MOLECULAR AND CELLULAR BIOLOGY, Apr. 1991, p. 1954-19640270-7306/91/041954-11$02.00/0Copyright C 1991, American Society for Microbiology

Synergistic Interactions of Silkmoth ChorionPromoter-Binding Factors

YASIR A. W. SKEIKY AND KOSTAS IATROU*

Department of Medical Biochemistry, University of Calgary, 3330 Hospital Drive N. W.,Calgary, Alberta, Canada T2N 4N1

Received 17 August 1990/Accepted 3 January 1991

Two DNA-binding proteins, BCFI and BCFII, that interact with defined promoter sequences of silkmothchorion genes of late developmental specificity appear in the nuclei of follicular cells at a time that coincideswith the transcriptional activation of the corresponding genes. BCFI prebinding is shown to be indispensablefor stable binding of BCFII to its cognate sequence. BCFI and BCFII synergism requires a relatively stringentstereospecific alignment and is a prerequisite for the assembly of higher-order protein-promoter DNAcomplexes containing additional factors, which are neither gene (stage) nor class (chorion) specific. Binding ofBCFI to its site correlates with the induction of DNA structural perturbations that may facilitate assembly ofadditional factors on the promoter. The BCFI-binding domain contains a core hexanucleotide sequence,AGATAA, which represents the major binding determinant of the erythroid-specific transcription factorGATA-1 of higher vertebrates. This sequence is shown to be necessary and sufficient for binding of BCFI, asit is for a factor that is present in induced K562 human erythroleukemic cells, presumably GATA-1.Comparative analyses of mobility shift patterns obtained with partially proteolyzed preparations of these twounrelated factors were used to confirm that a BCFI-like chorion promoter-binding protein, which is present inthe nuclei of an established silkmoth cell line derived from ovarian tissue, is in fact BCFI. The transcriptionalrepression of endogenous chorion genes in this cell line coupled with the documented absence of factor BCFIIsuggests that the synergistic interactions between these two factors constitute a minimum requirement for latechorion gene expression.

A fundamental characteristic of all silkmoth chorion genesis their organization in pairs of divergently oriented tran-scription units (2, 14-16, 18, 38, 39). The two genes in eachpair are coordinately regulated (14, 15, 39), and all cis-actingregulatory elements required for their sex, tissue, stage, andcoordinate regulation appear to reside within their shared5'-flanking sequences (27-29). These shared promoter se-quences are only 300 ± 30 bp long. They do not containduplicate copies of evolutionarily conserved sequence ele-ments that could be judged functionally relevant and aregenerally devoid of conserved palindromic motifs. Thus, thequestion arises as to how paired chorion genes undergocoordinate activation and repression.

Previous comparative studies on high-cysteine (Hc)chorion genes, which are expressed during late choriogene-sis, led to the suggestion that equivalent but nonidenticalsymmetrical structures at the transcriptional start sites ofsuch gene pairs may be recognized by a single trans-actingfactor or factor complex and be, at least in part, one of thedeterminants for coordinate expression (15). However, thevalidity of this model has not been tested experimentally.

Recently, it has become apparent that transcriptionalregulation is accomplished through the concerted action ofmultiple protein factors that interact with distinct domains ofthe genes as well as with one another (reviewed in references17, 22, 26, and 33). In an attempt to gain some understandingof the molecular basis for the differential and coordinateregulation of chorion gene pairs during silkmoth oogenesis,we have initiated studies aimed at the identification ofspecific DNA-binding proteins, presumably transcriptionfactors, that bind to defined sequence elements of the shared

* Corresponding author.

promoters of these genes. In this paper, we describe thedetection of two such proteins and document their roles indirecting the formation of higher-order complexes on pro-moter DNA. The developmental profiles of accumulation ofthe two DNA-binding proteins in the nuclei of follicular cellsand the distribution of their recognition sequences amongthe known members of all silkmoth chorion multigene fam-ilies suggest that these proteins represent transcription fac-tors important for chorion gene activation during late chorio-genesis.

MATERIALS AND METHODS

Nuclear extracts. Nuclear extracts derived from total andstaged follicular cells and Bombyx mori tissue culture cells(BmS) were prepared as described previously (38). Extractsderived from hemin-stimulated human erythroleukemia cellline K562 were the generous gift of Mark Brown, Universityof Calgary.DNA probe and competitor fragments. The promoter ele-

ment of chorion gene pair Hc.12 (15) was excised followingHindIII-HincII restriction and end labeled with [y-32P]ATPby using T4 polynucleotide kinase. Promoter subfragmentswere derived from this double-end-labeled fragment throughappropriate secondary digestions (Fig. 1A). The Hc.3 pro-moter fragment was prepared by primary digestion of theclone containing this gene pair (4) with HindIII-HincII,3'-end filling, and secondary digestion with AluI. The result-ant HindIII-AluI promoter fragment comprises sequencesfrom -10 to -95 with respect to the A gene. The A/B.X2promoter probe was prepared through primary digestion ofthe X2 subclone (40) with XbaI, end filling with Klenowpolymerase, and secondary digestion with Hinfl. This pro-moter fragment comprises sequences from +7 to -157 with

1954

Vol. 11, No. 4

on April 3, 2019 by guest

http://mcb.asm

.org/D

ownloaded from

SILKMOTH CHORION PROMOTER-BINDING FACTORS 1955

FIG. 1. Gel retardation analysis. (A) A 3.8-kb EcoRI (E) restric-tion fragment containing the chorion gene pair HcA/B.12 is depictedin the top diagram. Arrows indicate transcriptional orientations. Theline below shows the 260-bp common 5'-flanking HindIlI (D3)-HindIl (D2) promoter element (fragment P). Subfragments A, B, C,and D of the promoter were obtained from fragment P followingsecondary restrictions as indicated. Base numbering is relative tothe cap site of gene HcA.12. Dots indicate 32P-labeled 5' ends. (B)(Left) Gel retardation analysis using follicular nuclear extracts andpromoter fragments P, A, B, C, and D as probes. (Middle) Compe-tition analysis using follicular nuclear extracts and fragment A as

probe in the absence (lane -) or presence of a 100-fold molar excess

of the following competitor DNAs: HcA/B.12 promoter fragment P(lane P); promoter element of a chorion gene pair, A/B.L12, ofearly-middle developmental specificity (lane E/M); promoter ele-ment of a Bombyx cytoplasmic actin gene (lane Ac). (Right) Bandshift assays using nuclear extracts obtained from different cell typesand fragment A as probe. Lanes contain reactions with nuclearextracts from follicular (F), Bm5 tissue culture (T), or silk gland (S)cells. Lane - contains the mock-incubated probe (no extract).Major complexes Al to A4 formed on promoter fragment P are

indicated by dots, probes are marked by arrowheads, and the arrow

indicates an additional complex which was occasionally observedwith fragment P and was not studied further.

respect to the A gene. The intergenic region of A/B.L12 (39)was isolated from plasmid pAwt (28) following digestion withHindlIl. The promoter sequences of the cytoplasmic actingene (-195 to +77) were excised by a double digestion ofplasmid A3 (30) with PstI and AccI. Oligonucleotides I and IIwere synthesized at the Regional DNA Synthesis Labora-tory, University of Calgary. The double-stranded oligonu-cleotides I and II contained, respectively, the sequences

5'-TGTTCACCTTGAGATAAGAAAC-3'3'-TGGAACTCTATTCTTTGacAAG-5'

and

5'-ACAAATAGTTGAGAAACAATG-3'3'-ATCAACTCTTTGTTACTgTtt-5'

(lowercase letters indicate nucleotide substitutions in the 5'overhangs that were introduced to allow probe concatemer-ization for further experimentation). Double-stranded oligo-nucleotides E and E* (referred to as en4 and en4-201+24,respectively, in reference 8) were the generous gift of G.Felsenfeld, National Institutes of Health. Their completenucleotide sequences are shown in Fig. 6.

Following end labeling and purification, equimolar mix-tures of complementary oligonucleotides at a final concen-tration of 50 ,ug/ml in 150 mM NaCI-1 mM EDTA (pH 8.0)were heated at 90°C and allowed to anneal by gradual coolingto room temperature over a period of S h. Annealed nucleicacid was diluted fivefold with water, and the double-strandedDNA was separated from contaminating single strands bylayering it on a 1-ml Sephadex G-50 column and eluting it bylow-speed centrifugation. The eluted material was ethanolprecipitated and dissolved in water.

Gel retardation analysis. Unless otherwise indicated, 2.5 x104 to 5 x 104 cpm Cerenkov of end-labeled fragments (0.5 x107 to 1 x 107 cpm/4g) were incubated with 2 ,ug of variousnuclear extracts, and protein-DNA complexes were ana-lyzed as described previously (38). In competition experi-ments, usually a 100-fold molar excess of the appropriatecompetitor DNA was included in the binding reaction priorto the addition of the extract.

Trypsin digestions. Binding reactions were performed es-sentially as described above. After prebinding for 10 min at0°C, 1 Ru of trypsin solution (diluted to the desired concen-tration just before use) was added to the reaction mixture,and incubation continued for an additional 15 min at 0°C (36).The cleavage products were subsequently resolved by directloading on a 5% native polyacrylamide gel as describedelsewhere (38).DNase I footprinting and methylation interference assays.

The 170-bp HindIII-PstI promoter fragment A (Fig. 1A) wasused in both assays. Following restriction with HindlIl, thepromoter fragment was 5' end labeled by using T4 polynu-cleotide kinase (upper strand) or 3' end filled with Klenowpolymerase (lower strand) prior to secondary restrictionwith PstI. DNA-binding reactions for DNase I footprintingwere carried out exactly as described above for the gelretardation assays except that 25 ,ug of the appropriatenuclear extract and 1 ,g of poly(dI-dC):poly(dI-dC) per10-,ug extract was used for the binding reactions. Cleavagewith DNase I was performed essentially as described previ-ously (9), with only a minor modification: following incuba-tion of the binding reaction at 0°C for 30 min, 2 RI of a freshlyprepared solution containing 0.3 U of DNase I in 25 mMCaCl2-25 mM MgCl2 was added. Digestion was at 0°C for 90s, and the reaction was terminated by the addition of 50 pI ofDNase I stop buffer (1.5 M ammonium acetate, 20 mM TrisHCl [pH 8.0], 50 mM EDTA, 100 ,ug of tRNA per ml).Following purification by phenol extraction, the DNase Icleavage products were analyzed on a 8% polyacrylamide-8M urea sequencing gel (24) in parallel with a control reaction(binding reaction lacking nuclear extract) cleaved with 0.05U of DNase I. For methylation interference, a portion of theDNA probe was methylated by treating it with dimethylsulfate as described previously (24). Preparative bindingreactions were carried out by scaling up the analyticalreactions 5-fold and increasing the amount of the methylated

VOL . 1 l, 1991

on April 3, 2019 by guest

http://mcb.asm

.org/D

ownloaded from

1956 SKEIKY AND IATROU

probe 10-fold. The complexed and free DNA fragments wereeluted from gel slices and purified by binding to and elutionfrom DE-81 ion-exchange paper (Whatman [34]). Followingpiperidine treatment (24), the cleavage products were re-solved by denaturing polyacrylamide gel electrophoresis.

RESULTS

Multiple tissue- and stage-specific nuclear factors interactwith late chorion gene promoters. Hc chorion genes (2, 15,16, 35) belong to two multigene families, HcA and HcB,whose members are expressed only during the late stages ofchoriogenesis. As with the rest of the chorion genes of thesilkmoth, Hc genes are organized in pairs of divergentlyoriented transcription units, HcA/HcB, sharing common5'-flanking sequences 300 ± 30 bp in length, and all of themare clustered within one region of the chorion locus spanning140 kb of chromosome 2 of the organism (5, 11, 12). In theexperiments described below, we used portions of the pro-moter region of gene pair HcA/B.12 (Fig. 1A), our prototypefor Hc chorion genes, as probes for the detection of DNA-binding activities present in crude nuclear extracts obtainedfrom follicular cells.

Incubation of the promoter fragment with the follicularnuclear extracts (Fig. 1B, left, lane P) resulted in theformation of multiple complexes that presumably representdistinct protein-DNA and secondary protein-protein interac-tions. This complex pattern of interactions was simplifiedwhen subfragments derived from the promoter fragmentwere employed in the gel retardation assays. Fragment A inparticular, constituting the left half of the common promoter,yielded four distinct complexes (Al to A4; Fig. 1B, left),while subfragments B, C, and D (Fig. 1A and B, left) eachproduced one major complex.To deduce whether the factors responsible for complex

formation on fragment A are promoter specific, competitionexperiments were undertaken (Fig. 1B, middle). While com-petition with an excess of nonradioactive promoter (frag-ment P) resulted in the elimination of essentially all com-plexes, the two major complexes, Al and A2, remainedunaffected when the promoters of a chorion gene pair ofearly-middle developmental specificity, A/B.L12 (lane E/M),or a silkmoth cytoplasmic actin gene (lane Ac) were used ascompetitors. In contrast, complex A3 was severely reducedin the presence of the early-middle chorion promoter com-petitor DNA, indicating that this complex contains a factorthat recognizes more than one class of chorion promoters.Finally, complex A4 was eliminated in the presence of actinor early-middle chorion gene promoter DNA, indicating thatthe factor(s) responsible for its formation is not promoterspecific.Examination of a nuclear extract derived from silk gland

cells for the presence of factors that can bind to the late-chorion-promoter sequences (fragment A) did not reveal anystable complex formation (Fig. 1B, right, lane S), despite thefact that the same extract, when used in conjunction with thepromoter of the cytoplasmic actin gene, produced distinctcomplexes (data not shown). Interestingly, however, when anuclear extract derived from an established cell line, BmS,was used in the same assay, a complex was detected (Fig.1B, right, lane T) whose mobility was indistinguishable fromthat of complex Al. It appears, therefore, that the nuclei ofBmS cells may contain one of the late-chorion-promoter-specific factors present in follicular cell nuclei.

Factors BCFI and BCFII: binding domains. DNase I foot-printing and methylation interference assays were carried

out on promoter complexes formed with the follicular nu-clear extracts to determine the DNA regions which interactwith the factors responsible for formation of complexes Alto A4. The DNase I footprinting experiments (Fig. 2A, left)revealed that a nuclear factor, termed BCFI (Bombyxchorion factor I), contacts the DNA in the -57 to -64 region(relative to the transcriptional start site of gene HcA.12).Although this region was protected from DNase I digestionon both strands, protection was predominantly on the lowerstrand of the DNA. This protected region was bordered byDNase I hypersensitive sites. Additional DNase I hypersen-sitive sites were also evident further upstream (toward the Bgene, region -86 to -140), an indication of structuralperturbations on the DNA that are probably caused byinteractions with other proteins. The DNase I digestionassay also revealed a major footprint in the region of theTATA box (residues -24 to -30; not shown).

Methylation interference assays permitted a more detailedanalysis of the interactions between protein factors andpromoter DNA, because it was possible to carry out theseassays on promoter DNA recovered from specific complexes(Al to A4) obtained through gel retardation assays. Theseexperiments (Fig. 2A, right) revealed that complex Alcontains factor BCFI and that this factor contacts the majorgroove of the DNA (G residues -56 and -58 within itsbinding domain are slightly undermethylated in complex Al,while the next G residue, at position -63, is methylated tothe same extent as unbound DNA recovered from band AO).The methylation interference assays using DNA recoveredfrom complex A2 revealed that in addition to factor BCFI,this complex contains a second factor, termed BCFII, whichescaped detection in the less-sensitive DNase I footprintingassay. The minimum binding domain for BCFII, deducedfrom the pattern of methylation interference (G residues-84, -87, and -89 of the upper strand and -93 of the lowerstrand) is -84 to -93. Apparently, methylation of the four Gresidues within this binding domain results in strong bindinginhibition. Analysis of the DNA recovered from complexesA3 and A4 (not shown) revealed undermethylation patternsidentical to those of complex A2, suggesting that thesecomplexes contain additional factors which assemble on thepromoter region through protein-protein interactions or

through DNA contacts that do not involve G residues.Similar experiments using nuclear extracts derived from

BmS cells (Fig. 2B, right) revealed that these extractscontain a DNA-binding protein that produces a footprint inthe same region as BCFI (residues -57 to -64) and a patternof minor methylation interference on residues -56 to -58,again identical to that produced by BCFI. Therefore, on thebasis of this type of analysis, it appears that follicular factorBCFI and the factor present in BmS nuclei are the same.The binding sites for factors BCFI and BCFII are shown

diagrammatically in Fig. 2C. Each binding domain spans 9 to10 bp, and the two binding domains are separated by 19 bp.Thus, when bound to their target sequences, the two factorsshould lie on the same face of the DNA helix. It is thereforeconceivable that protein-protein contacts occur between thetwo factors and stabilize their binding to the promoter DNA.BCFI prebinding is required for stable binding of BCFII.

Two double-stranded oligonucleotides, I and II (Fig. 2C),that contain the binding sites for factors BCFI and BCFIIwere synthesized and used as probes in gel retardationassays. As shown in Fig. 3A (left), incubation of oligonucle-otide I with follicular nuclear extracts resulted in the forma-tion of a specific complex; this complex could be competedout by an excess of oligonucleotide I competitor but not by

MOL. CELL. BIOL.

on April 3, 2019 by guest

http://mcb.asm

.org/D

ownloaded from

SILKMOTH CHORION PROMOTER-BINDING FACTORS 1957

M

IL

4

- + - +

I!*

io9iX

i.,1-6 _ - 6

p a

M A A0A1 A2

A4A3

- A2

INA,

4

IAO

a

AOA1 A2

1-89- :-7W~

- .:-87 BCFII- - - * -84

- - * -93 BCFJ[

_ _ _

f.5w BCFI

a_. _, !

_~ ~ ~ ~~q_ "

U

U

.

L

BM - +

!0o: I

-b l

f

M A AOA1 AOA,

A1

-64

A C

V -57

.v

c,-56c--58

a

U L

U

C -10 -2 0 -3 0 -4 0 -50 BCFI -77 -o0 BCFII -10 0Z C . s *~~~~~~~__ACT-. -L '.kAGfCTTCkAACTTCGTTCTrATATAGTAC.ACT.AGA.ATCATGTTCAtC CTTf-AGATA. .ACA: CATGtAArA - T G A. CJTGATA77-AAAT-CGAACTTCTC-AAGCAAGAA-ATATCATTG-ATTCTTAGTACA.A.GTGn^-.k CT CTCALrT- CT C-LTG . C-GT-ACTGT-TTAT Cz'.L.CTCvTTT C-T-ACTA-T

-I * -- --* --1

-110 -1 2 0 -1 3 0 -14 0 -:50 -16 - - 7 0 - 90 -200

C--TTGC-C-TTT ATATCAAACAGGTGTTCGTAAATG:TTTCCTGATTAGAT CGC-CCCGAAGGCGAAAACTG C.a. W-AATATCTCCAAAG l CAC -TCTATATGCTATC.ar ~CCriNTAA7TAC'-TGTCCACAAGCATTTACAAAGC-vACTAATCTAG CC-GGG-CTTCCGC-CTT-C.7"-ACG C"-TATAGAGGCTTTCACT-C-CACti-rzTACGATA

- -2 2 0 -2 3 0 -2 4 0 -250 -260-6 0

77AGATATGA--CATGCGGATTTTCAAGGAAACTGCT CGGTATAAAAGCTG-ATGTAGTTCAGAGTCAA.C CAA.TCTAaCCTCGTAC aCCTAAAACTTCCTTTGACGAGCCATA-TTTCGACTACATCARAGTCTCAGTT-AG

FIG. 2. DNA-binding domains of nuclear factors BCFI and BCFII. (A) DNase I footprinting (left) and methylation interference (right)assays using promoter fragment A in conjunction with nuclear extracts from follicular cells. Lanes - and + of the footprinting assays containDNase I cleavage products obtained in the absence or presence of nuclear extracts, respectively. The upper (U) or lower (L) strands of theDNA were labeled by 5' end labeling (upper) or 3' end filling (lower) of the Hindlll site at the left end of the fragment (Fig. 1A). The protectedregions for factor BCFI (residues -57 to -64) are indicated. Asterisks indicate hypersensitive sites. The band shift pattern obtained from a

preparative retardation assay, in which partially methylated promoter fragment A was used as probe, is shown in the middle of the panel.DNA was recovered from complexes Al and A2 as well as from the band containing the free DNA (AO), cleaved with piperidine, and analyzedon the sequencing gels shown on the right. Lanes A contain cleavage products of control fragment A DNA; lanes AO, A1, and A2 containproducts obtained from the corresponding gel retardation bands. G residues which are strongly or weakly undermethylated when bound byBCFI and BCFII are indicated by solid or open circles, respectively. Size markers (lane M) are Maxam and Gilbert A+G sequencing laddersof fragment A, and numbering is relative to the transcription start site of gene HcA.12. (B) The same assays as in panel A but using nuclearextracts derived from BmS tissue culture cells. Note that BmS nuclear extracts yield a single complex with fragment A, equivalent to the Alcomplex obtained from follicular nuclear extracts. (C) The complete nucleotide sequence of the shared 5'-flanking sequences of gene pairHcA/B.12 is shown for both the upper and lower strands and is numbered relative to the transcription start site of gene HcA.12. The bindingdomains for BCFI and BCFII, deduced through the footprinting (lines) and methylation interference (circles) analysis shown above, are

indicated above and below the sequences. Because of the lack of a DNase I footprint, the BCFII-binding domain has been defined indirectlyby the two outer G residues whose methylation interferes with factor binding. Bars I and II below the binding domains indicate the sequencescontained within the synthetic double-stranded oligonucleotides I and II used as binding probes for BCFI and BCFII in subsequentexperiments. The open arrow at position -115 indicates the hypersensitive site described in the legend to Fig. 4.

A

I

VOL. 11, 1991

on April 3, 2019 by guest

http://mcb.asm

.org/D

ownloaded from

1958 SKEIKY AND IATROU

A I n p B I H

c - + -7 I

9a A4.

A3.

A2. WA .*

F

F

p--+ -

w-

so

-'U-0

F F-'T

T

FIG. 3. Binding of BCFI and BCFII to synthetic binding do-mains. Gel retardation assays using follicular (F) or BmS tissueculture (T) cell nuclear extracts with oligonucleotide I or II or

promoter fragment A (P) as probes in the presence (+) or absence(-) of a 100-fold molar excess of oligonucleotides I and II. (A)Reactions using oligonucleotide probes (left) or promoter fragmentA (right) with follicular extracts. Lane C contains control fragmentI. (B) The same as panel A but using extracts derived from Bm5cells. Lane F contains a reaction of the promoter fragment withfollicular extract run as standard for comparing the mobility of theAl-like complex obtained with the BmS extracts to that of complexAl. Complexes Al to A4 are indicated by dots, and unreactedprobes are indicated by arrowheads. The arrows indicate complexesresulting from BCFI binding to the probes.

oligonucleotide II. In contrast, oligonucleotide II was unableto produce a stable complex.A similar set of competition experiments was carried out

using the intact promoter fragment A as probe (Fig. 3A,right). Competition by oligonucleotide I resulted in theelimination of all complexes (however, notice the residualpresence of complex A2), while competition by oligonucle-otide II resulted in the elimination of complexes A2 to A4 butnot Al. These results demonstrate, first, that the bindingdomains for BCFI and BCFII are recognized and bound bythese two factors even when the domains are removed fromtheir normal promoter context. Three additional conclusionscan be drawn from the competition experiments. First,complexes A2, A3, and A4 can be formed only when factorsBCFI and BCFII are both bound to the DNA. Second, stablebinding of factor BCFII to its target sequence is possibleonly when BCFI is already bound to the DNA; apparently,binding of factor BCFII to its cognate sequence does occurin solution, but the binding is unstable under gel retardationassay conditions. Third, binding of factor BCFII to theBCFI-DNA complex increases the stability of BCFI binding;while complex Al is completely eliminated by a 100-foldexcess of oligonucleotide I competitor, a residual amount ofcomplex A2 persists even though in the noncompeted reac-tion, complex Al is two to three times more abundant thancomplex A2 (the residual A2 complex can be eliminated withan increased molar excess of oligonucleotide I competitor;note also the difference between lanes +/- and +/+ in panelA, gel P). It is worth noting that addition of divalent cations(10 mM MgCl2) in the binding reaction of promoter fragmentA resulted in an increase in the intensity of complex A2 atthe expense of Al (not shown), suggesting that Mg2+ stabi-lizes the interaction between BCFI and BCFII.

Similar band shift assays employing promoter fragment Aand oligonucleotides I and II as probes and nuclear extractsderived from Bm5 cells in the presence or absence ofoligonucleotides I and/or II competitors (Fig. 3B) demon-strated again that the binding properties of the nuclear factorin Bm5 cells is identical to factor BCFI in the nuclei offollicular cells.

Binding of factor BCFI to its target sequence is accompa-nied by the induction of structural alterations on the pro-moter DNA: limited DNase I digestion of the promoter DNA(fragment A) following incubation with the follicular nuclearextract resulted in the detection of a prominent DNase Ihypersensitive site at position -115, located approximately50 and 20 bp downstream from the binding sites of factorsBCFI and BCFII, respectively (Fig. 4). This hypersensitivesite was competed out when a 100-fold excess of oligonucle-otide I, but not II, was also added in the binding reaction,suggesting that factor BCFI but not BCFII plays a role in theinduction of the altered structure of the DNA. Whether theinduction of hypersensitivity is a direct consequence ofBCFI binding to its cognate sequence cannot be deducedfrom these experiments. The lack of induction of DNase Ihypersensitivity following incubation with nuclear extractsderived from pooled early and middle choriogenic follicles(Fig. 4, lanes E) suggests that if factors other than BCFI areresponsible for the creation of the hypersensitive sitethrough direct binding, these should be able to bind to theDNA only when factor BCFI is also bound to it. Thus, it isformally possible that these additional factors are not nec-essarily stage or even tissue specific.

Incubation of the promoter fragment with BmS cell nu-clear extracts resulted also in the appearance of the DNase Ihypersensitive site at position -115, albeit at a reducedintensity relative to that of the follicular nuclear extract. Thefrequency of DNase I cleavage at position -115 correlateswith the relative abundance of BCFI in these two types ofextracts (Fig. 3B left), and this corroborates our conclusionsregarding the role of this factor as direct or indirect inducerof the altered conformational state of the DNA.A second (and more prominent) DNase I "hypersensitive

site," apparently induced by the Bm5 nuclear extracts atposition -165 (Fig. 4), results in the shortening of the labeledstrand of the double-stranded probe by four nucleotides.Because this reduction corresponds to the length of theprotruding 3' terminus of this strand, it is likely that theshortening of the DNA is due to a single strand-specific 3'exonuclease or endonuclease present in the Bm5 extractrather than to an altered structure that is recognized byDNase I.

Factor BCFI and erythroid-specific factor GATA-1 sharecommon binding domains. Sequence comparisons betweenthe binding domains of BCFI and other known DNA-bindingproteins revealed that the BCFI-binding site contains thehexanucleotide sequence AGATAA, the recognition se-quence for the erythroid-specific factor GATA-1 (32) (alsoknown as Eryfl, GF-1, or NF-E1; consensus binding se-quence T/AGATAAIG), which has been shown to be re-quired for the transcriptional activation of all globin genes inbirds and mammals (8, 10, 23, 44). To determine whetherfactors BCFI and GATA-1 can bind to the same sequence,we carried out additional mobility shift assays with two newoligonucleotides, E and E* (Fig. SA), containing the authen-tic form and a mutated form, respectively, of the GATA-1(Eryfl)-binding domain of the common enhancer of thechicken P- and e-globin genes. Oligonucleotide E containstwo copies of the GATA-1 recognition sequence (the second

MOL. CELL. BIOL.

on April 3, 2019 by guest

http://mcb.asm

.org/D

ownloaded from

SILKMOTH CHORION PROMOTER-BINDING FACTORS 1959

- Ill-- Cagg'-TTT E B TTT EB X

IL ___0S -165

It _

lb.

w - !

M-M

_ _

__ r

, _

0 -m

do _

00so

04.

do_ .1

di

-- MO <-1 15

FIG. 4. Binding of BCFI induces a major structural alteration inpromoter DNA. Promoter fragment A (Fig. 1A) was used in DNaseI footprinting assays as described in the legend to Fig. 2, except thatthe amount of DNase I was decreased to 0.05 U per assay. Nuclearextracts (X) used in the binding reactions were from total chorio-genic follicular cells (T), pooled early and middle choriogenicfollicular cells (E), or Bm5 cells (B). The assays were carried out inthe presence or absence (-) of a 100-fold molar excess of double-stranded oligonucleotide I or II competitors (C) as indicated. Lanesa and g contain A and G dideoxynucleotide sequencing ladders ofphage M13, and lane g' contains a chemical A+G reaction offragment A. The open arrow at -115 indicates the position of thehypersensitive residue relative to the transcription start site of geneHcA.12 (see also Fig. 2C). The smaller arrow indicates the secondhypersensitive site, at -165, which appears with BmS extracts.Autoradiography was for 20 h (left panel) or 5 h (right panel).

one, TGATAG, is in inverse orientation). Of these, the firstone, AGATAA, represents the only sequence element com-mon to oligonucleotides E and I. Oligonucleotide E* differsfrom E in that the two binding sites have been alteredthrough site-directed mutagenesis. No sequence similaritiesof any substantial length exist between oligonucleotides E*and I.

Mobility shift assays using oligonucleotide I or promoter

AE CAGGTTGCAGATAAACATTTTGCTATCAAGACTTGCACAGACCTTGITTT

CAG-GTTGCCTwCGAAACAT- TTCTCTCC-ACAGACTTGCACAGACCTTGTTT

! T TGTcAcc-1GAGATAAGAAAC| ACAAATA7-l:GAG_ACAATG

B E E* I E* E E E*1 E C S H

WSW A E

FIG. 5. BCFI and erythroid-specific factor GATA-1 recognizethe same DNA-binding sequence. (A) The upper strands of thesynthetic double-stranded oligonucleotides used in the binding as-says described below are shown. The only sequence elementcommon to the GATA-1 (Eryfl)-binding sequence of the chickenP-globin gene enhancer (E) and the BCFI-binding sequence (I) is thecore hexanucleotide AGATAA, indicated in boldface type. Notethat the GATA-1-binding domain contains another copy of theconsensus GATA-1-binding site (T/AGATAA/G) in inverse orienta-tion (complementary strand). Oligonucleotide E* is the same as Ebut contains point mutations in the two binding sites. Oligonucleo-tide II (binding site for BCFII) contains two mismatches in theGATA-1-BCFI core sequence. (B) Gel retardation and competitionanalysis using 4 ,ug of follicular nuclear extracts and oligonucleotideI (left), promoter fragment A (middle), or oligonucleotide E (right) asprobe (indicated below each gel). Binding reactions were in theabsence (-) or presence of a 100-fold molar excess of the competitoroligonucleotides indicated at the top. (C) Band shift analysis usingoligonucleotide probe I in incubation reactions containing nuclearextracts derived from silkmoth follicular (S) and human K562 (H)cells.

fragment A as probes (Fig. 5B, gels I and A, respectively)demonstrated that oligonucleotide E but not E* or II cancompete out the binding of follicular factor BCFI as effi-ciently as oligonucleotide I. The converse experiment, inwhich oligonucleotide E was used as probe (Fig. SB, gel E),confirmed that oligonucleotides E and I but not E* or II areequivalent in terms of their abilities to bind factor BCFI.Since the only common element between oligomers E and Iis the hexamer AGATAA and since this sequence is absentfrom E* (and II), we conclude that this hexamer sequencerepresents the major binding determinant for factor BCFI.

In an additional experiment, a nuclear extract preparedfrom a hemin-stimulated human erythroleukemia cell line,K562, was used in a mobility shift assay in conjunction witholigonucleotide I. As shown in Fig. SC, a major complex wasobtained which migrated with a mobility similar to that of thecomplex obtained with the follicular nuclear extract. Itappears, therefore, that a factor present in the nuclei of theinduced K562 cells, presumably GATA-1, recognizes andforms a stable complex with oligonucleotide I.

Factor BCFI and BCFI-like factor of BmS cells are struc-turally related. Having established that oligonucleotide I can

-- In --

VOL. 11, 1991

on April 3, 2019 by guest

http://mcb.asm

.org/D

ownloaded from

1960 SKEIKY AND IATROU

o 9-0rwp o Q < ,,,o 0 p '? -- T P E/M L- T B B/M I

A4. A3

a. g*!w u:''.

.. ""0

*~~~~---.111_~~~~~0* *" 4

4-

wmvI

* .1 11

T F K

FIG. 6. Partial tryptic cleavage of follicular, Bm5, and K562nuclear extracts. Gel retardation assays following trypsin treatmentof complexes obtained from incubations of oligonucleotide I with 4,ug of nuclear extracts from BmS (T), choriogenic follicular (F), or

K562 (K) cells. Open arrows identify the undigested complexes.Asterisks in the BmS and K562 control lanes indicate complexes thatprobably contain partially degraded binding factors observed afterrepeated freeze-thawing of the extracts. Light arrows identify pro-teolyzed complexes that are common to all three extracts. Heavyarrows indicate the four complexes that distinguish the K562 extractfrom those of follicular and BmS cells. The free probe is shown bythe arrowhead, and numbers at the top indicate nanograms oftrypsin added to each binding reaction. Lane C contains controlprobe (no extract).

be recognized by and form stable complexes with at leasttwo phylogenetically distinct DNA-binding nuclear proteins(one, presumably GATA-1, present in human K562 cells,and the other, BCFI, present in silkmoth follicular cells), wecarried out a modified band shift assay to address thequestion of whether or not the follicular and Bm5 cellnuclear factors that form stable complexes with oligonucle-otide I are structurally related. The nuclear extracts used inthese experiments were subjected to partial proteolysis withincreasing concentrations of trypsin, with the expectationthat the partially proteolyzed binding factors that maintain afunctional binding domain would give rise to complexes withaltered migration properties. Electrophoretic analysis of thepartially trypsinized complexes obtained from incubationswith nuclear extracts of K562, Bm5, and choriogenic follic-ular cells revealed, as expected, the formation of multiplecomplexes (Fig. 6). While identical patterns of progressivelyfaster migrating complexes were obtained from the follicularand Bm5 extracts, the pattern obtained with the K562extract could be distinguished from that of the silkmothextracts by the presence of at least four bands. Therefore, onthe basis of the migration properties of the complexesobtained after partial trypsin digestion, it appears that theoligonucleotide I binding factors present in choriogenic

_ _ ~A2* E

FIG. 7. Temporal accumulation of factors BCFI and BCFII. Allband shift assays were performed using as probe fragment A of theHc.12 promoter (Fig. 1A) in the presence of 4 p.g of the appropriatenuclear extract. (A) Band shifts with nuclear extracts derived fromprechoriogenic follicular cells (lane P) and from early and middle(lane E/M), late (lane L), and total (lane T) choniogenic follicularcells. (B) Band shift assays using total choriogenic (lane T), Bm5(lane B), and a mixture of BinS and early and middle choriogenic(lane B/M) nuclear extracts. Lane I is the same as lane B/M but inthe presence of oligonucleotide I competitor. Lane contains theprobe (no extract). The four complexes formed on fragment A withfollicular nuclear extracts are identified by dots, and the unboundprobe is indicated by an arrowhead.

follicular (BCFI) andBiIcells are closely related and are,most probably, the same. This suggests that BinS cells arerelated to follicular cells in terms of lineage. Furthermore,these results demonstrate that small domains of the follicular(BCFI) and human (GATA-1) nuclear factors are sufficientfor specific DNA binding.Appearance of BCFI and BCFII in foilicular nuclei corre-

lates with activation of late chorion genes. The developmentalspecificity of the factors that form complexes Al to A4 onthe Hc gene promoter (fragment A) was examined by gelretardation assays using nuclear extracts derived fromstaged follicles (Fig. 7, left). While the extracts derived fromlate choriogenic follicles (last 50% of nonovulated follicles ofeach ovariole; fractional positions 0.5 to 1.0 [31]) producedall four complexes, those derived from prechoriogenic ormixed early and middle choriogenic follicles (combinedchoriogenic follicles from fractional positions 0 to 0.5 [31])did not yield any complexes at all, although all three ex-tracts, when used in conjunction with the Bombyx cytoplas-mic actin gene promoter, produced equivalent complexes(not shown). Considering that complexes A2 to A4 containfactor BCFI (as well as BCFII; Fig. 3) and that this factor isan absolute requirement for their formation (Fig. 3), it isobvious that none of them could be formed on the DNA evenif the participating factors were present in the nuclei ofprechoriogenic, early, or middle choriogenic follicular cells.Therefore, factor BCFI, the sine qua non for in vitrocomplex formation on promoter fragment A, is also likely tobe one of the major determinants of late-chorion-gene func-tion.To find out whether BCFII behaves in the same manner as

BCFI or whether it is present in follicular nuclei at earlierchoriogenic stages, we capitalized on the demonstration thatBmn nuclei contain only BCFI and carried out gel retarda-tion assays using Bin nuclear extracts in conjunction with

MOL. CELL. BIOL.

-w--4-

IF----

on April 3, 2019 by guest

http://mcb.asm

.org/D

ownloaded from

SILKMOTH CHORION PROMOTER-BINDING FACTORS 1961

follicular ones (Fig. 7, right). Our rationale has been that ifBCFII is present in early or middle choriogenic follicularnuclei, it should be able to form detectable complexes withthe promoter DNA, provided that BCFI is also suppliedthrough the addition of BmS nuclear extract. Incubation ofthe promoter fragment with the mixture of early and middlechoriogenic extracts in the presence of BmS nuclear extract(which contains BCFI) resulted in the formation of a singlecomplex (lane B/M). The identity of this complex as Al(factor BCFI) was established through its competition byoligonucleotide I (lane I). These results demonstrate that, aswas the case with BCFI, BCFII is present only during latechoriogenesis in follicular nuclei, i.e., the stage which ismarked by the transcriptional activation of Hc genes.

DISCUSSION

The initial characterization of nuclear proteins that bind tospecific promoter domains of chorion genes expressed dur-ing late choriogenesis has revealed that a subset of them,factors BCFI and BCFII, are promoter specific and accumu-late in follicular cells but not in other silkmoth tissues inwhich chorion genes are transcriptionally silent. Further-more, factors BCFI and BCFII are detectable in follicularnuclei only at a time that coincides with the transcriptionalactivation of Hc genes. Therefore, it is reasonable to con-clude that these two DNA-binding proteins represent bonafide transcription factors.

Factor BCFI is likely to be a key determinant of late-chorion-gene function, because no stable in vitro complexformation is possible on the left half of the promoter DNA inits absence, despite the fact that other factors with definedbinding specificity, particularly BCFII, can form unstablecomplexes with their cognate binding domains. Binding ofBCFI to the promoter not only stabilizes the binding ofBCFII, presumably through protein-protein contacts, but italso allows the formation of higher-order complexes contain-ing other factors that are not necessarily promoter or tissuespecific. It is possible that the ability of the latter to assembleas complexes A3 and A4 depends on structural perturbationsof the DNA induced by the binding of factor BCFI. Thesepertubations were evident when the DNA was subjected tolimited digestion with DNase I (appearance of a hypersensi-tive site downstream of the BCFII-binding domain). Addi-tional experiments (not shown) have revealed that binding ofBCFI is associated with a significant DNA bending effect aswell as with unwinding of the DNA at the binding domain(37a). Alternatively, it is possible that the observed struc-tural alterations are consequences of secondary complexformation. Irrespective of whether such perturbations rep-resent direct or indirect consequences of BCFI binding, theycould mediate the assembly of transcription preinitiationcomplexes by facilitating, first, the binding of additionalfactors and, second, the interaction of the complexes de-tected on the left half of the promoter with other factors thatbind to basal or gene-specific control elements located on theright half of the promoter. Thus, the answer to the funda-mental question of how the two genes in each pair can becoregulated by a shared promoter element which does notcontain obvious sequence duplications or perfect palin-dromes of any significant length may relate to the ability ofsingle copies of key trans-acting regulatory factors to con-tact other gene regulators either in an alternate on-offfashionor simultaneously through the availability of duplicatedfunctional protein domains. Both types of interactions wouldprobably require structural alterations of the promoter

-50 -70

- m_enm.. --2 r_ 1 __ -v v v sHc12

Hc 3HclOHc 9Hc 2Hc 4

R 3L 4LllL 2R 2x 1X 2

-80 -1000* * -

t t - 15a +2

a~~~~~~t

CgTGgTCACCTTc gGATAA cAgA-AtTTCA-TaAtgAAaAGTTGtGAAACtAgAgTAaTcTG A cGGGAA

caattL12 atT--cCAataaG gGAcgAL14 A gL 6 AL 3 g

FIG. 8. Comparative analysis of consensus promoter sequencesof chorion gene pairs of late, middle, and early-middle specificity.These classes of genes are exemplified by Hc.12 (for HcA/B.12), R3(for A/B.R3), and L12 (for A/B.L12), respectively. The consensussequences (from -44 to -104 of the HcA.12 gene) are repre-sentative of all 15 Hc, 10 middle, and 8 early-middle gene pairs thathave been sequenced to date and are aligned with respect to thesequence of the Hc.12 promoter. Lowercase letters indicate differ-ences from the Hc consensus sequence. Only point mutations whichoccur in the BCFI- and BCFII-binding domains (indicated in bold-face type) and segmental mutations which affect the spacing be-tween the BCFI and BCFII domains (arrow for the 2-bp insertion,bracket for the 15-bp deletion, and dashes for the 1-bp deletions) areindicated for each class of genes below their respective consensussequences. A 5-bp insertion occurring in the BCFI-like domain of allknown L12 class genes is underlined above the L12 consensussequence. The G residues of the two sites for which methylationinterference has been observed are identified by open and solidcircles, and the core BCFI and GATA-1 recognition sequence isboxed.

DNA, e.g., bending or looping of spacer sequences, asmediators of contacts between trans-acting molecules.Comparative analysis of published promoter sequences

from chorion genes of a variety of developmental specifici-ties (2, 14, 40) reveals that the sequences and spacing of thebinding domains for factors BCFI and BCFII are conservedin all Hc gene pairs (Fig. 8), which are expressed exclusivelyduring late choriogenesis. Point mutations exist in the BCFI-binding site of only 2 of the 15 Hc pairs of the locus, butthese do not affect the hexamer core sequence AGATAA orany of the G residues of the binding domain for which theweak methylation interference effect was observed. One ofthese two gene pairs also carries a 2-bp insertion 3' to theBCFI-binding domain, which changes its spacing from theBCFII-binding site from 19 to 21 bp. Our prediction is thatthis mutation should not significantly change the stereospe-cific alignment of the two factors on the DNA helix andshould not affect their interactive properties. Two additionalHc gene pairs contain a single point mutation, each in thebinding domain for factor BCFII. None of these mutationsaffect residues whose importance for BCFII binding hasbeen deduced through methylation interference assays. Fi-nally, one Hc gene pair, Hc.3 (Fig. 8), which contains a15-bp deletion 3' to the BCFI-binding site, is also present inthe chorion locus. The deletion reduces the spacing betweenthe two binding sites from almost two turns to one-half turnof the helix. Considering the demonstrated BCFI-dependentstabilization of BCFII binding to the DNA (presumablyinduced by BCFI-BCFII contacts), it could be predicted thatthe promoter sequence of this Hc gene pair would not bestably bound by BCFII and, consequently, would be tran-

VOL . 1 l, 1991

on April 3, 2019 by guest

http://mcb.asm

.org/D

ownloaded from

1962 SKEIKY AND IATROU

scriptionally inert. The promoter fragment of this Hc genepair has been used as probe in gel retardation assays; only asingle complex, equivalent to complex Al of the promoterfragment A of gene pair Hc.12, was detected with follicularnuclear extracts, and this complex was eliminated in thepresence of competitor oligonucleotide I but not II (notshown). Presumably, BCFII is unable to productively con-tact BCFI to form complex A2, and this also results in theelimination of secondary complexes A3 and A4, whichdepend on the formation of complex A2.Examination of promoter sequences of genes expressed at

early choriogenic stages (14, 21) revealed that these geneslack both the BCFI- and the BCFII-binding domains. On theother hand, all chorion genes of early-middle developmentalspecificities (prototype gene pair, A/B.L12; Fig. 8), contain aBCFII-like-binding sequence, aTTGtGAAAa, whose loca-tion matches that of the BCFII domain of the Hc genepromoters. This sequence, however, differs from the BCFII-binding domain in three positions. Two of these pointmutations (G-to-A transitions) involve G residues that havebeen shown to be intimately contacted by the factor. Fur-thermore, these genes do not contain significant homologiesto the BCFI-binding domain. Presumably, neither BCFI norBCFII can bind to early and middle promoter sequences.This has been convincingly demonstrated by the inability ofthe promoter of gene pair A/B.L12 (early-middle specificity)to act as competitor inhibiting the formation of complexesAl and A2 of the late promoter (Fig. 1).

Finally, with only one exception, all chorion gene pairs ofmiddle specificity (prototype pair, A/B.R3; Fig. 8) contain aproperly located BCFII-like-binding domain that differs fromthat of the Hc BCFII site by a single A-to-T transversion. Inaddition, middle gene pairs also contain a BCFI-like se-quence upstream of the BCFII-like domain. However, thissequence differs from that of the Hc BCFI-binding domain ineither of two positions, one of which may be critical forBCFI binding. In 6 of the 10 middle A/B gene pairs of thechorion locus, this change involves an A-to-G transition inthe core hexanucleotide AGATAA, which was shown to becrucial for BCFI (and GATA-1) binding. Furthermore, thespacing of the two putative binding sequences in all middlechorion gene promoters is reduced from 19 to 17 bp. It istherefore likely that a reduced affinity of factor BCFI for thealtered binding domain coupled with the different spatialarrangement of factor BCFII on the DNA relative to BCFIwill prevent BCFI-BCFII synergism and formation of com-plexes A2 to A4 on the middle promoters during latechoriogenesis, when factors BCFI and BCFII are present infollicular nuclei. The single exception, gene pair A/B.L4(Fig. 8), contains a perfect BCFI-binding domain but also acritical G-to-C transversion in the binding site for BCFII. Itis therefore predicted that the promoter of this gene pairshould be able to form only complex Al (resulting from thebinding of factor BCFI). The same prediction could be madefor the remaining two gene pairs, Xl and X2 (Fig. 8), whichcontain a perfect AGATAA sequence for BCFI binding butreduced spacing between the BCFI- and BCFII-bindingdomains. This prediction has been tested using the X2promoter fragment (residues +7 to -157 of the A.X2 gene)in gel retardation assays with total follicular nuclear ex-tracts. The assays revealed the formation of multiple com-plexes (not shown). Competition with oligonucleotide Iresulted in the elimination of only one of these complexes(the fastest-migrating one) but had no effect on any of theothers. Thus, it is evident that the promoter sequencesadjacent to the BCFI-binding domain prohibit this factor

from determining second-order complex formation on genepairs of middle developmental specificity, particularly withrespect to stabilization of BCFII binding.One obvious question that arises from these sequence

comparisons and the documented absence of BCFII frommiddle choriogenic nuclei is why A/B gene pairs of middlespecificity maintain a BCFII-binding domain. It is conceiv-able that this sequence, in conjunction with neighboringdomains, is recognized by a different factor that is present infollicular nuclei during middle choriogenesis. Although thevalidity of this hypothesis remains to be demonstrated, thereis ample precedent for differential gene regulation on thebasis of recognition of specific promoter sequences bydifferent (and developmentally distinct) trans-acting factorsthat exert their effects through a multitude of combinatorialinteractions (reviewed in references 19, 22, 26, and 33).The occurrence in the nuclei of Bm5 cells of a DNA-

binding protein whose properties are identical to those ofBCFI raises questions regarding the origin of these cells.This line (13) was derived from ovarian tissue, which con-tains cells of mesodermal origin (follicular epithelium andsheath) as well as germ line cells (nurse cells and oocytes),but its exact lineage is unknown. It is possible that Bm5 cellshave originated from follicular cells but differentiatedtowards a different pathway because of altered environmen-tal conditions and accumulation of mutations that cannot beselected against in vitro. Our recent finding that the nuclei offollicular and Bm5 cells contain 20-hydroxyecdysone recep-tors (2a) is consistent with the notion that Bm5 cells aredescendants of follicular cells. The endogenous choriongenes of Bm5 cells are transcriptionally silent, and thesecells cannot accurately transcribe transfected chorion genes(37a). Clearly, although factor BCFI appears to be necessaryfor late-chorion-gene transcription initiation, it is not byitself sufficient. It would be of interest to see whetherecdysteroid treatment of these cells can induce changes inthe type of complexes that can form on chorion promoterDNA and in the transcriptional behavior of the resident ortransfected chorion genes.The demonstration that two phylogenetically distinct and

functionally unrelated DNA-binding proteins, GATA-1 andBCFI, have similar, if not identical, binding-sequence re-quirements is not unique. For example, the yeast factorsGCN4 and HAP2,3 activate the amino acid biosynthetic andoxygen-regulated genes, respectively, whereas their mam-malian counterparts jun/AP-1 and CP-1 activate a variety ofgenes whose functions are unrelated to those of yeast cells(3, 41). In the absence of knowledge regarding the primarystructure of BCFI, no conclusions can be drawn aboutthe structural and evolutionary relationships between thisfactor and the GATA-1 protein of higher vertebrates. Therecent cloning of chicken, mouse, and human GATA-1 (7,42, 43, 45) revealed that this factor belongs to a novel classof zinc finger DNA-binding proteins distinguishable from theTFIIIA-Spl-type (20, 25) and the steroid hormone receptorfamily of proteins (1, 6) by the presence of repeated zincfinger motifs of the type Cys-X2-Cys-X17-Cys-X2-Cys.Therefore, the possibility that BCFI may also be a zincfinger-containing protein should be entertained. The recentcloning oftwo Drosophila chorion transcription factors, CF1and CF2 (37), which bind to promoter sequences unrelatedto the Bombyx BCFI- and BCFII-binding regions has dem-onstrated that such an assumption is not unreasonable. BothCF1 and CF2 were found to contain zinc finger domains thatare presumably responsible for their DNA-binding proper-ties. On the other hand, comparative analysis of the known

MOL. CELL. BIOL.

on April 3, 2019 by guest

http://mcb.asm

.org/D

ownloaded from

SILKMOTH CHORION PROMOTER-BINDING FACTORS 1963

GATA-1 sequences has revealed a remarkable conservationin the primary structure of the DNA-binding domains be-tween birds and mammals, despite the fact that the mamma-lian polypeptides show a high degree of divergence fromtheir avian counterparts in other regions that probablyinclude the transcriptional activation domains. Consideringthat the mechanisms of transcription are remarkably con-served throughout the eukaryotic kingdom, it is conceivablethat the Bombyx (BCFI) and vertebrate (GATA-1) factorsshare sequence similarities in their DNA-binding domains.We have already exploited the evolutionary conservation inthe GATA-1-binding domains and have cloned distinct se-quences from Bombyx genomic DNA that contain GATA-1-like zinc finger motifs (3a). Whether any of these sequencescorrespond to the BCFI gene remains to be determined.

ACKNOWLEDGMENTS

We thank M. Brown for drawing our attention to the similaritybetween the binding domains of BCFI and GATA-1 and for provid-ing nuclear extracts of K562 cells; N. A. Spoerel, H. T. Nguyen, andT. H. Eickbush for providing chorion genes of early-middle andmiddle specificities; P. Couble for his gift of the cytoplasmic actingene; G. Felsenfeld for his gifts of the wild-type and mutant GATA-1(Eryfl)-binding oligonucleotides; J. D. McGhee for critical com-ments on the manuscript; and C. Berglind for expert secretarialsupport.

This work has been supported by the Medical Research Council ofCanada.

REFERENCES1. Beato, M. 1989. Gene regulation by steroid hormones. Cell

56:335-344.2. Burke, W. D., and T. H. Eickbush. 1986. The silkmoth late

chorion locus. I. Variation within two paired multigene families.J. Mol. Biol. 190:343-356.

2a.Cherbash, L., P. Cherbas, and K. Iatrou. Unpublished data.3. Chodosh, L. A., J. Olesen, S. Hahn, A. S. Baldwin, L. Guarente,

and P. A. Sharp. 1988. A yeast and human CCAAT-bindingprotein have heterologous subunits that are functionally inter-changeable. Cell 53:25-35.

3a.Drevet, J., Y. A. W. Skeiky, and K. Iatrou. Unpublished data.4. Eickbush, T. H., and W. D. Burke. 1985. Silkmoth chorion gene

families contain patchwork patterns of sequence homology.Proc. Natl. Acad. Sci. USA 82:2814-2818.

5. Eickbush, T. H., and F. C. Kafatos. 1982. A walk in the chorionlocus of Bombyx mori. Cell 29:633-643.

6. Evans, R. M. 1988. The steroid and thyroid hormone receptorsuperfamily. Science 240:889-895.

7. Evans, T., and G. Felsenfeld. 1989. The erythroid-specific tran-scription factor Eryfl: a new zinc finger protein. Cell 58:877-885.

8. Evans, T., M. Reitman, and G. Felsenfeld. 1988. An erythrocyte-specific DNA-binding factor recognizes a regulatory sequencecommon to all chicken globin genes. Proc. Natl. Acad. Sci.USA 85:5976-5980.

9. Galas, D., and A. Schmitz. 1978. DNase footprinting: a simplemethod for the detection of protein-DNA binding specificity.Nucleic Acids Res. 5:3157-3170.

10. Galson, D. L., and D. E. Housman. 1988. Detection of twotissue-specific DNA binding proteins with affinity for sites in themouse ,-globin intervening sequence 2. Mol. Cell. Biol. 8:381-392.

11. Goldsmith, M. R. 1989. Organization and developmental timingof the Bombyx mori chorion gene clusters in strain C108. Dev.Genet. 10:16-23.

12. Goldsmith, M. R., and E. Clermont-Rattner. 1980. Organizationof the chorion genes of Bombyx mori. III. Detailed markercomposition of three gene clusters. Genetics 96:201-212.

13. Grace, T. D. C. 1967. Establishment of a line of cells from thesilkworm Bombyx mori. Nature (London) 216:613.

14. Hibner, B. L., W. D. Burke, R. Lecanidou, G. C. Rodakis, andT. E. Eickbush. 1988. Organization and expression of three earlygenes from the silkmoth early chorion locus. Dev. Biol. 125:423-431.

15. Iatrou, K., and S. G. Tsitilou. 1983. Coordinately expressedchorion genes of Bombyx mori: is developmental specificitydetermined by secondary structure recognition? EMBO J.2:1431-1440.

16. Iatrou, K., S. G. Tsitilou, and F. C. Kafatos. 1984. DNAsequence transfer between two high-cysteine chorion genefamilies in the silkmoth Bombyx mori. Proc. Natl. Acad. Sci.USA 81:4452-4456.

17. Johnson, P. F., and S. L. McKnight. 1989. Eukaryotic transcrip-tional regulatory proteins. Annu. Rev. Biochem. 58:799-839.

18. Jones, C. W., and F. C. Kafatos. 1980. Coordinately expressedmembers of two chorion multi-gene families are clustered,alternating and divergently orientated. Nature (London) 284:635-638.

19. Jones, N. 1990. Transcriptional regulation by dimerization: twosides to an incestuous relationship. Cell 61:9-11.

20. Kadonaga, J. T., K. R. Carner, F. R. Masiarz, and R. Tjian.1987. Isolation of cDNA encoding transcription factor Spl andfunctional analysis of the DNA binding domain. Cell 51:1079-1090.

21. Lecanidou, R., G. C. Rodakis, T. H. Eickbush, and F. C.Kafatos. 1986. Evolution of the silkmoth chorion gene super-family: gene families CA and CB. Proc. Natl. Acad. Sci. USA83:6514-6518.

22. Maniatis, T., S. Goodbrown, and I. A. Fischer. 1987. Regulationof inducible and tissue-specific gene expression. Science 236:1237-1245.

23. Martin, I. K., S.-F. Tsai, and S. H. Orkin. 1989. Increased-y-globin expression in a nondeletion HPFH mediated by anerythroid-specific DNA-binding factor. Nature (London) 338:435-438.

24. Maxam, A. M., and W. Gilbert. 1980. Sequencing end-labeledDNA with base-specific chemical cleavages. Methods Enzymol.65:499-560.

25. Miller, J., A. D. McLachlan, and A. Klug. 1985. Repetitivezinc-binding domains in the protein transcription factor IIIAfrom Xenopus oocytes. EMBO J. 4:1609-1614.

26. Mitchell, P. J., and R. Tjian. 1989. Transcriptional regulation inmammalian cells by sequence-specific DNA binding proteins.Science 245:371-378.

27. Mitsialis, S. A., and F. C. Kafatos. 1985. Regulatory elementscontrolling chorion gene expression are conserved between fliesand moths. Nature (London) 317:453-456.

28. Mitsialis, S. A., N. A. Spoerel, M. Leviten, and F. C. Kafatos.1987. A short defined DNA region is sufficient for developmen-tally correct expression of moth chorion genes in Drosophila.Proc. Natl. Acad. Sci. USA 84:7987-7991.

29. Mitsialis, S. A., S. Veletza, and F. C. Kafatos. 1989. Transgenicregulation of moth chorion gene promoters in Drosophila:tissue, temporal and quantitative control of four bidirectionalpromoters. J. Mol. Evol. 29:486-495.

30. Mounier, N., and J.-C. Prudhomme. 1986. Isolation of actingenes in Bombyx mori: the coding sequence of a cytoplasmicactin gene expressed in the silkgland is interrupted by a singleintron in an unusual position. Biochimie 68:1053-1061.

31. Nadel, M. R., and F. C. Kafatos. 1980. Specific protein synthesisin cellular differentiation. IV. The chorion proteins of Bombyxmori and their program of synthesis. Dev. Biol. 75:26-40.

32. Orkin, S. H. 1990. Globin gene regulation and switching: circa1990. Cell 63:665-672.

33. Nussinov, S. 1990. Sequence signals in eukaryotic upstreamregions. Biochem. Mol. Biol. 25:185-224.

34. Peterson, C. L., and K. L. Calame. 1987. Complex proteinbinding within the mouse immunoglobulin heavy-chain en-hancer. Mol. Cell. Biol. 7:4194-4203.

35. Rodakis, G. C., and F. C. Kafatos. 1982. Origin of evolutionarynovelty in proteins: how a high-cysteine chorion protein hasevolved. Proc. Natl. Acad. Sci. USA 79:3551-3555.

36. Schreiber, E., P. Matthias, M. M. Muller, and W. Schaffner.

VOL . 1l, 1991

on April 3, 2019 by guest

http://mcb.asm

.org/D

ownloaded from

1964 SKEIKY AND IATROU

1988. Identification of a novel lymphoid specific octamer bind-ing protein (OTF-2B) by proteolytic clipping bandshift assay(PCBA). EMBO J. 7:4221-4229.

37. Shea, M. J., D. L. King, M. J. Conboy, B. D. Mariani, and F. C.Kafatos. 1990. Proteins that bind to Drosophila chorion cis-regulatory elements: a new C2H2 zinc finger protein and a C2C2steroid receptor-like component. Genes Dev. 4:1128-1140.

37a.Skeiky, Y. A. W., and K. Iatrou. Unpublished data.38. Skeiky, Y. A. W., and K. Iatrou. 1990. Silkmoth chorion

antisense RNA structural characterization, developmental reg-ulation and evolutionary conservation. J. Mol. Biol. 213:53-66.

39. Spoerel, N., H. T. Nguyen, and F. C. Kafatos. 1986. Generegulation and evolution in the chorion locus of Bombyx mori:structural and developmental characterization of four eggshellgenes and their flanking DNA regions. J. Mol. Biol. 190:23-35.

40. Spoerel, N. A., H. T. Nguyen, T. H. Eickbush, and F. C. Kafatos.1989. Gene evolution and regulation in the chorion complex ofBombyx mori: hybridization and sequence analysis of multipledevelopmentally middle A/B chorion gene pairs. J. Mol. Biol.

MOL. CELL. BIOL.

209:1-19.41. Struhl, K. 1987. The DNA binding domain of jun oncoprotein

and the yeast GCN4 transcriptional activator protein are func-tionally homologous. Cell 50:841-846.

42. Trainor, C. D., T. Evans, G. Felsenfeld, and M. S. Bogusky.1990. Structure and evolution of a human erythroid transcrip-tion factor. Nature (London) 343:92-96.

43. Tsai, S.-F., D. I. K. Martin, L. I. Zon, A. D. D'andrea, G. W.Wong, and S. H. Orkin. 1989. Cloning of cDNA for the majorDNA-binding protein in erythroid lineage through expression inmammalian cells. Nature (London) 339:446 451.

44. Wall, L., E. de Boer, and F. Grosveld. 1988. The human 0-globingene 3' enhancer contains multiple binding sites for an eryth-roid-specific protein. Genes Dev. 2:1089-1100.

45. Zon, L. I., S.-F. Tsai, S. Burgess, P. Matsudaira, G. A. P. Bruns,and S. H. Orkin. 1990. The major human erythroid DNA-binding protein (GF-1): primary sequence and localization of thegene to the X chromosome. Proc. Natl. Acad. Sci. USA87:668-672.

on April 3, 2019 by guest

http://mcb.asm

.org/D

ownloaded from