Analytical Biochemistry 390 (2009) 173–180

Contents lists available at ScienceDirect

Analytical Biochemistry

journal homepage: www.elsevier .com/locate /yabio

TaqMan-based, real-time quantitative polymerase chain reaction methodfor RNA editing analysis

Kevin Wong a, Rebecca Lyddon b, Stella Dracheva a,b,*

a James J. Peters Veterans Affairs Medical Center, Bronx, NY 10468, USAb Department of Psychiatry, Mount Sinai School of Medicine, New York, NY 10029, USA

a r t i c l e i n f o

Article history:Received 5 March 2009Available online 14 April 2009

Keywords:RNA editingGluR5Multiplex qPCRTaqman

0003-2697/$ - see front matter Published by Elsevierdoi:10.1016/j.ab.2009.04.011

* Corresponding author. Address: Psychiatry ResearCenter, 130 West Kingsbridge Road, Bronx, NY 10468

E-mail address: stella.dracheva@mssm.edu (S. Dra1 Abbreviations used: mRNA, messenger RNA; A-to

inosines; ADAR, adenosine deaminase that acts on RNAiGluR, ionotropic glutamate receptor; AMPA, a-aminoazole-propionate; KA, kainite; ALS, amyotropic lateralpolymerase chain reaction; SNP, single nucleotide pomentary DNA; PFC, prefrontal cortex; dNTP, deoxythreshold cycle; CH, cross-hybridization; SD, standastandard curve method.

a b s t r a c t

Abnormal adenosine to inosine (A-to-I) messenger RNA (mRNA) editing has been linked to several dis-ease states afflicting the central nervous system. Here we report an assay to determine RNA editing fre-quencies at specific sites that is based on quantitative polymerase chain reaction (qPCR) with TaqManprobes. The assay was tested by measuring the frequency of the A-to-I mRNA editing at the Q/R site ofthe human kainate receptor subunit GluR5 and was compared with two established methods of assessingRNA editing: sequencing of individual clones and restriction analysis. The qPCR assay displayed high sen-sitivity and reproducibility, demonstrated exceptional discrimination between edited and unedited tran-script variants, and proved to have several advantages over the other editing methods. Due to the factthat TaqMan-based qPCR technology can be easily adapted to different editing targets, the increasedcapabilities afforded by this new technique should facilitate various RNA editing studies that aim to elu-cidate the role of this process in normal physiology and in disease.

Published by Elsevier Inc.

RNA editing is one of the multiple posttranscriptional mecha-nisms that give rise to the complexity of the human proteome de-spite the unexpectedly lower number of genes present in thehuman genome as compared with more primitive organisms [1].RNA editing encompasses any site-specific modification of RNAmolecules via nucleotide substitution, insertion/deletion, or modi-fication, adding to the diversity of messenger RNA (mRNA)1 tran-scripts that arise from a gene [2]. These changes can drasticallyimpact the gene products, and in some cases they are essential formaintaining normal function [3].

Adenosine deamination is the prominent form of RNA editing inhigher metazoans [4]. The modification converts adenosine to ino-sine (A-to-I), which is read by cellular translation machinery asguanine. A-to-I RNA editing is catalyzed by a family of enzymesknown as adenosine deaminases that act on RNA (ADARs) [5]. A-to-I editing has limited exonic targets in the human transcriptome,

Inc.

ch (4F-02), Bronx VA Medical, USA. Fax: +1 718 365 9622.cheva).-I, adenosine nucleotides to

; CNS, central nervous system;-3-hydroxyl-5-methyl-4-isox-

sclerosis; qPCR, quantitativelymorphism; cDNA, comple-nucleoside triphosphate; Ct,rd deviation; RSCM, relative

and most of these are expressed in the central nervous system(CNS) and encode neurotransmitter receptors, ion channels, andADAR2 itself [6,7]. Ionotropic glutamate receptor (iGluR) mRNA,specifically that of a-amino-3-hydroxyl-5-methyl-4-isoxazole-propionate (AMPA) receptors and kainate (KA) receptors, repre-sents the majority of targets that undergo A-to-I editing [8].

It is now understood that RNA editing is under tight spatial andtemporal regulation, and deviations from homeostasis have beenlinked to disease states, especially in the CNS [9]. A well-studiedexample is the Q/R site on the AMPA receptor subunit GluR2,where a glutamine (Q) codon is changed to an arginine (R) codonby A-to-I editing. AMPA receptors containing the edited GluR2 sub-unit display both lower Ca2+ permeability and lower channel con-ductance than their unedited counterparts [10]. Earlier studiesshowed that 99% of all GluR2 subunits in rat brain are edited,and rats genetically engineered to solely express the unedited var-iant of GluR2 suffered from seizures and died 3 weeks after birth[3]. In humans, reduced editing at the same site was detected inmotor neurons of sporadic amyotrophic lateral sclerosis (ALS) pa-tients, in the brains of epileptic patients, and in malignant gliomas[11,12]. In addition, increased RNA editing at the Q/R sites in GluR5and GluR6 subunits of the KA receptors were found in the temporalcortex of epileptic patients [13]. Abnormal A-to-I editing in iGluRswas also implicated in the pathogenesis of other diseases, includ-ing Alzheimer’s disease, Huntington’s disease, and schizophrenia[14]. In addition, increased A-to-I editing of the serotonin 2C recep-tor was reported in suicide victims [15].

174 Real-time PCR method for RNA editing analysis / K. Wong et al. / Anal. Biochem. 390 (2009) 173–180

The clinical implications of A-to-I RNA editing in iGluRs warrantthe development of a simple and accurate method to quantify theediting frequencies in tissues of interest. Existing methods used toassess RNA editing include, but are not limited to, sequence analy-sis of individual clones and restriction assays [16,17]. Sequencinganalysis has proven to be successful in evaluating A-to-I editing,but this method is labor-intensive and costly, requiring vastamounts of cloning and sequencing to generate statistically signif-icant data. Restriction assays are limited in that they depend on thepresence of a recognition site for a restriction enzyme in the edit-ing region, where the site is either destroyed or created during A-to-I editing. That assay is also labor-intensive and, as we discov-ered, may carry a systematic error in measurements (see below).Both methods involve multiple steps, increasing the chance ofcumulative errors.

Recently, a real-time quantitative polymerase chain reaction(qPCR) method was developed using SYBR Green to detect A-to-Iediting [7]. qPCR has the advantage of being fast and cost-effective,and it can detect gene expression levels with precision and accu-racy. However, because SYBR Green lacks specificity and fluoresceswhen bound to any double-stranded DNA, the assay developed byChen and coworkers relied on a single mismatch at the 30 end of aPCR primer to distinguish between edited and unedited transcripts[7]. As a result, only one of the two assays tested in that study—eachdesigned for a different editing site—rendered satisfactory results,suggesting inherent limitations of the SYBR Green-based approach.

Here we evaluated a novel assay that we developed using qPCRwith TaqMan probes, which have exceptional specificity for the de-sired target. Our assay uses two different probes with the same pri-mer pair to detect the two transcript variants differing by onenucleotide at the site of editing. The concept is analogous to exist-ing single nucleotide polymorphism (SNP) genotyping assays thatuse qPCR [18]. However, instead of genomic DNA, our assay em-ploys complementary DNA (cDNA) templates that are reverse-transcribed from mRNA isolated from tissue. The assay allows sim-ple, reliable, and high-throughput quantification of RNA editing. Inaddition, because the qPCR is performed in small volumes, re-agents and tissue samples can be conserved. A similar qPCR/Taq-Man approach to measure editing efficiencies was introduced ina recent article [19]. However, many different methods were com-pared in that study, and the description of the qPCR methodologywas not provided in sufficient detail.

We tested our qPCR assay alongside the two previously de-scribed methods, sequencing analysis of individual clones and arestriction assay with BbvI, to quantify the extent of editing atthe Q/R site of the KA receptor GluR5. This target was chosen touse as a proof of concept because its editing region can be readilycloned for sequencing analysis. Our qPCR assay proved to be reli-able in accessing editing at the GluR5 Q/R site and to have severaladvantages over the other editing assays.

Table 1Primers and probes used in the assays.

Primer orprobe

Sequence (50–30) Function

F1 GACGTGGTGGAAAACAATTTTACTT Forward PCR primerR1 CCACCATATCCCTCCAACTATTCT Reverse PCR primerA(FAM)

probe6-FAM-CTCTCATGCAGCAAGGA-MGB

TaqMan probe for uneditedvariant

G(VIC) probe VIC-TCTCATGCGGCAAGGA-MGB TaqMan probe for editedvariant

Note. GluR5 Q/R editing site is bolded. The primers and probes were designed basedon GluR5 NM_000830 sequence (NCBI).

Materials and methods

RNA isolation and cDNA synthesis

Eight specimens of total RNA extracted from the prefrontal cor-tex (PFC) were randomly chosen from 26 psychiatrically normalmale control specimens obtained from the Stanley Foundation Ar-ray Collection. RNA concentration and quality were assessed withthe RNA 6000 Nano Chip using the Bioanalyzer 2100 (Agilent Tech-nologies). cDNA was reverse-transcribed from 2 lg of extractedRNA using the High Capacity cDNA Archive Kit (Applied Biosys-tems) in a 20-ll reaction volume according to manufacturer’s pro-tocol. The resulting cDNA samples were diluted 1:20 and used forthree different editing assays (see below).

End-point PCR and cloning conditions

PCR primers and probes were designed using Primer Express(version 3.0, Applied Biosystems) in a region of the GluR5 Q/R edit-ing site with consideration that the target (GluR5) and its relatedKA receptors have very similar sequences (Table 1 and Fig. 1). Totest whether the designed primers specifically amplified the GluR5editing region in the PCR, we used a generic cDNA sample as a tem-plate. The generic sample was generated by pooling small quanti-ties of cDNA from all 8 samples used in the study. The PCR wascarried out in a 25-ll reaction volume containing 500 nM of eachforward and reverse primer, 4 mM MgCl2, 1 mM of each deoxynu-cleoside triphosphate (dNTP), 1� PCR buffer 2, and 1 U of AmpliTaqGold DNA Polymerase (Applied Biosystems) using the GeneAmpPCR System 9700 (Applied Biosystems). A touchdown PCR protocolwas applied. After the initial denaturation step at 95 �C for 10 min,the samples were subjected to 10 touchdown cycles, with each cy-cle consisting of 95 �C for 15 s, 68 to 59 �C for 30 s, and 72 �C for30 s, where the annealing temperature dropped 1 �C/cycle. Thetouchdown step was followed by 35 cycles with a constant anneal-ing temperature, each consisting of 95 �C for 15 s, 58 �C for 30 s,and 72 �C for 30 s. The PCR protocol concluded with a final elonga-tion step of 72 �C for 10 min.

Amplicon of an expected size (� 126 bp) was excised from thegel, purified using the MinElute Gel Extraction Kit (Qiagen), andcloned into the TA cloning vector pCR4–TOPO using the TOPO TACloning Kit (Invitrogen). The resulting construct was transformedinto Escherichia coli (TOP10 strain), and individual colonies wereselected. The clones were then grown in liquid cultures, and plas-mids were isolated from these preparations using the QuickLyseMiniprep Kit (Qiagen). The plasmid inserts were sequenced com-mercially and compared with a known GluR5 sequence. The veri-fied primer pair (forward [F1] and reverse [R1] primers) wasemployed to amplify the region of interest in all three editing as-says used in the study (Table 1).

A-to-I editing assay via sequencing individual clones

The assay was performed mostly as described in Ref. [15]. ThecDNA samples were amplified in a region of the GluR5 Q/R editingsite as described above. To minimize the influence of erroneousamplification and variability in a single PCR, three independentPCRs were performed for each subject. The products of these threePCRs were combined, gel-purified, and cloned as described in theabove section. A total of 24 individual colonies from each subjectwere randomly selected, and the inserts of their plasmids were se-quenced. A plasmid DNA insert from a single bacterial colony rep-resented the edited region of an individual GluR5 mRNA transcript.

A-to-I editing assay via BbvI restriction

The assay was performed mostly as described in Ref. [11]. Theregion of editing was amplified from the cDNA templates as

Fig. 1. Sequences of KA receptors in the region of the GluR5 Q/R editing site (denoted with large A). Sequences that correspond to the primers and probes used in the qPCRediting assay are bolded and underlined. Mismatches with GluR5 sequence are highlighted in gray.

Real-time PCR method for RNA editing analysis / K. Wong et al. / Anal. Biochem. 390 (2009) 173–180 175

described above, and the concentration of the resulting ampliconswas obtained using the Nanodrop 1000 (Thermo Scientific). Therestriction assay was performed in duplicate per subject in a 10-ll reaction volume containing 100 ng of the amplified DNA, 1�restriction buffer 2, and 2 U of BbvI (New England Biolabs). Thesamples were incubated at 37 �C for 2 h, and the reaction was ter-minated at 65 �C for 30 min. The resulting restriction digestionproducts were analyzed on a DNA 1000 chip using the Bioanalyzer2100.

To investigate the formation of hybrid amplicons formed be-tween edited and unedited DNA strands during the course of cDNAamplification, we employed plasmids containing inserts withunedited (A) and edited (G) GluR5 Q/R sites. These A and G plas-mids were identified during the process of sequencing individualclones for the assay described in the previous section. The regionof editing was amplified from the A plasmid and/or G plasmidusing the primers and the touchdown cycle described above. Threeseparate PCRs were performed: (i) using only A plasmid as a tem-plate, (ii) using only G plasmid as a template, and (iii) using a 50:50mixture of A and G plasmids. Resulting amplicons were separatelysubjected to restriction digestion with BbvI, and the restrictionproducts were then analyzed on the Bioanalyzer 2100.

A-to-I editing assay using multiplexed qPCR with TaqMan probes

qPCR was performed using the 7900HT Fast Real-Time PCRThermocycler (Applied Biosystems) in a 10-ll reaction volumecontaining 2.5 ll of cDNA (either sample or standard), 1� GeneExpression PCR Master Mix (Applied Biosystems), 350 nM of eachA(FAM) and G(VIC) probe, and 900 nM of each F1 and R1 primer(Table 1). Each sample or standard was run in triplicate in a 384-well plate using a standard qPCR cycle: 50 �C for 2 min (for ura-cil–DNA N-glycosylase activation), 95 �C for 10 min, followed by40 cycles (each consisting of 95 �C for 15 s and 60 �C for 1 min).

The standards for the qPCR assay were prepared from the gel-purified plasmid inserts containing unedited or edited GluR5 Q/Rsites, excised via an EcoRI restriction from the A or G plasmid,respectively (see above). The amounts of the purified inserts weredetermined using Nanodrop, and six different concentrations ofthe A or G standards were prepared from serial dilutions of the Aor G insert, respectively.

Statistical analysis

The data obtained by each of the three methods were analyzedusing SPSS 16.0. The means were compared using matched-samplet tests with a significance level of P = 0.05. Bland–Altman analysisusing Microsoft Excel was performed to compare the editing fre-quencies obtained by each method [20]. Bias and limits of agree-ment between the methods were obtained. The bias wascalculated as the mean of the averages of editing frequencies fora sample determined by the two methods being compared. Limits

of agreement were calculated as the 95% confidence interval of thedifferences between editing frequencies determined by the twomethods being compared [20].

Results

Analysis of editing efficiency at GluR5 Q/R site using qPCR

We have developed a new method to quantitate mRNA editingfrequencies. The new assay is based on the combination of SNPgenotyping and qPCR expression analysis. Similar to the SNP geno-typing, our assay consists of two PCR primers for amplifying the re-gion of editing and two TaqMan probes (labeled with differentfluorophores) for detecting the edited and unedited mRNA variantssimultaneously. The assay employs a cDNA preparation as a tem-plate and uses the quantitative properties of real-time PCR toachieve an accurate assessment of editing frequencies. We testedthis method by measuring the extent of editing at the Q/R site ofthe KA receptor GluR5 in human postmortem brain tissue.

Assay specificity toward GluR5

KA receptors (especially GluR5 and GluR6) share significant se-quence homology [21] evident in the region of Q/R editing (Fig. 1).Therefore, the PCR primers were designed to optimize the numberof mismatches between GluR5 and other KA receptors (Fig. 1). Thesequence analysis of the resulting PCR product confirmed that theGluR5 Q/R editing region was specifically amplified with the F1/R1primer pair under the cycling conditions employed.

Probe sensitivity and variant discrimination

Plasmids containing an unedited (A plasmid) or edited (G plas-mid) Q/R region as an insert were initially used as standard tem-plates for the qPCR. However, those preparations yieldedinconsistent results, probably due to the secondary structureformed by the plasmid DNA. Linearizing the plasmids by PstIrestriction also proved to be unsuccessful. Alternatively, 126-bpexcised inserts containing the edited or unedited GluR5 Q/R region(which were prepared from the A or G plasmid, respectively)yielded satisfactory results. Therefore, these inserts were em-ployed as standard templates. Serial dilutions of the A and G stan-dards (1 pg to 0.1 fg) were amplified in separate qPCRs thatcontained both A(FAM) and G(VIC) probes. When serial dilutionsof the A standards were used, predominantly FAM signals weredetected. Conversely, predominantly VIC signals were visiblewhen the G standards was employed (Figs. 2A and 2B), demon-strating the ability of the A(FAM) and G(VIC) probes to discrimi-nate between unedited and edited transcripts, respectively (seebelow).

Standard curves for the A(FAM) and G(VIC) probes were gener-ated by plotting the log(concentrations) of the serially diluted A or

176 Real-time PCR method for RNA editing analysis / K. Wong et al. / Anal. Biochem. 390 (2009) 173–180

G standards versus the resulting threshold cycle (Ct) values of theFAM (Fig. 2A) or VIC (Fig. 2B) signal, respectively. The regressionanalysis showed that both curves could be described as linear func-tions (Ct = slope�log(concentration) + b, where b is the y axis inter-cept), with correlation coefficients (R2) of 0.999 for the A(FAM)probe and 0.998 for the G(VIC) probe (Fig. 2C). Linearity was main-tained even when the standard templates were diluted to 0.1 fg(0.13 fM), demonstrating a wide dynamic range and high sensitiv-ity of the assays. The efficiencies of the qPCR for A(FAM) and G(VIC)probes (EA and EB) were calculated as E = (10–1/slope – 1) � 100%[22] and were 92.0% for the A(FAM) probe (slope = –3.53) and91.3% for the G(VIC) probe (EG) (slope = –3.55).

The specificity of the probes (i.e., their ability to discriminatebetween edited and unedited templates) was quantitated by thedegree of cross-hybridization (CH) between a probe and its mis-matched template. A lower cross-hybridization value indicatesbetter probe specificity. The parameter was defined asCH = [(1 + E) DCt] � 100%, where E is a qPCR efficiency of the probeand DCt is the difference between Ct values detected for this probewhen matched versus mismatched template was amplified. As wasindicated above, both A(VIC) and G(FAM) probes showed superiordiscrimination (Figs. 2A and 2B); their calculated mean CH values(± standard deviations [SD]) were (8 � 10�3 ± 1 � 10�4)% for Aprobe and (7 � 10�3 ± 1.02 � 10�5)% for G probe across all concen-trations of standards.

Optimal probe concentration

The optimal probe concentration for the qPCR editing assay wasidentified by generating dose–response curves using different

Fig. 2. qPCR amplification plots and standard curves. Rn, reporter signal minus baselinseparate qPCR reactions that contained both A(FAM) and G(VIC) probes. (A) A predominanfluorescent signal are detected, indicating low cross-hybridization between G probe andminimal accumulation of the FAM fluorescent signal are detected, indicating low cross-calculate expression levels of edited and unedited transcripts in the experimental sampleCt values for the G standard (VIC signal, panel B), and the lower curve is generated usin

concentrations of A(FAM) and G(VIC) probes (tested simulta-neously in the same reaction) and the generic cDNA sample as atemplate. The optimal concentration was determined as a satura-tion point at which, based on the obtained Ct values, the amountof probe no longer limited the reaction. The saturation point forboth probes was found to be approximately 350 nM (Fig. 3).

Quantitation of GluR5 editing efficiency at the Q/R site in the humanPFC

The relative standard curve method (RSCM) [23] was used toquantify the expression level of the edited and unedited variantsin the individual specimens from the human PFC. The RSCM pro-vides for the most accurate quantitation of gene expression be-cause the efficiencies of the assays are determined fromindividual standard curves [22,24].

To measure the GluR5 editing frequencies, multiplex qPCRs(containing both A(FAM) and G(VIC) probes) were performed usingeach experimental cDNA sample and each dilution of the A and Gstandards as templates. Then the standard curves for FAM andVIC signals were generated using Ct values obtained from the A(unedited) and G (edited) standard template, respectively(Fig. 2C). Finally, the amount of edited or unedited variant in eachexperimental sample was calculated using the regression equationfor the A or G standard curve, respectively. GluR5 editing frequencyin each experimental sample was computed as the ratio betweenthe amount of edited variant and the total amount of edited andunedited variants in the sample. The experiment was performedthree times, each time in triplicate per subject and standards (Ta-ble 2).

e signal. Serial dilutions of A standards (A) and G standards (B) were amplified int accumulation of the FAM fluorescent signal and a minimal accumulation of the VICA templates. (B) A predominant accumulation of the VIC fluorescent signal and a

hybridization between A probe and G templates. (C) Standard curves generated tos. Linear regression equations are indicated. The upper curve is generated using theg the Ct values for the A standard (FAM signal, panel A).

Fig. 3. Optimization of probe concentrations for the qPCR editing assay. MultiplexqPCRs were performed using generic cDNA samples and various concentrations ofA(FAM) and G(VIC) probes. Dose–response curves were generated by plotting theresulting Ct values versus probe concentrations. Both probes showed saturation atapproximately 350 nM.

Real-time PCR method for RNA editing analysis / K. Wong et al. / Anal. Biochem. 390 (2009) 173–180 177

Analysis of editing frequency at GluR5 Q/R site by sequencing ofindividual clones

The GluR5 Q/R editing region was amplified from each experi-mental cDNA sample. The resulting amplicons contained a mixtureof edited and unedited PCR products. Following cloning of theseamplicons into a vector, the recombinant DNA was transformedinto bacteria. Plasmids were isolated from 24 clones from each ofthe 8 samples, and the inserts of these plasmids were sequenced.The editing frequency in each sample was determined as a ratio be-tween the amount of clones with an edited insert (G at the editingsite) and the total amount of sequenced clones (Table 2). Theexperiment was performed only once due to the amount of timeand cost involved.

Analysis of editing frequency at GluR5 Q/R site by the BbvI restrictionmethod

The method is based on the premise that the BbvI recognitionsite is present at the GluR5 Q/R editing region when it is uneditedand is eliminated by the editing reaction. As a result, only uneditedtranscripts can be digested by BbvI (Fig. 4). The region of editingwas amplified from each experimental cDNA sample, and theamplicons were subjected to the BbvI restriction digestion. Editing

Table 2Editing frequencies measured by qPCR, sequencing, and restriction assays.

Subject qPCR assay Sequencingassay

Restriction assay

% Editing SD (amongrepeats)

% Editing SD % Editing SD (amongrepeats)

1 64.34 0.30 66.67 N/A 90.36 2.002 66.82 0.50 62.50 N/A 91.02 2.003 66.33 1.70 73.91 N/A 93.41 1.504 67.56 2.90 76.19 N/A 89.66 1.705 51.17 2.70 52.17 N/A 72.84 5.106 54.83 2.70 49.02 N/A 75.02 5.607 63.44 0.30 66.67 N/A 93.35 3.908 63.98 2.10 81.82 N/A 93.01 2.30Mean 62.31 66.12 87.33SD (among

subjects)6.00 11.4 8.41

Note. N/A, not available.

frequency in each sample was determined as a ratio between theamount of the amplicon that was digested by BbvI and the sumof both digested and nondigested amplicons. The experiment wasperformed three times, each time in duplicate per subject (Table 2).

Statistical analysis

Statistical comparisons of the results among pairs of editing as-says are presented in Table 3. Matched sample t tests showed thatthe editing frequencies obtained using the restriction assay weresignificantly higher than those obtained by the other two methods,which did not differ significantly. Bland–Altman analysis indicatedgood agreement between sequencing and qPCR methods, with alow bias and a low limit of agreement (both parameters < 10.0%).The restriction method displayed high bias (> 21.2%) but low limitsof agreement (< 4.4%) compared with the other two methods(Table 4).

Formation of hybrid PCR amplicons

We hypothesized that the increased editing efficiencies de-tected by the BbvI restriction assay may originate from the forma-tion of hybrid PCR amplicons composed of an unedited DNA strandbase-paired with an edited cDNA strand. The formation of such hy-brids is plausible given that the two cDNA strands would differ byonly 1 bp. Because a restriction enzyme recognition site requiresboth DNA strands to facilitate the restriction digestion, BbvI wouldnot be able to digest such hybrids. Therefore, the presence of thesehybrid amplicons should result in overestimation of the editingfrequency detected by the restriction assay.

To test this hypothesis, three separate PCRs were performed: (i)using only A plasmid as template, (ii) using only G plasmid as tem-plate, and (iii) using a 50:50 mixture of A and G plasmids. Theamplicons were then subjected to BbvI restriction digestion, andthe resulting fragments were analyzed. As was expected, virtuallyall amplicons (� 99%) generated with the unedited template (Aplasmid) were digested by BbvI, whereas the amplicons generated

Fig. 4. BbvI restriction assay. The GluR5 126-bp A amplicon (unedited) contains aBbvI recognition site, GCACC. Therefore, restriction digestion of the A amplicon byBbvI generates 75- and 51-bp DNA fragments (restriction occurs 10 bp downstreamof the recognition site). On the contrary, the GluR5 G amplicon (edited) cannot bedigested by BbvI because A-to-I editing destroys the recognition site.

Table 3Comparison of pairs of assays by matched t test.

Assays Mean (df = 7) and probability

qPCR vs. t = 1.419individual clones P = 0.199qPCR vs. t = 19.847restriction analysis P = 0.000Individual clones t = 9.554vs. restriction analysis P = 0.000

Note. Statistically significant values (P < 0.005) are bolded.

Table 4Bland–Altman analysis of pairs of assays.

Assays Bias (%) Limit of agreement (%)

qPCR vs. individual clones 3.81 5.26qPCR vs. restriction analysis 25.03 2.47Individual clones vs. restriction analysis 21.22 4.35

Note. Restriction analysis assay showed a constant bias compared with the othertwo methods (shown in bold).

178 Real-time PCR method for RNA editing analysis / K. Wong et al. / Anal. Biochem. 390 (2009) 173–180

with the edited template (G plasmid) were not (Figs. 5A and 5B).However, the products generated by a mixed template wereapproximately 24.5% cut, lower than the expected 50% (Fig. 5C).

These data suggest the formation of hybrid amplicons. If dou-ble-stranded DNA amplicons are formed randomly from equalamounts of edited and unedited single-stranded DNA molecules,it would be expected that, among the resulting double-strandedDNA amplicons, approximately 25% would contain two editedcomplementary strands, 25% would contain two unedited strands,and 50% would be hybrids containing one edited strand and oneunedited strand. Thus, among these amplicons, only approximately25% (those containing two unedited complementary strands thatcomprise the BbvI recognition site) can undergo restriction diges-tion by BbvI, exactly as was detected in our experiment (Fig. 5C).

Fig. 5. Formation of DNA hybrids. Shown are the Bioanalyzer 2100-recorded electrophdisplayed on the x axis, and DNA concentration (relative fluorescence units) is displayed ogenerated using the A plasmid as a template. Virtually all 126-bp amplicons were digestamplicons that were PCR-generated using the G plasmid. Virtually none of the 126-bp amwere PCR-generated using a 50:50 mixture of the A and G plasmids. Approximately oneinto 51- and 75-bp DNA fragments. This suggests the presence of hybrid amplicons (ed

Discussion

This article has introduced a new qPCR-based assay that allowsrapid, sensitive, quantitative, and cost-effective analysis of RNAediting at a specific site. The assay was tested by measuring the fre-quency of the A-to-I mRNA editing at the Q/R site of GluR5 and wascompared with two established methods of assessing RNA editing:individual clone sequencing and restriction analysis. The qPCR as-say showed exceptional specificity and reproducibility, and it dem-onstrated advantages over the other two methods.

The qPCR editing assay developed here consists of two PCRprimers for amplifying the edited region and two TaqMan probes(labeled with different fluorophores) for detecting the edited andunedited mRNA variants. Because the qPCR assay depends on theability to distinguish between two variants whose sequences differby only 1 bp, the assay’s success is determined by the specificity ofprobes. Cross-hybridization experiments performed in this studydemonstrated that the TaqMan probes designed for the GluR5 as-say could reliably discriminate between the edited and uneditedvariants of the receptor mRNA. Although only one qPCR editing as-say was tested in this study, we expect that similar approaches canbe adopted for other edited targets. It has been established thatTaqMan-based real-time PCR detection is highly sensitive to mis-matches (even in 1 nt) between a TaqMan probe and its target se-quence, and TaqMan SNP genotyping is based solely on these

oretograms of the BbvI restriction digestion products. DNA length (base pairs) isn the y axis. (A) BbvI restriction digestion products of the amplicons that were PCR-

ed into 51- and 75-bp DNA fragments. (B) BbvI restriction digestion products of theplicons were digested. (C) BbvI restriction digestion products of the amplicons that

-fourth (24.5% instead of the expected 50%) of the 126-bp amplicons were digestedited plus unedited strands) that cannot be digested by BbvI.

Real-time PCR method for RNA editing analysis / K. Wong et al. / Anal. Biochem. 390 (2009) 173–180 179

discriminative qualities of the probes. In our ongoing studies, wehave already designed reliable qPCR assays to analyze three otherglutamate receptor editing sites (R. Lyddon et al., unpublishedobservations). However, the qPCR editing assay may have somelimitations. Although the assay was demonstrated to analyze anediting site with two RNA variants, it remains to be examinedwhether this assay can be applied to multiple transcript variants(e.g., as observed in serotonin 2C receptor) [25]. Due to the com-plexity of quantifying frequencies of multiple variants that origi-nate from several closely situated RNA editing sites, a sequencingmethod or recently reported capillary electrophoresis approach[26] could still be better suited for that analysis.

The qPCR assay addresses several issues that have been prob-lematic for other methodologies. For example, although thesequencing method is assumed to provide unambiguous results,it contains several steps (PCR, cloning, and sequencing), is time-and labor-intensive, and is costly. With these limitations, thesequencing assay was performed only once, as is usually the casein other published reports (see, e.g., Refs. [27,28]). Therefore, wecould not compare reproducibility among all methods assessedin our study. Both the qPCR the restriction assays required signifi-cantly less labor compared with the sequencing assay, and bothwere proven to be highly reproducible, as was demonstrated bytheir low variability among three independent runs using the samecDNA specimens. More importantly, the sequencing method relieson sampling of a limited population of cloned transcripts that the-oretically may introduce a significant error into the measurements(e.g., a bias toward one or another variant during the cloning pro-cedure). Conversely, the entire population of RNA transcripts aftera single PCR is sampled by both the qPCR and restriction assays.

The restriction method, however, has some inherent disadvan-tages compared with the qPCR assay. First, it depends on the pres-ence of a recognition site for a restriction enzyme in the region ofediting and, therefore, cannot be applied to all editing sites. Sec-ond, in addition to PCR, the restriction method involves an inter-mediate step (digestion) that creates another source of potentialerror. Finally, as was suggested in the current article, the restric-tion assay may carry an underlying systematic bias due to the for-mation of hybrid DNA molecules.

In our study, editing frequencies at the GluR5 Q/R site in the hu-man PFC that were detected by the restriction assay were in agree-ment with the values reported by Kawahara and coworkers [17]but were significantly higher than the frequencies detected bythe sequencing and qPCR assays (which did not differ from eachother). We postulated that the high editing levels detected by therestriction assay could be attributed to the formation of hybridproducts between edited and unedited strands during the PCR.The formation of these hybrids is plausible given that the two com-plementary amplicon variants differ by only 1 nt situated at theediting site. The same nucleotide determines the presence or ab-sence of the BbvI restriction site in an amplicon (Fig. 4). BecauseBbvI cuts only double-stranded unedited GluR5 variants, the for-mation of hybrids between edited and unedited strands would re-duce the amount of unedited products that could undergorestriction, resulting in overestimation of editing frequencies. Theoutcome of experiments performed in our study favored thishypothesis and strongly suggested a bias in detection of editinglevels by the restriction assay. This detection bias was confirmedby the Bland–Altman analysis performed in our study. Althoughthe restriction assay introduces a systematic error, all three assayshave small limits of agreement, indicating that the assay was mea-suring the same phenomenon.

The qPCR editing assay necessitates generation of edited andunedited standard templates to assess the cross-hybridization be-tween the probes and the mismatched transcript variants and toobtain standard curves. Although generation of the edited and

unedited standards involves additional cloning and sequencingprocedures, when an assay is established the consequent analysisof editing frequencies is fast and high-throughput measurementsin large quantities of samples can be achieved.

To summarize, we have developed a rapid quantitative methodto measure frequencies of two isoforms resulting from RNA editingat a specific site. The method uses TaqMan-based qPCR technologyand can be easily adapted for studies of edited RNA from differenttargets. The increased capabilities afforded by this new techniqueshould facilitate the studies of RNA editing aiming to elucidatethe role of this process in normal physiology and in disease.

Acknowledgments

Postmortem brain tissue was donated by the Stanley MedicalResearch Institute’s array collection courtesy of Michael B. Knable,E. Fuller Torrey, Maree J. Webster, and Robert H. Yolken. This studywas supported by a VA Merit award (S.D.), a grant from the Amer-ican Foundation for Suicide Prevention (S.D.), and the VISN3 Men-tal Illness Research and Education Clinical Center (MIRECC).

References

[1] International Human Genome Sequencing Consortium, Finishing theeuchromatic sequence of the human genome, Nature 431 (2004) 931–945.

[2] B.L. Bass, RNA editing by adenosine deaminases that act on RNA, Annu. Rev.Biochem. 71 (2002) 817–846.

[3] R. Brusa, F. Zimmermann, D.S. Koh, D. Feldmeyer, P. Gass, P.H. Seeburg, R.Sprengel, Early-onset epilepsy and postnatal lethality associated with anediting-deficient GluR-B allele in mice, Science 270 (1995) 1677–1680.

[4] S. Maas, T. Melcher, P.H. Seeburg, Mammalian RNA-dependent deaminases andedited mRNAs, Curr. Opin. Cell Biol. 9 (1997) 343–349.

[5] U. Kim, Y. Wang, T. Sanford, Y. Zeng, K. Nishikura, Molecular cloning of cDNAfor double-stranded RNA adenosine deaminase: a candidate enzyme fornuclear RNA editing, Proc. Natl. Acad. Sci. USA 91 (1994) 11457–11461.

[6] L. Valente, K. Nishikura, ADAR gene family and A-to-I RNA editing: diverseroles in posttranscriptional gene regulation, Prog. Nucleic Acid Res. Mol. Biol.79 (2005) 299–338.

[7] Y.C. Chen, S.C. Kao, H.C. Chou, W.H. Lin, F.H. Wong, W.Y. Chow, A real-time PCRmethod for the quantitative analysis of RNA editing at specific sites, Anal.Biochem. 375 (2008) 46–52.

[8] S. Barlati, A. Barbon, RNA editing: a molecular mechanism for the finemodulation of neuronal transmission, Acta Neurochir. 93 (Suppl.) (2005) 53–57.

[9] S. Maas, Y. Kawahara, K.M. Tamburro, K. Nishikura, A-to-I RNA editing andhuman disease, RNA Biol. 3 (2006) 1–9.

[10] P.H. Seeburg, M. Higuchi, R. Sprengel, RNA editing of brain glutamate receptorchannels: mechanism and physiology, Brain Res. Rev. 26 (1998) 217–229.

[11] Y. Kawahara, K. Ito, H. Sun, H. Aizawa, I. Kanazawa, S. Kwak, Glutamatereceptors: RNA editing and death of motor neurons, Nature 427 (2004) 801.

[12] S. Maas, S. Patt, M. Schrey, A. Rich, Underediting of glutamate receptor GluR-BmRNA in malignant gliomas, Proc. Natl. Acad. Sci. USA 98 (2001) 14687–14692.

[13] G. Kortenbruck, E. Berger, E.J. Speckmann, U. Musshoff, RNA editing at the Q/Rsite for the glutamate receptor subunits GLUR2, GLUR5, and GLUR6 inhippocampus and temporal cortex from epileptic patients, Neurobiol. Dis. 8(2001) 459–468.

[14] S. Akbarian, M.A. Smith, E.G. Jones, Editing for an AMPA receptor subunit RNAin prefrontal cortex and striatum in Alzheimer’s disease, Huntington’s disease,and schizophrenia, Brain Res. 699 (1995) 297–304.

[15] S. Dracheva, N. Patel, D.A. Woo, S.M. Marcus, L.J. Siever, V. Haroutunian,Increased serotonin 2C receptor mRNA editing: a possible risk factor forsuicide, Mol. Psychiatry 13 (2008) 1001–1010.

[16] M.S. Sodhi, D.C. Airey, W. Lambert, P.W. Burnet, P.J. Harrison, E. Sanders-Bush,A rapid new assay to detect RNA editing reveals antipsychotic-inducedchanges in serotonin-2C transcripts, Mol. Pharmacol. 68 (2005) 711–719.

[17] Y. Kawahara, K. Ito, H. Sun, I. Kanazawa, S. Kwak, Low editing efficiency ofGluR2 mRNA is associated with a low relative abundance of ADAR2 mRNA inwhite matter of normal human brain, Eur. J. Neurosci. 18 (2003) 23–33.

[18] M.T.P. Gilbert, J.J. Sanchez, T. Haselkorn, D.J. Laurence, S.B. Lucas, E. Van Marck,C. Borsting, N. Morling, M. Worobey, Multiplex PCR with minisequencing as aneffective high-throughput SNP typing method for formalin-fixed tissue,Electrophoresis 28 (2007) 2361–2367.

[19] A. Nakae, T. Tanaka, K. Miyake, M. Hase, T. Mashimo, Comparing methods ofdetection and quantitation of RNA editing of rat glycine receptor a3, Intl. J.Biol. Sci. 4 (2008) 397–405.

[20] J.M. Bland, D.G. Altman, Statistical methods for assessing agreement betweentwo methods of clinical measurement, Lancet 1 (1986) 307–310.

180 Real-time PCR method for RNA editing analysis / K. Wong et al. / Anal. Biochem. 390 (2009) 173–180

[21] J.E. Huettner, Kainate receptors and synaptic transmission, Prog. Neurobiol. 70(2003) 387–407.

[22] J.H. Schefe, K.E. Lehmann, I.R. Buschmann, T. Unger, H. Funke-Kaiser,Quantitative real-time RT–PCR data analysis: current concepts and the novel‘‘gene expression’s CT difference” formula, J. Mol. Med. 84 (2006) 901–910.

[23] Applied Biosystems, Guide to performing relative quantitation of geneexpression using real-time quantitative PCR, Applied Biosystems, Foster City,CA, 2004.

[24] S.N. Peirson, J.N. Butler, R.G. Foster, Experimental validation of novel andconventional approaches to quantitative real-time PCR data analysis, NucleicAcids Res. 31 (2003) e73.

[25] C.M. Burns, H. Chu, S.M. Rueter, L.K. Hutchinson, H. Canton, E. Sanders-Bush,R.B. Emeson, Regulation of serotonin-2C receptor G-protein coupling by RNAediting, Nature 387 (1997) 303–308.

[26] A. Poyau, L. Vincent, H. Berthomme, C. Paul, B. Nicolas, J.F. Pujol, J.J. Madjar,Identification and relative quantification of adenosine to inosine editing inserotonin 2C receptor mRNA by CE, Electrophoresis 28 (2007) 2843–2852.

[27] Y. Du, M.T. Davisson, K. Kafadar, K. Gardiner, A-to-I pre-mRNA editing of theserotonin 2C receptor: comparisons among inbred mouse strains, Gene 382(2006) 39–46.

[28] E.A. Hackler, D.C. Airey, C.C. Shannon, M.S. Sodhi, E. Sanders-Bush, 5-HT2C

receptor RNA editing in the amygdala of C57BL/6J, DBA/2J, and BALB/cJ mice,Neurosci. Res. 55 (2006) 96–104.