of mitochondria in one cell. The nuclear is in the center of 391
the mitochondria, and the cytoskeleton surrounds the mitochondria. The cell 392
boundaries are visible and obvious even without nuclear or cytoplasmic marker. It is 393
easy to identify one cell from the neighboring cells when only using Mito-tracker red. 394
In general, a cluster of mitochondria represents one cell. Then we only use Mito-395
tracker red as the dye in the subsequent experiments. We investigated whether the 396
gain-of-function or loss-of-function manipulation of mitochondrial dynamics proteins 397
caused significant morphological changes in primary cardiomyocytes using 398
MitoTracker Red probe. As shown in Figure S5, in primary cardiomyocytes cultured 399
in low glucose medium (LG, 5.5 mmol/L) for 24 hours, mitochondrial morphology 400
mainly presented as elongated tubules with highly interconnecting networks. There 401
were no significant changes in mitochondrial morphology in cells cultured in high 402
glucose medium (HG, 25mmol/L) or osmolarity control (OC) medium (5.5 mmol/L 403
glucose and 19.5mmol/L mannitol) for 24 hours compared with those cultured in LG. 404
There were also no significant changes in mitochondrial morphology in 405
cardiomyocytes cultured in HG+OA medium (25 mmol/L glucose and 500 μmol/L 406
oleate acid) compared with those cultured in HG (25 mmol/L glucose) medium. 407
21
Nevertheless, after stimulation with HG+PA (25 mmol/L glucose and 500 μmol/L 408
palmitate) or HG+PA+OA (25 mmol/L glucose and 500 μmol/L palmitate and 500 409
μmol/L oleate acid) for 24 hours, mitochondria became fragmented and the expression 410
of Mfn2 was significantly reduced, while there were no significant differences in the 411
expression of other mitochondrial fission-related proteins (total Drp1 and Fis1) and 412
fusion-related proteins (Mfn1 and Opa1) (Figure S5 E-G). These results indicate that 413
palmitate but not oleate acid could induce mitochondrial fission and downregulate the 414
expression of Mfn2. HG was then chosen as the control for all subsequent 415
experiments as it had no significant effects on mitochondrial morphology, while 416
HG+PA was served as HG/HF in this study. Moreover, compared with HG treatments, 417
HG+PA or HG+PA+OA incubation resulted in slightly increased phospho-Ser616-418
Drp1 expression and decreased phospho-Ser637-Drp1 expression (Figure S5E and F). 419
Notably, as shown in Figure 5, transfection with the adenovirus encoding Mfn2 (Ad-420
Mfn2) increased the expression of Mfn2 (Figure 5A and 5B) and prevented 421
mitochondrial fission (Figure 5D-G) in HG/HF-treated cells, whereas silencing Mfn2 422
expression with the adenovirus encoding Mfn2 shRNA (Ad-Mfn2 shRNA) induced 423
excessive mitochondrial fission in control normal cardiomyocytes (Figure5A, 5C and 424
5D-G). 425
426
Mfn2 overexpression inhibited HG/HF-induced mitochondria-dependent 427
apoptosis, whereas Mfn2 knockdown induced mitochondria-dependent apoptosis 428
Cardiomyocyte apoptosis was examined in vitro by flow cytometry and western 429
22
blot analysis. As shown in Figure 6, up-regulated Mfn2 remarkably reduced cell 430
apoptosis in HG/HF-treated cardiomyocytes, as evidenced by decreased percentages 431
of apoptotic cells (Figure 6A) and decreased expression of cleaved caspase-3 (Figure 432
6B). Moreover, Mfn2 overexpression significantly increased the mitochondrial 433
membrane potential (Figure 6D) and inhibited the release of cytochrome c from 434
mitochondria (Figure 6C), indicating that up-regulation of Mfn2 inhibits 435
mitochondria-dependent apoptosis in HG/HF-treated cardiomyocytes. In contrast, as 436
shown in Figure 7, silencing Mfn2 expression with Ad-Mfn2 shRNA significantly 437
induced mitochondria-dependent apoptosis in control normal cardiomyocytes as 438
evidenced by increased percentages of apoptotic cells, up-regulated expression of 439
cleaved caspase-3, elevated release of cytochrome c and decreased mitochondrial 440
membrane potential. In addition, Mfn2 knockdown further exacerbated HG/HF-441
induced mitochondria-dependent apoptosis. 442
443
Mfn2 overexpression protected against HG/HF-induced mitochondrial 444
dysfunction, whereas Mfn2 knockdown induced mitochondrial dysfunction 445
Further investigation of mitochondrial oxidative stress and mitochondrial 446
function (respiratory capacity) was carried out in cardiomyocytes. As shown in Figure 447
8A-C, HG/HF culture leaded to increased cellular ROS (shown as green) as well as 448
mitochondria-derived ROS (shown as red). The co-staining (shown as yellow) results 449
suggested that mitochondria are the major source of cellular ROS. Overexpression of 450
Mfn2 reduced both total cellular ROS and mitochondria-derived ROS in HG/HF-451
23
treated cardiomyocytes. HG/HF suppressed the mitochondrial respiratory capacity 452
including basal respiration, ATP-linked respiration, maximal respiration, and spare 453
respiration, all of which were significantly improved by Mfn2 overexpression (Figure 454
8D). In contrast, knockdown of Mfn2 increased mitochondria-derived ROS and 455
impaired the mitochondrial respiratory capacity in control normal cardiomyocytes, 456
suggesting enhanced mitochondrial oxidative stress and disturbed mitochondrial 457
function in Mfn2-knockdown cells. 458
To further confirm whether mitochondrial fusion played a major role in mfn2-459
mediated protective effects, an activator of mitochondrial fission, FCCP (10 μM, 460
Selleck Chemicals, USA) [33], or recombinant adenovirus expressing Drp1 (Ad-461
Drp1) was used to recall the fission in the cardiomyocyte transfected with Ad-Mfn2. 462
As shown in Figure S6, in HG/HF-treated cardiomyocytes without Mfn2 463
overexpression, FCCP or Ad-Drp1 had no significant effects on the percentage of cells 464
with mitochondrial fragmentation and the percentage of apoptotic cells. Nevertheless, 465
application of FCCP or Ad-Drp1 in Mfn2-overexpressed cells blunted the protective 466
effects of Mfn2 on cell apoptosis, mitochondrial membrane potential, and 467
mitochondria-derived ROS. In contrast, M1 (5 μM, Sigma-Aldrich, USA), a small 468
molecule that promotes the fusion of genetically induced fragmented 469
mitochondria[34], was used to restore the mitochondrial fusion in the cardiomyocyte 470
transfected with Ad-Mfn2 shRNA, The cardiomyocytes transfected with Ad-Mfn2 471
shRNA were incubated with M1 for another 24 hours. As shown in Figure S7, M1 472
treatment restored mitochondrial fusion and exerted the protective effects on cell 473
24
apoptosis, mitochondrial membrane potential and mitochondria-derived ROS in 474
Mfn2-knockdown cardiomyocytes. All these findings suggest that Mfn2 475
overexpression alleviates HG/HF-induced mitochondrial dysfunction by promoting 476
mitochondrial fusion, whereas Mfn2 knockdown disrupts mitochondrial function by 477
inducing mitochondrial fission. 478
479
The transcription of Mfn2 was directly regulated by PPARα 480
The study above has shown that the expression of Mfn2 in diabetic hearts is 481
mainly down-regulated at the transcriptional level, then the transcriptional mechanism 482
underlying the down-regulation of Mfn2 was finally investigated. Public microarray 483
mRNA expression data derived from the heart failure patients with or without T2DM 484
were downloaded from the Gene Expression Omnibus (GEO) database 485
(https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE26887) to evaluate the 486
correlations between the mRNA expression of Mfn2 and several potential 487
transcription factors (PGC-1α, PPARα, PPARγ, PPARδ, Stat3, and FoxO1) in human 488
hearts (Figure 9A and Figure S8). Pearson correlation analysis indicated that only 489
PPARα had a significant positive correlation with Mfn2 (Figure 9A left, r=0.7304, 490
P<0.01). The correlation became even more significant when only heart tissues from 491
heart failure patients with DM were analysed (Figure 9A right, r=0.9167, P<0.01). 492
Consistently, the protein levels of PPARα were down-regulated in the hearts of 12-493
week-old db/db mouse when compared with the hearts of age-matched db/+mouse. 494
The down-regulation of PPARα became more obvious in the hearts of 16-week-old 495
25
db/db mice (Figure 9B). Moreover, it was shown in Figure 9C and S9A that the 496
expression of PPARα was also significantly reduced in the cardiomyocytes cultured in 497
HG/HF medium compared with those cultured in Con. Overexpression of PPARα 498
with Ad-PPARα significantly increased the expression and mRNA level of Mfn2 and 499
inhibited the down-regulation of Mfn2 and mitochondrial fission induced by HG/HF 500
(Figure 9C-H), whereas knockdown of PPARα with siRNA exhibited the opposite 501
effect (Figure S9). 502
ChIP and PCR analysis revealed that PPARα bound to the promoter region of the 503
Mfn2 gene in primary cardiomyocytes (Figure 10A). To determine whether PPARα 504
directly regulates Mfn2 transcription, the rat full-length Mfn2 promoter (-2000-0) was 505
cloned upstream from the luciferase reporter gene in the pGL3.0 Basic plasmid (PGL-506
FL-Mfn2 promoter reporter). As shown in Figure 10B, PGL-FL-Mfn2 promoter 507
reporter was co-transfected with Ad-PPARα or Ad-EV into HEK-293T cells, the 508
resultant relative luciferase activity indicated that PPARα induced a robust and 509
positive response. To identify the exact PPARα-binding sites in Mfn2 promoter 510
region, 5’ series promoter deletion fragments were cloned upstream from the 511
luciferase reporter gene in the pGL3.0 Basic plasmid. HEK-293T cells co-transfected 512
with Ad-PPARα and different Mfn2 promoter-reporter constructs were subjected to 513
luciferase reporter assay at 24 hours post-transfection. As shown in Figure 10C, Ad-514
PPARα transfection exerted a similar induction effect on Mfn2-Luc-0 (FL-Mfn2 515
promoter), Mfn2-Luc-1 and Mfn2-Luc-2. However, Ad-PPARα transfection did not 516
significantly promote luciferase activity on Mfn2-Luc-3 and Mfn2-Luc-4, indicating 517
26
that the PPARα regulatory sites were within the Mfn2 promoter region between -1000 518
and -800. Then, the specific PPARα binding sites were predicted by sequencing 519
analysis, a suspicious sequence “GACTGGGGACGGGGTAAG” located in the 520
region from -882 to -865 was found. Furthermore, when sequence 521
“GACTGGGGACGGGGTAAG” was deleted from Mfn2-Luc-2, the luciferase 522
activity induced by Ad-PPARα transfection was reduced by 74% (Figure 10D and E). 523
Together, the concordant results of the ChIP and luciferase reporter studies suggest 524
that PPARα regulates the transcription of Mfn2 by directly binding to the sequence 525
“GACTGGGGACGGGGTAAG” within the promoter. 526
27
Discussion 527
Accumulating evidence has indicated that diabetes result in functional and 528
structural changes of the myocardium. However, the underlying pathological 529
mechanism of DCM (especially in type 2 DCM) is far from clear. Several important 530
observations have been made in the present study. First, we validated that reduced 531
Mfn2 expression and excessive mitochondrial fission were observed in diabetic 532
hearts, which results in mitochondrial dysfunction in DCM. Second, reconstitution of 533
Mfn2 promoted mitochondrial fusion, alleviated mitochondrial dysfunction and 534
consequently inhibited the development of DCM. Last, the down-regulation of Mfn2 535
expression in diabetic cardiomyocytes was due, at least in part, to decreased 536
expression of PPARα (Figure 11). Collectively, our study demonstrates for the first 537
time that imbalanced mitochondrial dynamics is induced by Mfn2 down-regulation 538
and contributes to the development of DCM. Therefore, targeting mitochondrial 539
dynamics by regulating Mfn2 might be a potential therapeutic strategy for DCM. 540
Although mitochondria are often depicted as isolated organelles, they actually 541
form highly dynamic networks. The dynamic cycling of mitochondrial fusion and 542
fission is essential for maintaining various cellular function, including energy 543
production, ROS generation and cell apoptosis[35]. Accumulating evidence has 544
indicated that both mitochondrial oxidative damage and mitochondrial dysfunction are 545
observed in diabetic hearts and contribute to the development of DCM[31, 36]. 546
However, the mechanisms underlying mitochondrial pathology in DCM are still 547
largely unclear. In this study, we provide compelling evidence showing that type 2 548
28
diabetes (hyperglycaemia and hyperlipidaemia) reduces Mfn2 expression and causes 549
excessive mitochondrial fission both in vitro and in vivo. db/db mouse hearts showed 550
reduced Mfn2 expression and impaired cardiac function at 12 weeks of age compared 551
with db/+ mice. Our results are consistent with some existing studies which reported 552
that db/db hearts exhibited a marked reduction in cardiac function at 12 weeks of 553
age[37-40]. Nevertheless, several other studies have reported much later development 554
of cardiac dysfunction at 15-16 weeks of age in db/db mice compared with control 555
mice[23, 41]. In addition, heart rate was significantly lower in db/db mice under 556
conscious or anesthetic condition compared with db/+ mice. The main reason for 557
lower heart rate observed in db/db mice may be due to damaged sympathetic activity. 558
Previous studies have indicated a significant reduction of cardiac norepinephrine 559
concentration and an impairment of axoplasmic transport of norepinephrine in the 560
hearts of db/db diabetic mice[42-44]. The reconstitution of Mfn2 prevents 561
mitochondrial fission and inhibits mitochondrial injury and mitigates the progression 562
of DCM in diabetic db/db mice. In contrast, knockdown of Mfn2 induces 563
mitochondrial fission and mitochondrial dysfunction, which mimics an important 564
molecular characteristic of diabetic cardiomyocytes. These results suggest that 565
decreased Mfn2 in diabetic hearts disrupts the balance of fission and fusion dynamics 566
and then accelerates the progression of DCM. Overall, our study develops a new 567
concept that imbalanced mitochondrial dynamics induced by decreased Mfn2 568
contributes to the development of type 2 DCM, partly by enhancing mitochondrial 569
oxidative stress and mitochondria-dependent apoptosis. 570
29
Mitochondrial morphologic abnormalities and dysfunction represent common 571
observations in both type 1 and type 2 diabetes, while it seems that the fission/fusion 572
proteins are differently affected. Our previous study has demonstrated that enhanced 573
mitochondrial fission was mediated by increased expression of fission-related 574
proteinDrp1 in STZ-induced type 1 diabetic hearts[24]. In this study, increased 575
mitochondrial fission was caused by the down-regulation of fusion-related protein 576
Mfn2 in type 2 diabetic hearts of db/db mice. The microenvironment enveloping 577
cardiac myocytes in type 2 diabetes is distinct from that of type 1 diabetes, which may 578
result in different changes of fission/fusion proteins in the heart. Consistent with the 579
findings of our study, Bach et al. reported that Mfn2 was significantly down-regulated 580
in human skeletal muscle at both the mRNA and protein levels in type 2 diabetes[45]. 581
Another in vivo study also showed that Mfn2 was reduced in rat cardiac tissue in 582
different stages of diabetes[46]. Nevertheless, cardiac tissues from type 2 DM patients 583
showed reduced expression of Mfn1[47]. The inconsistent results may be due to the 584
fact that the biopsies were taken from the right atrium, not the left ventricular tissue 585
where the DCM pathology is the most obvious[48]. 586
Mfn2 was originally identified as a mitochondrial protein mediating 587
mitochondrial outer membrane fusion. Interestingly, recent data have shown that 588
Mfn2 appears to have a number of pleiotropic non-fusion roles, which plays an 589
important role in cardiac disease. Mfn2 has been reported to tether the endoplasmic 590
reticulum to the mitochondria for Ca2+
signalling from the endoplasmic reticulum to 591
mitochondria[49, 50]. Moreover, Mfn2 plays a crucial role in the cardiac autophagic 592
30
process by facilitating the fusion between autophagosome and lysosome, and Mfn2 593
deficiency impairs autophagosome-lysosome fusion and gradually leads to cardiac 594
vulnerability and dysfunction[51, 52]. In our study, the protective effects of Mfn2 in 595
HG/HF-treated cardiomyocytes are blunted by fission activator FCCP, while fusion 596
activator M1 restored mitochondrial fusion and exerted the protective effects in Mfn2-597
knockdown cardiomyocytes, suggesting that imbalanced mitochondrial dynamics 598
induced by down-regulated Mfn2 could be the main cause of cardiac dysfunction in 599
diabetic hearts. Nevertheless, other non-fusion roles besides Mfn2 defect such as 600
impaired autophagosome degradation and the disruption of endoplasmic 601
reticulum−mitochondria signalling may also be involved in the pathogenesis of DCM, 602
which can be reversed by the reconstitution of Mfn2. In our study, mitochondrial 603
fission activator FCCP or Ad-Drp1 have no significant effects on the percentage of 604
cells with mitochondrial fragmentation and the percentage of apoptotic cells in 605
HG/HF-treated cardiomyocytes without Mfn2 overexpression. The reason for this 606
may be that there exist shared mechanisms of action between HG/HF and FCCP or 607
Ad-Drp1 treatments. As shown in our study, HG/HF-treated cardiomyocytes exhibit 608
reduced mitochondrial membrane potential and increased expression of phospho-609
Ser616-Drp1 (the active form of Drp1), which are similar with the actions of FCCP or 610
Ad-Drp1. 611
Increased incidence of cardiac arrhythmias was also identified in DCM animals 612
in recent studies[53, 54]. Emerging evidence indicates that mitochondrial dysfunction 613
can impair cardiac electrical functioning by disturbing the intracellular ion 614
31
homeostasis and membrane excitability through decreased ATP production and 615
excessive reactive oxygen species (ROS) generation, resulting in increased 616
susceptibility to cardiac arrhythmias[55]. In our study, reconstitution of Mfn2 617
suppressed mitochondrial ROS generation and improved mitochondrial function in 618
DCM. Moreover, previous study has shown that vagus nerve stimulation exerted 619
cardioprotection against myocardial ischemia/reperfusion injury via attenuation of 620
mitochondrial dysfunction, increased mitochondrial fusion, decreased mitochondrial 621
fission[56]. Although there was no study investigating the role of Mfn2 in cardiac 622
arrhythmias up to now, it is speculated that overexpression of Mfn2 may reduce the 623
incidence of cardiac arrhythmias in DCM by inhibiting mitochondrial oxidative stress 624
and ameliorating mitochondrial dysfunction. 625
Another important finding of the present study is that down-regulated Mfn2 in 626
diabetic hearts is partly attributed to decreased expression of transcription factor 627
PPARα, which is supported by the suppression of PPARα observed in various tissue 628
from animal models and patients with type 2 diabetes[57, 58]. PPARα, a main 629
member of the nuclear receptor super family PPARs, plays a critical role in the lipid 630
metabolism by regulating their oxidation and storage[59]. Moreover, PPARα has been 631
reported to suppress the myocardial inflammatory responses when activated by 632
synthetic ligands[60, 61]. Reduced expression of PPARα is observed in pressure 633
overload-induced cardiac hypertrophy[62, 63]. In the present study, we found that 634
overexpression of PPARα increases the expression of Mfn2 and promotes 635
mitochondrial fusion in HG/HF-treated cardiomyocytes, whereas knockdown of 636
32
PPARα exhibits the opposite effect. Elezabya et al. have reported that both PPARα 637
and Mfn2 are significantly down-regulated in mice with cardiomyocyte-specific lipid 638
overload, accompanied by marked decreases in mitochondrial size[64]. In addition, 639
previous study has showed that chronic exposure to fatty acid excess downregulates 640
PPARα expression in the cardiomyocytes, the downregulation of PPARα may lead to 641
further myocardial damage by suppressing cellular free fatty acid oxidation[65]. It 642
seems that the downregulation of PPARα and Mfn2 is a result of dysregulated lipid 643
metabolism in diabetic hearts. 644
This study has several limitations. First, as a result of ethical issues, the 645
expression of Mfn2 cannot be determined in the left ventricular tissue of diabetic 646
patients. Second, not all the conclusions were obtained from in vivo study. Third, the 647
cause of down-regulated Mfn2 in DCM is still largely unknown, although we 648
identified the suppression of PPARα was involved. The significant positive correlation 649
between the expression of Mfn2 and PPARα was proved from public microarray 650
mRNA expression data derived from the heart failure patients with or without 651
diabetes. Since clinical metabolic/functional data was not included in this database, it 652
is hard for us to correlate Mfn2 and PPARα expression in human heart tissue with 653
clinical metabolic/functional data and to quantify expression of some of the proteins 654
analysed in the main experimental study. Maybe further study is needed to clarify the 655
correlation between PPARα/Mfn2 and clinical metabolic/functional data in diabetic 656
patients. Despite these limitations, we believe that our study has provided important 657
new insights for understanding the role of abnormal mitochondrial dynamics in type 2 658
33
DCM. 659
In summary, our study provides compelling evidence that imbalanced 660
mitochondrial dynamics induced by down-regulated Mfn2 promoted mitochondrial 661
dysfunction and diabetic cardiomyopathy, and the reconstitution of mitochondrial 662
fusion through overexpression of Mfn2 restores mitochondrial homeostasis and 663
alleviates the development of diabetic cardiomyopathy. The findings suggest that 664
targeting mitochondrial dynamics by regulating Mfn2 might be a potential therapeutic 665
strategy for diabetic cardiomyopathy. 666
667
Abbreviations 668
ATP: adenosine-triphosphate; DCM: diabetic cardiomyopathy; DM: diabetes mellitus; 669
Drp1: dynamic-related protein1; FCCP: carbonyl cyanide m-chlorophenylhydrazone; 670
Fis1: mitochondrial fission 1 protein; FoxO1: forkhead box protein O1; LVEF: left 671
ventricular ejection fraction; LVFS: left ventricular fraction shortening; MnSOD: 672
manganese superoxide dismutase; MDA: malondialdehyde; Mfn1: Mitofusin1; Mfn2: 673
mitofusin2; Nox4: NADPH oxidase 4; Opa1: optic atrophy 1; OCR: oxygen 674
consumption rate; PPARα: peroxisome proliferators-activated receptors alpha; 675
PPARγ: peroxisome proliferators-activated receptors gamma; PPARδ: peroxisome 676
proliferators-activated receptors delta; PGC-1α: Peroxisome proliferator-activated 677
receptor gamma co-activator 1-alpha; ROS: reactive oxygen spices; STZ: 678
Streptozocin; Stat3: Signal transducer and activator of transcription 3; TG: 679
triglyceride; TC: total cholesterol. 680
34
681
Acknowledgement 682
This work was supported by the grants from the National Natural Science Foundation 683
of China (No. 81770369, No. 81570252, No. 81670354, No. 81600235), Key 684
Research and Development Plan of Shaanxi (No. 2018SF-294) and the Fundamental 685
Research Funds for the Central Universities (No. xzy012019115). 686
687
Contributions 688
Yan Li and Feng Fu conceived and designed the study. Lang Hu, Mingge Ding, Daishi 689
Tang, Kaiyan Wang and Feng Fu performed the animal experiments. Lang Hu, 690
Mingge Ding, Daishi Tang, Kaiyan Wang and Jihuan Qiu carried out the cell 691
experiments. Lang Hu, Mingge Ding, Daishi Tang, Huishou Zhao and Pan Chang 692
performed the molecular biology experiments. Lang Hu, Mingge Ding, Daishi Tang 693
and Bingchao Qi analyzed the data. Lang Hu drafted the manuscript. Feng Fu and Yan 694
Li revised and edited the manuscript. All authors have read and approved the final 695
version of this manuscript. 696
697
Competing interests 698
The authors declare that they have no competing interest. 699
700
35
Reference: 701
1. Wild S, Roglic G, Green A, Sicree R, King H. Global prevalence of diabetes: 702
estimates for the year 2000 and projections for 2030. Diabetes Care. 2004; 27: 1047-703
53. 704
2. Yach D, Stuckler D, Brownell KD. Epidemiologic and economic consequences of 705
the global epidemics of obesity and diabetes. Nat Med. 2006; 12: 62-6. 706
3. Bugger H, Abel ED. Molecular mechanisms of diabetic cardiomyopathy. 707
Diabetologia. 2014; 57: 660-71. 708
4. Nathan DM. Diabetes: Advances in Diagnosis and Treatment. Jama. 2015; 314: 709
1052-62. 710
5. Aon MA, Tocchetti CG, Bhatt N, Paolocci N, Cortassa S. Protective mechanisms 711
of mitochondria and heart function in diabetes. Antioxid Redox Signal. 2015; 22: 712
1563-86. 713
6. Schilling JD. The mitochondria in diabetic heart failure: from pathogenesis to 714
therapeutic promise. Antioxid Redox Signal. 2015; 22: 1515-26. 715
7. Verma SK, Garikipati VNS, Kishore R. Mitochondrial dysfunction and its impact 716
on diabetic heart. Biochim Biophys Acta Mol Basis Dis. 2017; 1863: 1098-105. 717
8. Anderson EJ, Kypson AP, Rodriguez E, Anderson CA, Lehr EJ, Neufer PD. 718
Substrate-specific derangements in mitochondrial metabolism and redox balance in 719
the atrium of the type 2 diabetic human heart. J Am Coll Cardiol. 2009; 54: 1891-8. 720
9. Ansley DM, Wang B. Oxidative stress and myocardial injury in the diabetic heart. 721
J Pathol. 2013; 229: 232-41. 722
36
10. Galloway CA, Yoon Y. Mitochondrial dynamics in diabetic cardiomyopathy. 723
Antioxid Redox Signal. 2015; 22: 1545-62. 724
11. Wai T, Langer T. Mitochondrial Dynamics and Metabolic Regulation. Trends 725
Endocrinol Metab. 2016; 27: 105-17. 726
12. Vasquez-Trincado C, Garcia-Carvajal I, Pennanen C, Parra V, Hill JA, Rothermel 727
BA, et al. Mitochondrial dynamics, mitophagy and cardiovascular disease. J Physiol. 728
2016; 594: 509-25. 729
13. Chiong M, Cartes-Saavedra B, Norambuena-Soto I, Mondaca-Ruff D, Morales 730
PE, Garcia-Miguel M, et al. Mitochondrial metabolism and the control of vascular 731
smooth muscle cell proliferation. Front Cell Dev Biol. 2014; 2: 72. 732
14. Ong SB, Hall AR, Hausenloy DJ. Mitochondrial dynamics in cardiovascular 733
health and disease. Antioxid Redox Signal. 2013; 19: 400-14. 734
15. Serasinghe MN, Chipuk JE. Mitochondrial Fission in Human Diseases. Handb 735
Exp Pharmacol. 2017; 240: 159-88. 736
16. Kelley DE, He J, Menshikova EV, Ritov VB. Dysfunction of mitochondria in 737
human skeletal muscle in type 2 diabetes. Diabetes. 2002; 51: 2944-50. 738
17. Dabkowski ER, Baseler WA, Williamson CL, Powell M, Razunguzwa TT, 739
Frisbee JC, et al. Mitochondrial dysfunction in the type 2 diabetic heart is associated 740
with alterations in spatially distinct mitochondrial proteomes. Am J Physiol Heart Circ 741
Physiol. 2010; 299: H529-40. 742
18. Lee H, Yoon Y. Mitochondrial fission and fusion. Biochem Soc Trans. 2016; 44: 743
1725-35. 744
37
19. van der Bliek AM, Shen Q, Kawajiri S. Mechanisms of mitochondrial fission and 745
fusion. Cold Spring Harb Perspect Biol. 2013; 5. 746
20. Nan J, Zhu W, Rahman MS, Liu M, Li D, Su S, et al. Molecular regulation of 747
mitochondrial dynamics in cardiac disease. Biochim Biophys Acta Mol Cell Res. 748
2017; 1864: 1260-73. 749
21. Ding M, Dong Q, Liu Z, Liu Z, Qu Y, Li X, et al. Inhibition of dynamin-related 750
protein 1 protects against myocardial ischemia-reperfusion injury in diabetic mice. 751
Cardiovasc Diabetol. 2017; 16: 19. 752
22. Marin-Garcia J, Akhmedov AT. Mitochondrial dynamics and cell death in heart 753
failure. Heart Fail Rev. 2016; 21: 123-36. 754
23. Ji L, Liu F, Jing Z, Huang Q, Zhao Y, Cao H, et al. MICU1 alleviates diabetic 755
cardiomyopathy through mitochondrial Ca2+
-dependent antioxidant response. 756
Diabetes. 2017; 66: 1586-600. 757
24. Ding M, Feng N, Tang D, Feng J, Li Z, Jia M, et al. Melatonin prevents Drp1-758
mediated mitochondrial fission in diabetic hearts through SIRT1-PGC1alpha pathway. 759
J Pineal Res. 2018; 65: e12491. 760
25. Chen L, Gong Q, Stice JP, Knowlton AA. Mitochondrial OPA1, apoptosis, and 761
heart failure. Cardiovasc Res. 2009; 84: 91-9. 762
26. Nan J, Hu H, Sun Y, Zhu L, Wang Y, Zhong Z, et al. TNFR2 Stimulation 763
Promotes Mitochondrial Fusion via Stat3- and NF-kB-Dependent Activation of OPA1 764
Expression. Circ Res. 2017; 121: 392-410. 765
27. Ma M, Song L, Yan H, Liu M, Zhang L, Ma Y, et al. Low dose tunicamycin 766
38
enhances atherosclerotic plaque stability by inducing autophagy. Biochem Pharmacol. 767
2016; 100: 51-60. 768
28. Liu M, Lu S, He W, Zhang L, Ma Y, Lv P, et al. ULK1-regulated autophagy: A 769
mechanism in cellular protection for ALDH2 against hyperglycemia. Toxicol Lett. 770
2018; 283: 106-15. 771
29. Feng Y, Bopassa JC. Oxygen surrounding the heart during ischemic conservation 772
determines the myocardial injury during reperfusion. Am J Cardiovasc Dis. 2015; 5: 773
127-39. 774
30. Maddocks OD, Berkers CR, Mason SM, Zheng L, Blyth K, Gottlieb E, et al. 775
Serine starvation induces stress and p53-dependent metabolic remodelling in cancer 776
cells. Nature. 2013; 493: 542-6. 777
31. Fillmore N, Mori J, Lopaschuk GD. Mitochondrial fatty acid oxidation alterations 778
in heart failure, ischaemic heart disease and diabetic cardiomyopathy. Br J Pharmacol. 779
2014; 171: 2080-90. 780
32. Maalouf RM, Eid AA, Gorin YC, Block K, Escobar GP, Bailey S, et al. Nox4-781
derived reactive oxygen species mediate cardiomyocyte injury in early type 1 782
diabetes. Am J Physiol Cell Physiol. 2012; 302: C597-604. 783
33. Jin Q, Li R, Hu N, Xin T, Zhu P, Hu S, et al. DUSP1 alleviates cardiac 784
ischemia/reperfusion injury by suppressing the Mff-required mitochondrial fission 785
and Bnip3-related mitophagy via the JNK pathways. Redox Biol. 2018; 14: 576-87. 786
34. Wang D, Wang J, Bonamy GM, Meeusen S, Brusch RG, Turk C, et al. A small 787
molecule promotes mitochondrial fusion in mammalian cells. Angew Chem Int Ed 788
39
Engl. 2012; 51: 9302-5. 789
35. Nasrallah CM, Horvath TL. Mitochondrial dynamics in the central regulation of 790
metabolism. Nat Rev Endocrinol. 2014; 10: 650-8. 791
36. Blake R, Trounce IA. Mitochondrial dysfunction and complications associated 792
with diabetes. Biochim Biophys Acta. 2014; 1840: 1404-12. 793
37. Semeniuk LM, Kryski AJ, Severson DL. Echocardiographic assessment of 794
cardiac function in diabetic db/db and transgenic db/db-hGLUT4 mice. Am J Physiol 795
Heart Circ Physiol. 2002; 283: H976-82. 796
38. Aasum E, Hafstad AD, Severson DL, Larsen TS. Age-dependent changes in 797
metabolism, contractile function, and ischemic sensitivity in hearts from db/db mice. 798
Diabetes. 2003; 52: 434-41. 799
39. Yue P, Arai T, Terashima M, Sheikh AY, Cao F, Charo D, et al. Magnetic 800
resonance imaging of progressive cardiomyopathic changes in the db/db mouse. Am J 801
Physiol Heart Circ Physiol. 2007; 292: H2106-18. 802
40. Aasum E, Belke DD, Severson DL, Riemersma RA, Cooper M, Andreassen M, et 803
al. Cardiac function and metabolism in Type 2 diabetic mice after treatment with BM 804
17.0744, a novel PPAR-alpha activator. Am J Physiol Heart Circ Physiol. 2002; 283: 805
H949-57. 806
41. Pereira L, Matthes J, Schuster I, Valdivia HH, Herzig S, Richard S, et al. 807
Mechanisms of Ca2+
transient decrease in cardiomyopathy of db/db type 2 diabetic 808
mice. Diabetes. 2006; 55: 608-15. 809
42. Giachetti A. Axoplasmic transport of noradrenaline in the sciatic nerves of 810
40
spontaneously diabetic mice. Diabetologia. 1979; 16: 191-4. 811
43. Tessari F, Travagli RA, Zanoni R, Prosdocimi M. Effects of long-term diabetes 812
and treatment with gangliosides on cardiac sympathetic innervation: a biochemical 813
and functional study in mice. J Diabet Complications. 1988; 2: 34-7. 814
44. Lehnen AM, Rodrigues B, Irigoyen MC, De Angelis K, Schaan BD. 815
Cardiovascular changes in animal models of metabolic syndrome. J Diabetes Res. 816
2013; 2013: 761314. 817
45. Bach D, Naon D, Pich S, Soriano FX, Vega N, Rieusset J, et al. Expression of 818
Mfn2, the Charcot-Marie-Tooth neuropathy type 2A gene, in human skeletal muscle: 819
effects of type 2 diabetes, obesity, weight loss, and the regulatory role of tumor 820
necrosis factor alpha and interleukin-6. Diabetes. 2005; 54: 2685-93. 821
46. Gao Q, Wang XM, Ye HW, Yu Y, Kang PF, Wang HJ, et al. Changes in the 822
expression of cardiac mitofusin-2 in different stages of diabetes in rats. Mol Med Rep. 823
2012; 6: 811-4. 824
47. Montaigne D, Marechal X, Coisne A, Debry N, Modine T, Fayad G, et al. 825
Myocardial contractile dysfunction is associated with impaired mitochondrial function 826
and dynamics in type 2 diabetic but not in obese patients. Circulation. 2014; 130: 554-827
64. 828
48. Lorenzo-Almoros A, Tunon J, Orejas M, Cortes M, Egido J, Lorenzo O. 829
Diagnostic approaches for diabetic cardiomyopathy. Cardiovasc Diabetol. 2017; 16: 830
28. 831
49. de Brito OM, Scorrano L. Mitofusin 2 tethers endoplasmic reticulum to 832
41
mitochondria. Nature. 2008; 456: 605-10. 833
50. Merkwirth C, Langer T. Mitofusin 2 builds a bridge between ER and 834
mitochondria. Cell. 2008; 135: 1165-7. 835
51. Zhao T, Huang X, Han L, Wang X, Cheng H, Zhao Y, et al. Central role of 836
mitofusin 2 in autophagosome-lysosome fusion in cardiomyocytes. J Biol Chem. 837
2012; 287: 23615-25. 838
52. Chen Y, Dorn GW, 2nd. PINK1-phosphorylated mitofusin 2 is a Parkin receptor 839
for culling damaged mitochondria. Science. 2013; 340: 471-5. 840
53. Liu Z, Cai H, Zhu H, Toque H, Zhao N, Qiu C, et al. Protein kinase RNA-like 841
endoplasmic reticulum kinase (PERK)/calcineurin signaling is a novel pathway 842
regulating intracellular calcium accumulation which might be involved in ventricular 843
arrhythmias in diabetic cardiomyopathy. Cell Signal. 2014; 26: 2591-600. 844
54. Soliman H, Nyamandi V, Garcia-Patino M, Zhang PC, Lin E, Jia ZP, et al. 845
ROCK2 promotes ryanodine receptor phosphorylation and arrhythmic calcium release 846
in diabetic cardiomyocytes. Int J Cardiol. 2019; 281: 90-8. 847
55. Yang KC, Bonini MG, Dudley SC, Jr. Mitochondria and arrhythmias. Free Radic 848
Biol Med. 2014; 71: 351-61. 849
56. Nuntaphum W, Pongkan W, Wongjaikam S, Thummasorn S, Tanajak P, 850
Khamseekaew J, et al. Vagus nerve stimulation exerts cardioprotection against 851
myocardial ischemia/reperfusion injury predominantly through its efferent vagal 852
fibers. Basic Res Cardiol. 2018; 113: 22. 853
57. Hu Y, Chen Y, Ding L, He X, Takahashi Y, Gao Y, et al. Pathogenic role of 854
42
diabetes-induced PPAR-alpha down-regulation in microvascular dysfunction. Proc 855
Natl Acad Sci U S A. 2013; 110: 15401-6. 856
58. Ding J, Li M, Wan X, Jin X, Chen S, Yu C, et al. Effect of miR-34a in regulating 857
steatosis by targeting PPARalpha expression in nonalcoholic fatty liver disease. Sci 858
Rep. 2015; 5: 13729. 859
59. Han L, Shen WJ, Bittner S, Kraemer FB, Azhar S. PPARs: regulators of 860
metabolism and as therapeutic targets in cardiovascular disease. Part I: PPAR-alpha. 861
Future Cardiol. 2017; 13: 259-78. 862
60. Okayasu T, Tomizawa A, Suzuki K, Manaka K, Hattori Y. PPARalpha activators 863
upregulate eNOS activity and inhibit cytokine-induced NF-kappaB activation through 864
AMP-activated protein kinase activation. Life Sci. 2008; 82: 884-91. 865
61. Marx N, Sukhova GK, Collins T, Libby P, Plutzky J. PPARalpha activators inhibit 866
cytokine-induced vascular cell adhesion molecule-1 expression in human endothelial 867
cells. Circulation. 1999; 99: 3125-31. 868
62. Sorokina N, O'Donnell JM, McKinney RD, Pound KM, Woldegiorgis G, LaNoue 869
KF, et al. Recruitment of compensatory pathways to sustain oxidative flux with 870
reduced carnitine palmitoyltransferase I activity characterizes inefficiency in energy 871
metabolism in hypertrophied hearts. Circulation. 2007; 115: 2033-41. 872
63. Barger PM, Kelly DP. PPAR signaling in the control of cardiac energy 873
metabolism. Trends Cardiovasc Med. 2000; 10: 238-45. 874
64. Elezaby A, Sverdlov AL, Tu VH, Soni K, Luptak I, Qin F, et al. Mitochondrial 875
remodeling in mice with cardiomyocyte-specific lipid overload. J Mol Cell Cardiol. 876
43
2015; 79: 275-83. 877
65. Lee TI, Kao YH, Chen YC, Huang JH, Hsiao FC, Chen YJ. Peroxisome 878
proliferator-activated receptors modulate cardiac dysfunction in diabetic 879
cardiomyopathy. Diabetes Res Clin Pract. 2013; 100: 330-9. 880
881
882
44
Figures 883
884
Figure 1 Excessive mitochondrial fission and reduced Mfn2 expression were 885
observed in diabetic hearts of 12-week-old db/db mice (A) Representative 886
echocardiography images. LVIDd and LVIDs were labeled. (B) Representative 887
transmission electron microscopic images of the myocardium, mitochondria were 888
labeled by asterisks. Scale bar = 1 μm. (C) LVEF, left ventricular ejection fraction (D) 889
LVFS, left ventricular fractional shortening. (E) Mean size of mitochondria. (F) The 890
45
number of mitochondria per um2. (G) Representative blot images of mitochondrial 891
fission-related proteins (Drp1 and Fis1) and fusion-related proteins (Opa1, Mfn1 and 892
Mfn2). (H) Quantitative analysis of Mfn2 protein expression. (I) Quantitative analysis 893
of S-616-Drp1 protein expression. (J) Quantitative analysis of S-637-Drp1 protein 894
expression. (K) Real-time PCR analysis of Mfn2 mRNA expression. (L) 895
Representative immunohistochemical stains of Mfn2 in mouse hearts. Scale bars = 50 896
μm. * P<0.05 vs. db/+; **P<0.01 vs. db/+. n = 8 animals. 897
898
46
899
Figure 2 Reconstitution of Mfn2 prevents mitochondrial fission and DCM in 900
db/db mice (A) Schematic representation of the experimental protocols. (B, C) 901
Representative blot images and quantitative analysis of Mfn2 expression. (D) 902
Representative transmission electron microscopic images of the myocardium, 903
mitochondria were labeled by asterisks. Scale bars=1 μm. (E) Representative 904
immunohistochemical stains of Mfn2 in mouse hearts. Scale bars = 50 μm. (F) Mean 905
area of mitochondria. (G) The number of mitochondria per um2. (H) Representative 906
M-mode echocardiography images. LVIDs and LVIDd were labeled. (I) LVEF, left 907
47
ventricular ejection fraction (J) LVFS, left ventricular fractional shortening. (K) Heart 908
rate of db/+ and db/db mice under conscious or anesthetic condition. (L) 909
Representative Doppler echocardiography images. (M) E/A ratio. Ad-EV, control 910
adenovirus; Ad-Mfn2, recombinant adenovirus encoding Mfn2. **P<0.01 vs. db/+ + 911
Ad-EV. ##P<0.01 vs. db/db + Ad-EV. †P<0.05 vs. db/+ + Ad-EV (conscious). ††912
P<0.01 vs. db/+ + Ad-EV (conscious). ‡ P<0.05 vs. db/db + Ad-EV (conscious). ^ 913
P<0.05 vs. db/+ + Ad-EV (anesthetic). &P<0.05 vs. db/db + Ad-EV (anesthetic). n = 914
8 animals. 915
916
48
917
Figure 3 Reconstitution of Mfn2 alleviated cardiac hypertrophy and fibrosis in 918
diabetic db/db mice. (A) The gross morphology of hearts stained by hematoxylin and 919
eosin staining. Scale bar = 2mm. (B) The ratio of heart weight to tibia length. (C, D) 920
Representative images of wheat germ agglutinin staining and quantitative analysis of 921
the cross-sectional area of cardiomyocytes. Scale bar= 20 μm. (E, F) Representative 922
images of Masson trichrome staining of hearts and quantitative analysis of interstitial 923
fibrosis. Scale bars=25 μm. Ad-EV, control adenovirus; Ad-Mfn2, recombinant 924
adenovirus encoding Mfn2; CSA, cross-sectional area. **P<0.01 vs. db/+ + Ad-EV. 925
#P<0.05 vs. db/db + Ad-EV. ##P<0.01 vs. db/db + Ad-EV. n=8 animals. 926
927
49
928
Figure 4 Reconstitution of Mfn2 inhibited cell apoptosis and oxidative stress in 929
diabetic hearts. (A) Representative photomicrographs of TUNEL-stained and DAPI-930
stained heart sections. Green fluorescence shows TUNEL-positive nuclei; Blue 931
50
fluorescence shows nuclei of total cardiomyocytes (DAPI-positive). Scale bar = 50 932
μm. (B) Percentage of TUNEL-positive nuclei. (C) Representative blot images and 933
quantitative analysis of cleaved-caspase 3 and total caspase 3. (D) Representative 934
microphotographs of DHE staining in heart sections. Scale bar=50 μm. (E) 935
Quantitative analysis of DHE fluorescence density (fold over db/+ +Ad-EV). (F) 936
Representative blot images and quantitative analysis of Nox4 protein expression. (G) 937
Myocardial malondialdehyde (MDA) content. (H) Mitochondrial manganese 938
superoxide dismutase (MnSOD) activity. (I) Time-dependent increase of 939
mitochondrial ROS related fluorescence density. (J) Isolated mitochondrial H2O2 940
production. Ad-EV, control adenovirus; Ad-Mfn2, recombinant adenovirus encoding 941
Mfn2. **P<0.01 vs. db/+ +Ad-EV. ##P<0.01 vs. db/db+Ad-EV. n=6-8 animals. 942
943
51
944
Figure 5 Mfn2 overexpression prevented HG/HF-induced mitochondrial fission, 945
whereas Mfn2 knockdown caused mitochondrial fission in cardiomyocytes. (A) 946
Representative blot images of Mfn2. (B, C) Quantitative analysis of Mfn2 protein 947
expression. (D) Representative confocal microscope images showing mitochondrial 948
morphology stained by MitoTracker Red. Original magnification ×600. (E) The 949
number of mitochondria per cell. (F) Mean volume of mitochondria (fold over 950
Con+Ad-EV). (G) The percentage of cells with fragmented mitochondria. Ad-EV, 951
control adenovirus; Ad-Mfn2, recombinant adenovirus encoding Mfn2; Ad-Mfn2-952
shRNA, recombinant adenovirus encoding short hairpin RNA against Mfn2; HG/HF, 953
high-glucose and high-fat medium (25 mmol/L glucose and 500 μmol/L palmitate). 954
52
**P<0.01 vs. con + Ad-EV. #P<0.05, ##P<0.01 vs. HG/HF + Ad-EV. n = 6 in each 955
group. 956
957
53
958
Figure 6 Mfn2 overexpression preserved mitochondrial membrane potential and 959
inhibited mitochondria-dependent apoptosis in HG/HF-treated cardiomyocytes. 960
(A) Flow cytometry analysis of apoptosis by annexin V and PI staining (left) and 961
quantification of apoptotic cells (right) in primary cardiomyocytes. (B) Representative 962
blot images and quantitative analysis of cleaved-caspase 3 expression. (C) 963
Representative blot images and quantitative analysis of cytosolic cytochrome c 964
expression. (D) Flow cytometry analysis (left) and quantification (right) of 965
mitochondrial membrane potential by JC-1 in primary cardiomyocytes. High levels of 966
green fluorescence (x-axis) represent reduced ΔΨm, and high levels of red 967
fluorescence (y-axis) show increased ΔΨm. A decrease in the red/green fluorescence 968
is indicative of loss of ΔΨm. Ad-EV, control adenovirus; Ad-Mfn2, recombinant 969
adenovirus encoding Mfn2; HG/HF, high-glucose and high-fat medium (25 mmol/L 970
glucose and 500 μmol/L palmitate). **P<0.01 vs. Con + Ad-EV. ##P<0.01 vs. 971
54
HG/HF + Ad-EV. n = 6 in each group. 972
973
55
974
Figure 7 Mfn2 knockdown decreased mitochondrial membrane potential and 975
induced mitochondria-dependent apoptosis in control normal cardiomyocytes. 976
(A) Flow cytometry analysis of apoptosis by annexin V and PI staining (left) and 977
quantification of apoptotic cells (right) in primary cardiomyocytes. (B) Representative 978
blot images and quantitative analysis of cleaved-caspase 3 expression. (C) 979
Representative blot images and quantitative analysis of cytosolic cytochrome c 980
expression. (D) Flow cytometry analysis (left) and quantification (right) of 981
mitochondrial membrane potential by JC-1 in primary cardiomyocytes. High levels of 982
green fluorescence (x-axis) represent reduced ΔΨm, and high levels of red 983
fluorescence (y-axis) show increased ΔΨm. A decrease in the red/green fluorescence 984
is indicative of loss of ΔΨm. Ad-EV, control adenovirus; Ad-Mfn2-shRNA, 985
recombinant adenovirus encoding short hairpin RNA against Mfn2; HG/HF, high-986
glucose and high-fat medium (25 mmol/L glucose and 500 μmol/L palmitate). 987
56
**P<0.01 vs. Con + Ad-EV. #P<0.05, ##P<0.01 vs. HG/HF + Ad-EV. n = 6 in each 988
group. 989
990
57
991
Figure 8 Mfn2 overexpression protected against HG/HF-induced mitochondrial 992
dysfunction, whereas Mfn2 knockdown induced mitochondrial dysfunction. (A) 993
Representative confocal microscope images of intracellular ROS and mitochondria 994
derived superoxide production. Original magnification ×600. (B) Quantitative 995
analysis of intracellular ROS density in primary cardiomyocytes (fold over Con + Ad-996
EV). (C) Quantitative analysis of mitochondria derived superoxide production in 997
primary cardiomyocytes (fold over Con + Ad-EV). (D) Oxygen consumption rate 998
58
(OCR) and quantitative statistical analysis of OCR. Ad-EV, control adenovirus; Ad-999
Mfn2, recombinant adenovirus encoding Mfn2; Ad-Mfn2-shRNA, recombinant 1000
adenovirus encoding short hairpin RNA against Mfn2; HG/HF, high-glucose and 1001
high-fat medium (25 mmol/L glucose and 500 μmol/L palmitate). **P<0.01 vs. Con + 1002
Ad-EV, ##P<0.01 vs. HG/HF + Ad-EV. n = 6 in each group. 1003
1004
59
1005
Figure 9 Overexpression of PPARα inhibited the down-regulation of Mfn2 and 1006
mitochondrial fission induced by HG/HF. (A) Correlations between the mRNA 1007
expression levels of PPARα and Mfn2 were evaluated in human hearts based on a 1008
public microarray expression data set (GSE26887). Left: 19 hearts from patients with 1009
heart failure and 5 nonfailing control hearts. Right: Only 7 hearts from type 2 diabetes 1010
patients with heart failure were included. (B) Representative blot images and 1011
quantitative analysis of PPARα protein expression in db/+ and db/db mice hearts. (C-1012
E) Representative blot images and quantitative analysis of PPARα and Mfn2 protein 1013
expression in primary cardiomyocytes with treatment as indicated. (F) Representative 1014
60
confocal microscope images showing mitochondrial morphology stained by 1015
MitoTracker Red. Original magnification ×600. (G) Real-time PCR analysis of Mfn2 1016
mRNA expression in primary cardiomyocytes with treatment as indicated. (H) The 1017
percentage of cells with fragmented mitochondria. Ad-EV, control adenovirus; Ad-1018
PPARα, recombinant adenovirus encoding PPARα; HG/HF, high-glucose and high-fat 1019
medium (25 mmol/L glucose and 500 μmol/L palmitate). &P<0.05 vs. 12-week-old 1020
db/+; ^^P<0.01 vs. 16-week-old db/+; **P<0.01 vs. Con + Ad-EV; ##P<0.01 vs. 1021
HG/HF + Ad-EV. n = 6 in each group. 1022
1023
61
1024
Figure 10 PPARα directly binds to the promoter of Mfn2 gene. (A) ChIP analysis 1025
for PPARα binding to the Mfn2 promoter in primary rat cardiomyocytes. (B) 1026
Responses of the Full-length Mfn2 promoter reporter to Ad-EV or Ad-PPARα. (C) 1027
Responses of the individual fragments of Mfn2 promoter to Ad-PPARα. (D) A 1028
schematic illustrates the deleted sequence of Mfn2 promoter region. (E) Responses of 1029
sequence deleted promoter of Mfn2 to Ad-PPARα. Ad-PPARα, recombinant 1030
adenovirus encoding PPARα; ##P<0.01 vs. pGL-Basic + Ad-PPARα; **P<0.01 vs. 1031
Mfn2-Luc-0; ^^P<0.01 vs. Mfn2-Luc-2. n = 6 in each group. 1032
1033
62
1034
Figure 11 Schematic figure illustrating that imbalanced mitochondrial dynamics 1035
induced by decreased Mfn2 promotes mitochondrial dysfunction and diabetic 1036
cardiomyopathy. PPARα positively regulates Mfn2 expression by directly binding to 1037
its promoter. Type 2 diabetes (high-glucose and high-fat, HG/HF) reduces the 1038
expression of PPARα and then decreases the expression of Mfn2. Reduction of Mfn2 1039
causes mitochondrial fission and subsequently leads to the mitochondria-derived ROS 1040
production, mitochondrial dysfunction and mitochondria-dependent apoptosis, which 1041
results in the development of diabetic cardiomyopathy. Reconstitution of Mfn2 1042
reduces mitochondria-dependent apoptosis, suppresses mitochondria-derived ROS 1043
production, alleviates mitochondrial dysfunction and protects against diabetic 1044
cardiomyopathy. Mito, mitochondrial; ΔΨm, mitochondrial membrane potential. 1045