Synergistic Contribution of the Legionella pneumophila lqs Genes … · LqsA was recently...

JOURNAL OF BACTERIOLOGY, Nov. 2008, p. 7532–7547 Vol. 190, No. 220021-9193/08/$08.00�0 doi:10.1128/JB.01002-08Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Synergistic Contribution of the Legionella pneumophila lqs Genes toPathogen-Host Interactions�†

Andre Tiaden,1 Thomas Spirig,1 Paula Carranza,2 Holger Bruggemann,3‡ Kathrin Riedel,2 Leo Eberl,2Carmen Buchrieser,3 and Hubert Hilbi1*

Institute of Microbiology, ETH Zurich, Wolfgang-Pauli-Strasse 10, 8093 Zurich, Switzerland1; Institute of Plant Biology, University ofZurich, Zollikerstr. 10, 8008 Zurich, Switzerland2; and Unite de Biologie des Bacteries Intracellulaires and

CNRS URA 2171, Institut Pasteur, 28 Rue du Dr Roux, 75724 Paris, France3

Received 20 July 2008/Accepted 9 September 2008

The causative agent of Legionnaires’ disease, Legionella pneumophila, is a natural parasite of environmentalprotozoa and employs a biphasic life style to switch between a replicative and a transmissive (virulent) phase.L. pneumophila harbors the lqs (Legionella quorum sensing) cluster, which includes genes encoding the auto-inducer synthase LqsA, the sensor kinase LqsS, the response regulator LqsR, and a homologue of HdeD, whichis involved in acid resistance in Escherichia coli. LqsR promotes host-cell interactions as an element of thestationary-phase virulence regulatory network. Here, we characterize L. pneumophila mutant strains lacking allfour genes of the lqs cluster or only the hdeD gene. While an hdeD mutant strain did not have overt physiologicalor virulence phenotypes, an lqs mutant showed an aberrant morphology in stationary growth phase and wasdefective for intracellular growth, efficient phagocytosis, and cytotoxicity against host cells. Cytotoxicity wasrestored upon reintroduction of the lqs genes into the chromosome of an lqs mutant strain. The deletion of thelqs cluster caused more-severe phenotypes than deletion of only lqsR, suggesting a synergistic effect of the otherlqs genes. A transcriptome analysis indicated that in the stationary phase more than 380 genes were differ-entially regulated in the lqs mutant and wild-type L. pneumophila. Genes involved in protein production,metabolism, and bioenergetics were upregulated in the lqs mutant, whereas genes encoding virulence factors,such as effectors secreted by the Icm/Dot type IV secretion system, were downregulated. A proteome analysisrevealed that a set of Icm/Dot substrates is not produced in the absence of the lqs gene cluster, which confirmsthe findings from DNA microarray assays and mirrors the virulence phenotype of the lqs mutant strain.

In the environment, Legionella pneumophila colonizes a widerange of aquatic habitats, including biofilms, but most promi-nently, the gram-negative bacteria survive as intracellular par-asites of free-living amoebae (20). The eukaryotic phagocytesprovide nutrients and protection against adverse conditionsand may serve as transmission vectors (26, 32). The interac-tions between L. pneumophila and protozoa likely selected apool of bacterial virulence traits that support bacterial survivaland replication within mammalian phagocytes (8, 44). Indeed,upon inhalation of aerosols from contaminated water sources,L. pneumophila replicates within and kills alveolar macro-phages (50), thereby causing inflammation and potentiallyevoking a life-threatening pneumonia termed Legionnaires’disease.

L. pneumophila establishes its intracellular niche in host cellsby forming Legionella-containing vacuoles (LCVs), whereinthe bacteria are not degraded but rather replicate. To this end,LCVs avoid the endosomal pathway by inhibiting phagosome-lysosome fusion and instead recruit early secretory vesicles and

the endoplasmic reticulum (66). A key bacterial factor involvedin efficient uptake and formation of LCVs is the Icm/Dot typeIV secretion system (T4SS) (31, 63, 71). The Icm/Dot T4SS isa DNA conjugation system that also translocates bacterial ef-fector proteins into the host cell (62). To date, more than 50Icm/Dot-secreted proteins have been identified as putative ef-fectors, many of which form families of paralogues (53). Someof these effectors interfere with host cell trafficking by mod-ulating GTPase activity or phosphoinositide metabolism (8,30, 53).

The life-style of a facultative intracellular bacterium is char-acterized by the exposure to intracellular as well as extracel-lular environments. To accommodate these changes, L. pneu-mophila adopts a biphasic life cycle that is characterized by thetransition from a replicative phase to a transmissive (virulent)phase (46). This transition is mirrored by distinct gene expres-sion patterns (9). Upon entry of L. pneumophila into the sta-tionary growth phase, virulence genes required for transmis-sion and infection of host cells are preferentially expressed.These genes are repressed in the replicative phase, duringwhich components of aerobic metabolism as well as amino acidand carbohydrate catabolism are upregulated. The global shiftin gene expression is governed by a complex regulatory net-work, including the alternative sigma factors RpoS (�S/�38) (4,27) and FliA (�28) (28, 45), as well as conserved RNA bindingproteins, such as Hfq (40) and CsrA (RsmA). The latter is aglobal repressor of transmission traits and an essential activa-tor of intracellular replication (19, 21, 47).

Two-component systems such as LetA/LetS, CpxR/CpxA,

* Corresponding author. Mailing address: Institute of Microbiology,ETH Zurich, Wolfgang-Pauli-Strasse 10, 8093 Zurich, Switzerland.Phone: (41) 44 632 4782. Fax: (41) 44 632 1137. E-mail: [email protected].

† Supplemental material for this article may be found at http://jb.asm.org/.

‡ Present address: Max Planck Institute for Infection Biology, De-partment of Molecular Biology, Chariteplatz 1, 10117 Berlin, Ger-many.

� Published ahead of print on 19 September 2008.

7532

on October 20, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

https://crossmark.crossref.org/dialog/?doi=10.1128/JB.01002-08&domain=pdf&date_stamp=2008-11-15

http://jb.asm.org/

PmrA/PmrS, and the response regulator LqsR have also beenimplicated in the regulation of transmissive traits of L. pneu-mophila. LetA/LetS activates transmissive traits upon enteringthe stationary growth phase through a relief of repressioninduced by CsrA (19, 21, 47), whereas CpxR and PmrA pro-mote the expression of several Icm/Dot components and trans-located substrates, respectively (3, 23, 75). Recently, we char-acterized the putative response regulator LqsR as a novelelement of the virulence regulatory network controlled byRpoS and LetA (70). LqsR was found to promote pathogen-host cell interactions, such as phagocytosis, formation of theLCV, intracellular replication, and cytotoxicity, while delayingthe entry of L. pneumophila into the replicative growth phase.DNA microarray analysis demonstrated that lqsR regulates theexpression of genes involved in virulence, motility, and celldivision.

In Vibrio spp. or Pseudomonas spp., endogenously producedand secreted small molecules termed autoinducers regulatevirulence (7, 10, 22). The minimum set of these quorum sens-ing systems comprises an autoinducer synthase, which pro-duces the autoinducer signal, and a cytoplasmic transcriptionfactor that modulates gene expression upon binding of thesignaling molecule. More-complex quorum sensing networksinclude two-component systems and phosphorelay systems,which detect, transmit, and integrate multiple signals (29). TheL. pneumophila virulence-associated response regulator lqsR islocated within the lqs (Legionella quorum sensing) cluster(lqsA-lqsR-hdeD-lqsS), which includes genes encoding the au-toinducer synthase LqsA, the sensor kinase LqsS, and theputative membrane protein HdeD. In Escherichia coli, thehdeD gene is localized on an acid fitness island and involved inacid resistance (38, 39). LqsA was recently characterized as apyridoxal 5�-phosphate-dependent enzyme producing the dif-fusible signaling molecule 3-hydroxy-pentadecan-4-one (68).The clustering and orientation of the lqsA-lqsR-lqsS genes areconserved among different bacterial species (70), suggesting afunctional relationship among the individual genes. LqsA andLqsS are homologues of the CqsAS quorum sensing compo-nents identified in Vibrio cholerae and other marine Vibrio spp.,which contribute to regulation of type III secretion, metallo-protease production, virulence, and bioluminescence (29, 41).

Here, we demonstrate that L. pneumophila lacking all fourgenes of the lqs cluster is more severely defective for a numberof transmissive traits than an lqsR single mutant strain, andtranscriptome as well as proteome data indicate that a set ofIcm/Dot-secreted effector proteins is not produced in the ab-sence of the lqs gene cluster. Thus, the lqs genes synergisticallyparticipate in pathways controlled by lqsR.

MATERIALS AND METHODS

Bacteria, phagocytes, and reagents. The bacterial strains used are listed inTable 1. L. pneumophila was grown on charcoal-yeast extract (CYE) agar plates(18) or in ACES [N-(2-acetamido)-2-aminoethanesulfonic acid]-buffered yeastextract (AYE) medium. Acanthamoeba castellanii (ATCC 30234) was grown inproteose-yeast extract-glucose (PYG) medium at 30°C (43, 65). High-strengthgel agar (Serva), proteose peptone (Becton Dickinson Biosciences), and yeastextract (Difco) were used. Dictyostelium discoideum wild-type strain Ax3 wasgrown axenically in HL-5 medium at 23°C (72). The murine macrophage cell lineRAW264.7 and human HL-60 cells were cultured in a humidified atmosphere of5% CO2 at 37°C in RPMI 1640 medium (Omnilab) supplemented with 10%

(vol/vol) fetal calf serum and 2 mM L-glutamine (50 �g/ml). All reagents wereobtained from Sigma if not specified otherwise.

Cloning and construction of chromosomal lqs and hdeD deletion mutantstrains. The chromosomal lqs deletion mutant strain NT01 was generated asfollows: plasmid pNT-1 (Fig. 1A) harboring the lqsA, lqsR, hdeD, and lqsS genesas well as a 5� flanking region (FR1, containing lpg2730 [dsbB] and lpg2731[cycB]) and a 3� flanking region (FR2, containing truncated lpg2735 [hemC]) wasdigested with BsgI and BbvCI to release a 4,482-bp fragment containing lqsA,lqsR, hdeD, and most of the lqsS open reading frame (ORF) (Fig. 1C). pNT-1lacking the lqs region but still harboring the flanking regions FR1 and FR2 wasblunted using a 3�-to-5� exonuclease (BsgI site) and Klenow polymerase (BbvCIsite), dephosphorylated using shrimp alkaline phosphatase (Roche Diagnostics),and ligated with a kanamycin (Km) resistance cassette, which was released frompUC4K by digestion with BamHI, blunted (Klenow polymerase), and phosphor-ylated (T4 polynucleotide kinase). From the resulting plasmid, pNT-2, the FR1-Kmr-FR2 fragment (3,579 bp) was released by digestion with MluI, blunted, andcloned into the blunted pLAW344 suicide vector cut with BamHI, yieldingplasmid pNT-7. Clones were analyzed by restriction digestion, by PCR using theprimers oLqs-fo (GTATTAGGATCCAGAATAATTTGAGTACCCGCAG) andoLqs-re (CCGGCTCCATATGTCACAACTAAAAAAAATAG) (Fig. 1), and bysequencing to test for the correct sequences of the flanking regions FR1 and FR2.

To generate the �hdeD strain (NT04), the chromosomal hdeD gene wasdeleted as follows: pNT-1 was digested with SwaI and Mph1130I, releasing a70-bp fragment of the hdeD ORF. The resulting backbone, including a 5� up-stream (HH1) and a 3� downstream (HH2) region, were blunted using a 3�-to-5�exonuclease (Mph1103I site) and subsequently dephosphorylated using shrimpalkaline phosphatase. The Km resistance cassette was released from plasmid

TABLE 1. Bacterial strains and plasmids used in this study

Strain or plasmid Relevant property(ies)a Source orreference

StrainsE. coli TOP10 Invitrogen

L. pneumophilaGS3011

(�icmT)JR32 icmT3011::Kmr 64

JR32 Virulent L. pneumophila serogroup1, strain Philadelphia, salt-sensitive isolate of AM511

60

NT01 (�lqs) JR32 lqsA-lqsR-hdeD-lqsS::Kmr This studyNT03

(�lqsR)JR32 lqsR::Kmr 70

NT04(�hdeD)

JR32 hdeD::Kmr This study

PlasmidspGEM-T Easy Cloning of PCR products; Apr PromegapGS-GFP-04 gfp in pMMB207 31pLAW344 oriT (RK2) oriR (ColE1) sacB Cmr

Apr73

pMMB207C Legionella expression vector; �mobA 12pMMB207C-

RBS-lcsCLegionella expression vector for

LcsC (with RBS)72

pNT-1 pUCBM20, lqs genomic region 70pNT-2 pUCBM20, FR1-�lqs-FR2 This studypNT-5 pUCBM20, HH1-�hdeD-HH2 This studypNT-7 pLAW344, �lqs::Kmr This studypNT-10 pLAW344, �hdeD::Kmr This studypNT-25 pLAW344, lqs This studypTS-1 pMMB207C, lqs This studypTS-10 pMMB207C-RBS 70pTS-13 pMMB207C, Ptac, lacZ 37pTS-14 pMMB207C, lux box, lacZ 70pUCBM20 lacPOZ�, Apr RochepUC4K oriR (pBR322), Apr, MCS::Kmr Amersham

a Abbreviations: Apr, ampicillin resistance; Cmr, chloramphenicol resistance;Kmr, kanamycin resistance; RBS, ribosome binding site.

VOL. 190, 2008 SYNERGISM OF L. PNEUMOPHILA lqs GENES 7533


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

pUC4K with BamHI, blunted (Klenow polymerase), phosphorylated (T4 polynu-cleotide kinase), and inserted into the blunted hdeD fragment to create pNT-5.The HH1-Kmr-HH2 fragment was then isolated with MluI, blunted, and clonedinto the pLAW344 suicide vector cut with BamHI and blunted, resulting inpNT-10. Clones were analyzed by PCR, using oHdeD-fo (CCGCGTCCATATGGCTAATTCACAAG) and oHdeD-re (TATTGGATCCCTAGAGTTTGGCCGTTTTTAC) as primers.

Allelic exchange by double homologous recombination using counterselectionon sucrose was performed essentially as described previously (70, 73). L. pneu-mophila JR32 was transformed by electroporation (Bio-Rad Gene Pulser; 2.3kV, 100 �, 25 mF) with pNT-7 or pNT-10, and cointegration of the plasmid wasassayed by selection on CYE-Km (5 to 7 days, 30°C). Several clones thus ob-tained were pooled, grown overnight in AYE medium, and streaked on CYE-Kmcontaining 2% sucrose (3 days, 30°C). Single colonies were spotted on CYE-Cmr,CYE-Kmr-2% sucrose, and CYE-Kmr plates to screen for Cms Kmr Sucr colo-nies. Candidate deletion mutant clones were screened by PCR using the primersindicated above and by Southern blot analysis using a digitonin DNA labelingand detection kit (Roche). As an additional control, the letA and letS genes weresequenced with the lqs mutant strain and confirmed to have wild-type sequences.

To complement the �lqs mutant strain NT01, the lqs region was reintroducedinto the mutant in trans or in cis. For trans-complementation, the plasmid pNT-1was digested with XmaI and XbaI to release a 6,839-bp fragment harboring thenative lqs region as well as the 5� and 3� flanking regions used for the constructionof the lqs deletion strain. The fragment was cloned into pMMB207C (12),yielding plasmid pTS-1. Complementation in cis was performed by chromosomalreintegration of the native lqs region into the lqs deletion strain. The native lqsregion, including the 5� and 3� flanking sequences, was released from pNT-1 withBamHI and cloned into pLAW344. The resulting suicide plasmid, pNT-25, waselectroporated into the �lqs mutant strain, and cointegration of the plasmid was

selected by growth on CYE-chloramphenicol (Cm) plates (3 days, 30°C). Singlecolonies were spotted on CYE-Cm, CYE-2% sucrose, and CYE-Km plates toscreen for Cms Kms Sucr strains that replaced the Km resistance cassette with thenative lqs region. The resulting chromosomal complementation (CC) strainswere checked by PCR for the presence of the native lqs sequence and theabsence of the Kmr cassette (Fig. 1D).

�-Galactosidase assay. To measure the activity of the lqsR promoter in thewild-type L. pneumophila and lqs mutant strains, plasmid pTS-14 was used (70),harboring a transcriptional fusion of the 5� upstream/promoter region of lqsRwith the lacZ gene. Specific enzyme activity was measured in Miller units, quan-tifying the conversion of ortho-nitrophenyl-�-D-galactopyranoside (ONPG) intogalactose and o-nitrophenol (in units of optical density at 420 nm [OD420]).Bacterial cultures containing the plasmid pTS-14 were inoculated in AYE me-dium (OD600 � 0.02) and grown at 37°C. At the time points indicated, the cellswere harvested, suspended in 1 ml Z buffer, and lysed with 0.1% sodium dodecylsulfate (SDS)-chloroform, and �-mercaptoethanol was added. The suspensionwas vortexed and reheated (28°C, 2 min), and ONPG was added for severalminutes at 28°C until the suspension turned yellow. The reaction was stopped bythe addition of Na2CO3, the cells were shortly spun down, and the absorbance inthe supernatant was measured.

Analysis of the phagocytosis, intracellular replication, and cytotoxicity of L.pneumophila. The phagocytosis, intracellular replication, and cytotoxicity of L.pneumophila were analyzed by fluorescence-activated cell sorting as describedpreviously, using green fluorescent protein (GFP)-labeled bacteria and A. cas-tellanii or D. discoideum as host cells (70, 72). Briefly, exponentially growingamoebae were seeded onto a 24-well plate (2.5 105 A. castellanii bacteria/ml or5 105 D. discoideum bacteria/ml), allowed to adhere for 1 to 2 h, infected withL. pneumophila bacteria grown for 21 h in AYE medium, and incubated at 30°C(A. castellanii) or 25°C (D. discoideum). To assay phagocytosis, the amoebae were

FIG. 1. The L. pneumophila lqs cluster and model of the Lqs quorum sensing circuit. (A) The lqs (Legionella quorum sensing) cluster consistsof four ORFs, designated lqsA (lpg2731), lqsR (lpg2732), hdeD (lpg2733), and lqsS (lpg2734). The 5� flanking region contains two ORFs, lpg2730(dsbB) and lpg2731 (cycB), encoding electron transfer proteins. An operon including ORFs lpg2735 to lpg2738 (hemC, hemD, hemX, and hemY),involved in heme biosynthesis, is located in the 3� flanking region. (B) Model of the Lqs quorum sensing circuit. (C) The two AflIII restriction sitesin the lqs locus delineate the cloned genomic lqs fragment (6,790 bp), and the BsgI and BbvCI restriction sites were used to replace a 4,482-bp lqsfragment with a Km resistance cassette to construct the suicide vector for allelic exchange. Arrows indicate the oligonucleotide binding sites usedfor PCR screening of the genomic regions of the wild type (5,118 bp), the lqs deletion mutant (1,907 bp), and three �lqs chromosomalcomplementation strains (CC-1, CC-9, and CC-17) (D).

7534 TIADEN ET AL. J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

infected (multiplicity of infection [MOI] � 50) with L. pneumophila diluted inPYG (A. castellanii) or HL5 (D. discoideum) medium and at 1 h postinfectionwere washed three times with Ac (A. castellanii) or SorC (D. discoideum) buffer.To assay intracellular replication, the amoebae were infected (MOI � 10) withL. pneumophila diluted in Ac buffer (A. castellanii) or MB medium (D. discoi-deum). To assay cytotoxicity, L. pneumophila was grown for 30 h in AYE mediumat 30°C, diluted in PYG medium, and used to infect the amoebae (MOI � 100)at 30°C. Cytotoxicity was assessed at 24 h postinfection by adding propidiumiodide (PI; 1 �g/ml) to A. castellanii (1, 2, 70). The viability of L. pneumophila (asdetermined by CFU counts) and expression of GFP (typically 80 to 90%) wereroutinely controlled.

Intracellular replication of L. pneumophila in A. castellanii was also quantified bydetermining the number of CFU in the supernatant. Briefly, 5 104 exponentiallygrowing A. castellanii bacteria/well were seeded onto a 96-well plate, allowed toadhere for 1 to 2 h, and infected at an MOI of 1 with L. pneumophila grown for 21 hin AYE medium. The infected amoebae were incubated at 30°C, and at the timepoints indicated, the number of bacteria released into the supernatant was quantifiedby plating aliquots of appropriate dilutions on CYE plates.

The cytotoxicity of L. pneumophila was also assayed using a dye reductionassay (12). The reduction of Alamar Blueox (resazurin; Lucerna Chem) toAlamar Bluered (resorufin; ex � 530 nm, em � 590 nm) by A. castellanii orRAW264.7 macrophages is proportional to the number of respiring cells over 2orders of magnitude (data not shown). Exponentially growing A. castellanii orRAW264.7 macrophages were suspended in PYG or RPMI medium and seededonto a 96-well plate (1 105 cells/200 �l). L. pneumophila was grown for 21 h inAYE medium and diluted in PYG or RPMI medium, and 25 �l was used toinfect the host cells at an MOI of 100, 10, or 1. Prior to the infection, the hostcells were washed once, and the medium was exchanged for 200 �l Ac buffer (A.castellanii) or RPMI (RAW264.7). The infection was synchronized by centrifu-gation (10 min, 880 g), and the infected cells were incubated at 30°C (A.castellanii) or 37°C (RAW264.7). At 3 h postinfection, the infected cells werecarefully washed three times with Ac buffer (A. castellanii) or RPMI(RAW264.7) to remove extracellular bacteria. Two hundred microliters of PYGor RPMI medium containing 10% Alamar Blueox was added and incubated for16 h at 30°C (A. castellanii) or 37°C (RAW264.7). As a control, uninfected hostcells were treated equally. Fluorescence was measured with a Victor3 platereader (Perkin Elmer).

Confocal and transmission electron microscopy. GFP-expressing L. pneumo-phila strains were grown in AYE medium at 37°C for 8 h (exponential phase), 21 h(early stationary phase), or 30 h (late stationary phase), harvested, resuspended in 1ml 1 phosphate-buffered saline, and diluted to an OD600 of 0.15. Aliquots of thefluorescent bacteria were centrifuged on poly-L-lysine-coated coverslips, fixed with4% paraformaldehyde, and viewed with an inverted confocal microscope (Axiovert200 M; Zeiss) equipped with an Ultraview LCI confocal spinning disk head(PerkinElmer) and a 63 phase contrast objective (70, 72).

For transmission electron micrographs, the L. pneumophila strains were grownat 37°C for 30 h (stationary phase) in AYE medium. Subsequently, the bacteriawere washed with water and finally diluted 1:10 in water. Ten microliters of thesuspension was directly applied to plasma-treated 400-mesh copper grids. Aftersedimentation of the bacteria and removal of the remaining fluid, the sampleswere stained with 2% uranyl acetate and examined with a transmission electronmicroscope (CM 12; Philips) at 100 kV.

DNA microarray analysis. L. pneumophila wild-type JR32 and the lqs mutantstrain NT01 were grown in AYE medium at 37°C and harvested for RNA isolationat the exponential (OD600 � 1.5) or stationary (OD600 � 3.0) growth phase. RNAwas reverse transcribed and indirectly labeled with Cy5 or Cy3 dye (AmershamBiosciences). A DNA microarray containing gene-specific 70-mer oligonucleotidesbased on all predicted genes of the genomes of L. pneumophila strains Paris, Lens,and Philadelphia was used, and hybridizations were performed as described previ-ously (9, 70, 72). As controls, biological replicates as well as dye swap experimentswere carried out. For normalization and differential analysis, the R software pro-gram (http://www.r-project.org/) was used. Loess normalization (74) was performedon a slide-by-slide basis, and differential analysis was carried out separately for eachcomparison, using the VM method (VarMixt package) (17), together with theBenjamini and Yekutieli P value adjustment method (57).

Proteome analysis by 2-DE coupled with matrix-assisted laser desorptionionization–time-of-flight mass spectrometry (MALDI-TOF MS)-based sequenc-ing. To prepare samples, L. pneumophila wild-type strain JR32 and the lqsmutant strain NT01 were grown in AYE medium at 37°C to an OD600 of 1.5 or3.0 (exponential or stationary growth phase, respectively). The bacteria wereharvested by centrifugation (3,300 g, 4°C, 20 min), frozen in liquid nitrogen,and stored at �80°C. To isolate proteins, the bacteria were thawed on ice,washed twice in 50 mM Tris-HCl, pH 7.5, and resuspended in the same buffer

supplemented with one tablet of protease inhibitor (complete EDTA-free pro-tease inhibitor cocktail; Roche). The bacteria were lysed by sonication, the debriswere removed by centrifugation (21,000 g, 4°C, 60 min), and the lysate wasextracted with phenol as described previously (58). The precipitate was pulver-ized and solubilized in rehydration buffer (8 M urea, 2% {wt/vol} CHAPS{3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate}, 15 mM di-thiothreitol, and 0.2% immobilized pH gradient {IPG} buffer, pH 3 to 10; GEHealthcare). Protein concentrations were calculated according to the Bradfordmethod, using bovine serum albumin as a standard, and prior to two-dimensionalgel electrophoresis (2-DE), the protein samples were analyzed by SDS-poly-acrylamide gel electrophoresis (PAGE).

For isoelectric focusing, the samples were diluted with rehydration buffer to800 �g protein in 450 �l. Immobiline DryStrips (IPG strips, 24 cm, pH 3 to 10NL; GE Healthcare) were rehydrated and focused under mineral oil at 20°Cusing a gradient up to 64,000 V (30 V, 13 h; 200 V, 1.5 h; 500 V, 1.5 h, gradientto 1,000 V, 1.5 h; and gradient to 8,000 V, 6.5 h). Subsequently, the strips wereequilibrated for 15 min in buffer I (6 M urea, 30% glycerol, 2% [wt/vol] SDS, and1% [wt/vol] dithiothreitol in 50 mM Tris-HCl, pH 8.8), followed by a 15-minincubation in buffer II (6 M urea, 30% glycerol, 2% [wt/vol] SDS, and 4% [wt/vol]iodacetamide in 50 mM Tris-HCl, pH 8.8).

For SDS-PAGE, the strips were transferred to 25- by 20-cm gels. The gels wererun at room temperature for 1 h at 50 mA, followed by approximately 5 h at 80W. Subsequently, the gels were incubated for 45 min in fixing solution (45%ethanol, 10% acetic acid) before the proteins were stained with Coomassiebrilliant blue G-250 as described previously (51). After the proteins weredestained in water, the gels were scanned with a densitometric ImageScanner(GE Healthcare), and the raw images were analyzed with Proteomeweaver 2-Dgel analysis software, version 3.1 (Bio-Rad). Gels from two independent sampleswere run and analyzed, and only significant (�2-fold) changes in spot intensitywere considered.

To identify proteins by MALDI-TOF MS, spots of differentially expressedproteins were excised from the gels, subjected to in-gel trypsin digestion,destained at 37°C for 30 min in a 1:1 mixture of (NH4)HCO3 (5 mM, pH 7.8) andmethanol, and dried by vacuum centrifugation. The dried spots were rehydratedfor 10 min in 10 �l trypsin solution (10 ng/�l in 5 mM Tris-HCl, pH 8.4;sequencing grade; Promega), and after addition of another 20 �l 5 mM Tris-HCl,pH 8.4, the gel slices were incubated for 3 h at 37°C. Aliquots of 0.7 �l of thepeptide samples were mixed with 2.1 �l matrix solution (0.5% -cyano-4-hy-droxycinnamic acid in 70% acetonitrile, 30% trifluoroacetic acid [0.1% wt/vol]),and 0.7 �l was immediately spotted on a MALDI plate and air dried beforeanalysis. Samples were analyzed using a MALDI-tandem TOF system (model4700 Proteomics Analyzer; Applied Biosystems) with an Nd:YAG laser operat-ing at 200 Hz, as described previously (59). To identify proteins, the MS andtandem MS data were searched against the available L. pneumophila genomes(11, 13, 24) by using MASCOT version 1.9.05 (Matrix Science) as the searchengine (55) and GPS Explorer software (Applied Biosystems) for databasesubmission of data acquired by MS. The following settings were applied: maxi-mum numbers of missed cleavage, 1; peptide tolerance, 35 ppm; and tandem MStolerance, 0.2 kDa. Oxidation of methionine was set as a variable modification.Carboxyamidomethylation of cysteine was selected as a fixed modification. Con-fidence interval scores of �95% were accepted for protein identifications.

RESULTS

Strain distribution and genomic context of the L. pneumo-phila lqs cluster. The Legionella quorum sensing (lqs) clusterwas identified in a bioinformatic screen for homologues of theV. cholerae cqsAS quorum sensing system (70). The lqs clusterharbors four genes (lqsA-lqsR-hdeD-lqsS) and is present inall L. pneumophila strains sequenced to date: Philadelphia(lpg2731 to lpg2734), Paris (lpp2787 to lpp2790), Lens (lpl2656to lpl2659), and Corby (lpc0402-lpc0401-lpc0399-lpc0396). Thelqs cluster of L. pneumophila Philadelphia is flanked by severalgenes encoding components of the bacterial inner membranerespiratory chain (Fig. 1A). The 5� upstream region harborsthe genes dsbH (lpg2729), encoding a putative protein-disul-fide oxidoreductase, and cycB (lpg2730), encoding cytochromec5. The 3� downstream region harbors an operon that includesthe four ORFs lpg2735 to lpg2738, encoding the heme biosyn-



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

thesis proteins porphobilinogen deaminase (hemC), uropor-phyrinogen III synthetase (hemD), uroporphyrinogen IIImethylase (hemX), and protoporphyrinogen IX and copropor-phyrinogen III oxidase (hemY).

Effects of the L. pneumophila lqs genes on growth in brothand morphology. To analyze the function of the L. pneumo-

phila lqs cluster, the corresponding genomic region, includinglqsA, lqsR, hdeD, and lqsS, was deleted from the chromosomeby double homologous recombination, yielding strain NT01(Fig. 1). The growth rate of the lqs deletion mutant in AYEmedium at 30°C or 37°C was very similar to that of wild-type L.pneumophila (Fig. 2A). However, while at 37°C the lqs mutant

FIG. 2. Effects of the L. pneumophila lqs genes on growth in broth and morphology. (A) L. pneumophila wild-type strain JR32 (F, E) or lqsmutant strains (Œ, ‚) were inoculated at an OD600 of 0.1, and the growth of the strains in AYE medium was followed for 21 h at 37°C (gray line)or 28 h at 30°C (black line). Similar results were obtained in two or three independent experiments. (B) Cell morphology of L. pneumophilawild-type strain JR32, the lqs mutant, and an lqsR mutant strain grown for 8 h (exponential phase), 21 h (early stationary phase), and 30 h (latestationary phase) in AYE medium at 37°C. Representative transmission electron micrographs (upper row) or confocal microscopy pictures (lowerthree rows) of dividing cells (8 h); single coccoid, rod-shaped bacteria (21 h and 30 h; wild type and �lqsR); or filamentous bacteria (21 h and 30 h;�lqs) are shown.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

entered the replicative phase slightly later than wild-type L.pneumophila, at 30°C the mutant entered the replicative phaseearlier. The latter phenotype was previously observed for anlqsR mutant strain, suggesting that LqsR plays an inhibitoryrole in the transmission from the transmissive to the replicativegrowth phase of L. pneumophila (70).

Wild-type and lqsR mutant L. pneumophila strains grown tostationary growth phase in AYE medium at 37°C form coccoid,rod-shaped cells (Fig. 2B, upper). Interestingly, lqs mutantbacteria showed an elongated form under the same growthconditions. To analyze the morphology of lqs mutant L. pneu-mophila in different growth phases, we used GFP-labeledstrains and fluorescence microscopy (Fig. 2B, lower). Wild-type and lqsR mutant L. pneumophila strains appeared coccoidand rod shaped in the replicative (8 h; OD600 � 1.0), earlystationary (21 h; OD600 � 3.0), and late stationary (30 h;OD600 � 3.0) growth phases. In contrast, the lqs mutant strainshowed wild-type morphology in the replicative growth phase,yet most if not all mutant bacteria showed an elongated formin early as well as late stationary growth phase. This phenotypeprevailed after prolonged cultivation times (48 h), when wild-type and lqsR mutant L. pneumophila strains appeared evenmore coccoid than at earlier time points (data not shown).These observations suggest that the genes within the lqs regionregulate cell division and/or constituents determining the cellshape, e.g., components of the cell wall. Moreover, since themorphology of an lqsR mutant strain appeared unaltered, thelqs phenotype is more pleiotropic than the lqsR phenotype.

L. pneumophila �lqs is less cytotoxic for amoebae and mac-rophages. The effect of the lqs genes on host-pathogen inter-actions was assessed by testing for virulence-related pheno-types. L. pneumophila is cytotoxic for A. castellanii, as reflectedby a shift of the host cell population toward smaller and more-granular cells in flow cytometry assays (Fig. 3A). Upon infec-tion of A. castellanii with wild-type L. pneumophila for 24 h, thepopulation of small, granular cells increased to 64.8%, com-pared to 2.8% for uninfected amoebae (data not shown) or4.4.% for amoebae infected with icmT mutant bacteria lackinga functional Icm/Dot (intracellular multiplication/defective or-ganelle trafficking) T4SS. An infection with lqs mutant L. pneu-mophila resulted in only 30.5% dead cells. The cytotoxicitydefect of the lqs mutant strain was complemented upon chro-mosomal reintegration of a DNA fragment containing the na-tive lqs genes (59.1% dead amoebae; strain CC9), indicatingthat the observed virulence defect is indeed due to the loss ofthe lqs gene cluster.

The cytotoxic effect was also quantified by PI staining (Fig.3A). In this assay, 58.2% amoebae infected with wild-type L.pneumophila, but only 3.8% amoebae infected with icmT mu-tant bacteria and 31.2% amoebae infected with the lqs mutantstrain, stained positive for PI. The cytotoxicity of the lqs mutantwas restored using the CC9 chromosomal complementationstrain (57.7% PI-positive amoebae). Since even at high MOIsL. pneumophila wild-type strain JR32 does not cause immedi-ate cytotoxicity for A. castellanii, the observed cytotoxicity islikely caused by intracellular replication of the bacteria (seebelow).

Supplying the native lqs genes on plasmid pNT-1 in trans didnot complement the cytotoxicity defect of the lqs mutant. How-ever, since pNT-1 strongly reduced the cytotoxicity of wild-type

L. pneumophila (data not shown), complementation by thisplasmid was unlikely. Providing the four genes of the lqs clusteron a multicopy plasmid likely alters the copy number andpossibly the expression levels of individual genes and thusmight impair the balance between functionally different com-ponents of a complex regulatory system.

Alternatively, the viability of A. castellanii or murineRAW264.7 macrophages infected with L. pneumophila wasassessed by determining the ability of the host cells to reducethe dye Alamar Blue. Using this dye reduction assay, wild-typeL. pneumophila infected at an MOI of 100 or 10 was found toreduce the viability of A. castellanii by approximately 50%within 19 h postinfection. In contrast, the lqs and icmT mutantstrains apparently did not reduce the viability of the amoebaeat the MOIs tested (Fig. 3B).

Different from amoebae, macrophages are killed by L. pneu-mophila by a replication-independent but contact-dependentmechanism (33). Moreover, mammalian cells are usually moresusceptible to killing by pathogenic bacteria than amoebae dueto the induction of apoptotic pathways. Accordingly, the infec-tion of murine RAW264.7 macrophages with wild-type L.pneumophila caused an MOI-dependent reduction in viability,as measured by the Alamar Blue reduction assay (Fig. 3B). Aninfection with wild-type L. pneumophila reduced the viability ofmacrophages already at an MOI of 1 approximately 20%, com-pared to the level for an uninfected macrophage monolayer,and at MOIs of 10 and 100, the viabilities decreased approxi-mately 50% and 80%, respectively. Interestingly, while the lqsmutant strain was not cytotoxic for A. castellanii, under thesame conditions, the mutant was cytotoxic for macrophages, asdetermined by a viability reduction of 15% or 50% at an MOIof 10 or 100, respectively. Cytotoxicity was entirely dependenton a functional Icm/Dot T4SS, since an icmT mutant did notreduce the viability of macrophages. In summary, in the ab-sence of the lqs gene cluster L. pneumophila is impaired forcytotoxicity against A. castellanii and macrophages, and thephenotype is complemented upon reintegration of the nativelqs genes into the chromosome.

L. pneumophila �lqs is impaired for intracellular growth inA. castellanii and efficient phagocytosis. To analyze the intra-cellular replication of an lqs deletion mutant within A. castel-lanii, the amoebae were infected with GFP-expressing bacteriaat an MOI of 10, and the percentage of green fluorescentamoebae was determined by flow cytometry as establishedpreviously (70). At 2 days postinfection, 34% and 4% of amoe-bae infected with the wild-type and lqsR mutant L. pneumo-phila strains, respectively, showed fluorescence above the back-ground level (amoebae infected with icmT mutant bacteria),and within another day, these values increased to approxi-mately 80% (Fig. 4A). In contrast, only 4% of A. castellaniistrains infected with the lqs deletion mutant showed fluores-cence values above the background level at 3 days postinfec-tion, and this value increased to 35% over 5 days. These resultsindicate that a lack of the lqs gene cluster impairs intracellularreplication much more strongly than the lack of only lqsR,suggesting that the other genes of the cluster synergisticallycontribute to the production of virulence traits.

GFP-expressing L. pneumophila was also quantified by flowcytometry in the supernatant of infected A. castellanii (Fig.4B). Using this assay, the numbers of lqs mutant bacteria re-



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

leased from amoebae remained almost at the background level(icmT mutant), while at 2 to 3 days postinfection, wild-typebacteria were released in large numbers. Again, compared tothe profound growth defect of the lqs deletion mutant, the lqsRmutant strain showed a less pronounced phenotype.

In another approach, we quantified intracellular replicationwithin and release from A. castellanii of lqs mutants by deter-

mining the number of CFU in the supernatant (Fig. 4C). L.pneumophila does not replicate in the medium used for amoe-bae, and therefore, the number of CFU determined representsintracellularly grown bacteria. While the number of wild-typeL. pneumophila bacteria grown in amoebae increased 4 ordersof magnitude within 2 to 4 days, 100-fold-lower numbers ofCFU were determined for an lqs mutant strain within the same

FIG. 3. L. pneumophila lacking the lqs cluster is less cytotoxic for amoebae and macrophages. (A) Cytotoxicity of L. pneumophila against A.castellanii was assayed by flow cytometry at 24 h postinfection (MOI � 100) using the wild-type strain JR32, an lqs mutant strain, a chromosomallycomplemented lqs mutant (CC9), or an icmT mutant strain. Live versus dead A. castellanii bacteria were scored by a population shift towardsmaller, more granular cells (forward scatter [FSC] versus sideward scatter [SSC]; upper) and quantified by PI staining (PI versus counts; lower).The data shown are representative of at least two independent experiments. (B) The viability of A. castellanii (left) or murine RAW264.7 (right)macrophages infected with L. pneumophila wild-type strain JR32 or the lqs or icmT mutant strain was assayed by an Alamar Blue dye reductionassay at 19 h postinfection (MOIs of 100, 10, and 1). The data shown are representative of at least three independent experiments. Statisticallysignificant (P � 0.05; unpaired Student t test) differences are marked by asterisks (*, wild type versus mutants; **, �lqs versus �icmT).



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

period of time, indicating that the mutant bacteria replicatedmuch less efficiently in amoebae. This phenotype was observedfor several lqs mutant strains isolated independently (data notshown). Similar to what was observed with GFP-labeled L.pneumophila, the intracellular growth defect of an L. pneumo-phila lqsR mutant strain was less severe than the growth defectof the lqs mutant. Within 2 to 4 days, approximately 10 times

fewer lqsR mutant bacteria were released from A. castellaniithan from wild-type L. pneumophila, as reported previously(Fig. 4C) (70). We also quantified intracellular replication ofan L. pneumophila �hdeD mutant strain (NT04) and foundthat this strain replicated at the wild-type level. The �hdeDmutant appeared morphologically normal and grew at thewild-type rate in AYE broth (data not shown). Finally, as

FIG. 4. L. pneumophila �lqs is impaired for intracellular growth in A. castellanii and efficient phagocytosis. Intracellular replication ofGFP-labeled L. pneumophila strains within A. castellanii over the period of 5 days was assayed by flow cytometry by gating on the amoebae (A) oron the bacteria (B) (black bars, wild-type JR32; dark gray bars, �lqsR; light gray bars, �lqs; white bars, �icmT) released from infected amoebae(means and standard deviations for triplicates). (C) Intracellular replication of L. pneumophila strains was determined by counting CFU afterinfecting A. castellanii at an MOI of 1 with wild-type strain JR32 (black triangles), an hdeD mutant (gray triangles), an lqsR mutant (gray circles),an lqs mutant (white circles), or an icmT mutant (black squares). At the time points indicated, appropriate dilutions of supernatants of the infectedamoebae were plated. (D) Phagocytosis of GFP-labeled L. pneumophila strains (wild-type JR32, �hdeD, �lqsR, �lqs, or �icmT) by A. castellaniiinfected at an MOI of 50 for 1 h was assayed by flow cytometry. Similar results were obtained in two (A, B) and at least three (C, D) independentexperiments.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

expected, icmT mutant bacteria did not replicate at all butrather were eradicated by the amoebae.

Another virulence trait of L. pneumophila is efficient phago-cytosis, which is dependent on a functional Icm/Dot T4SS aswell as on LqsR (31, 70, 72). As expected, approximately 10times more wild-type L. pneumophila bacteria were taken upby A. castellanii than by an icmT mutant strain (Fig. 4D). Thelqs deletion mutant strain was as defective for efficient phago-cytosis by the amoebae as the icmT mutant, and the lqsRmutant strain again showed a less pronounced phenotype.Moreover, the lqs and lqsR mutant strains were also phagocy-tosed less efficiently by D. discoideum and by differentiatedhuman HL-60 macrophage-like cells (data not shown). Thus,deletion of the lqs genes apparently affects the expression ofgenes required for efficient phagocytosis of L. pneumophila. Incontrast, the lack of HdeD did not affect the efficient phago-cytosis of L. pneumophila.

In summary, compared to the deletion of lqsR only, thedeletion of all four genes of the lqs cluster results in more-

pleiotropic and more-severe phenotypes with regard to bacte-rial morphology and virulence traits. Since hdeD apparently isnot involved in pathogen-host interactions, lqsA and lqsS likelyaccount for the synergistic effects observed.

Effects of the lqs genes on pH and salt sensitivity of L.pneumophila in AYE medium. In E. coli, the hdeD gene isimplicated in acid tolerance (38, 39). Therefore, we comparedthe growth of wild-type L. pneumophila and the hdeD, lqsR,and lqs mutant strains on CYE agar plates of different pHvalues. L. pneumophila grew robustly on CYE plates only overa quite narrow pH range of 6.6 to 7.4. Wild-type L. pneumo-phila and the hdeD mutant grew similarly at pH 6.3 to 7.7 (Fig.5A) yet did not grow at pH 6.0 or 8.0 (data not shown). Thus,under the conditions tested, hdeD does not appear to play arole in acid tolerance of L. pneumophila. Interestingly, how-ever, the lqs mutant strain was much more acid sensitive thanthe lqsR mutant, which grew at dilutions 3 to 4 orders ofmagnitude higher at pH values differing by only 0.2 to 0.3 unitsfrom the optimal value of 6.9. In summary, compared to the

FIG. 5. Effects of the lqs genes on pH and salt sensitivity of L. pneumophila in AYE medium. L. pneumophila wild-type strain JR32 or the hdeD,lqsR, or lqs mutant strain grown for 21 h in AYE medium was spotted in triplicates at the dilutions indicated onto CYE agar plates titrated to thepH values indicated (A) or spotted onto CYE agar plates containing 100 mM NaCl or no additional salt (control) (B). One representative dilutionseries is shown for each strain, and similar results were obtained in three independent experiments.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

lqsR mutant strain the lqs mutant is characterized not only bymore-severe morphological and virulence phenotypes but alsoby a more pronounced physiological phenotype.

Wild-type L. pneumophila is sensitive toward 100 mM NaCl,a trait that positively correlates with virulence (60). To testwhether the lqs genes or hdeD plays role in salt sensitivity of L.pneumophila, the hdeD, lqsR, and lqs mutant strains as well asthe corresponding wild-type strain were spotted on CYE agarplates containing 100 mM NaCl. Under these conditions, theL. pneumophila wild-type strain JR32 and the hdeD mutantstrain were severely impaired for growth. In contrast, both thelqs and, as reported previously (70), the lqsR mutant were pro-tected from the salt and grew at a dilution 3 orders of magnitudehigher than that for wild-type L. pneumophila (Fig. 5B).

The lqs genes regulate lqsR promoter activity. The expres-sion of the lqsR response regulator gene is positively regulatedby the alternative sigma factor RpoS and the two-componentregulator LetA (70). To test whether the expression of lqsR isalso regulated by the genes of the lqs cluster or by lqsR alone,we investigated the production of �-galactosidase under thecontrol of the lqsR promoter in the L. pneumophila wild-typestrain JR32 or in an lqs or lqsR mutant background (Fig. 6). Inthe wild-type strain, the lqsR promoter was induced in thereplicative phase approximately sixfold. The expression of thelqsR promoter was reduced in the lqsR and even more pro-nounced in the lqs mutant strain. Interestingly, while in thewild-type strain and the lqsR mutant the expression of the lqsRpromoter decreased to background levels upon entry into thestationary growth phase, in the lqs mutant the expression oflqsR remained almost constant at approximately 50% of themaximum wild-type level. These results suggest that the dele-tion of the lqs gene cluster affects the expression of the lqsRpromoter more profoundly and also in an apparently morecomplex manner than deletion of only lqsR.

Gene expression controlled by the lqs cluster genes. To iden-tify differentially regulated genes possibly responsible for thephenotypes of the lqs mutant, we compared the gene expres-sion profiles in the lqs mutant with those in wild-type L. pneu-mophila by using DNA microarrays. In the replicative growthphase, the transcriptome patterns were almost identical in theabsence and presence of the lqs cluster (data not shown).However, in stationary growth phase (OD600 � 3.0), 386 geneswere differentially regulated at least twofold in the absence ofthe lqs gene cluster. Of these, 190 genes were induced (seeTable S1A in the supplemental material) and 196 genes wererepressed (see Table S1B in the supplemental material). Weclassified the differentially regulated genes according to theirannotation and/or putative function as recorded in the PasteurInstitute LegioList (http://genolist.pasteur.fr/LegioList/), theColumbia Genome Center Legionella genome project (http://genome3.cpmc.columbia.edu/�legion/), and the InterPro da-tabase (http://www.ebi.ac.uk/interpro/). Interestingly, in the lqsmutant many key components required for the replicativephase were induced (Fig. 7A), including genes encoding (i) theprotein production and secretion machinery (39% of the in-duced genes), (ii) metabolic functions (24%), (iii) membrane-bound bioenergetic complexes (7%), (iv) components of thebacterial envelope (7%), and (v) stress response proteins (8%).In contrast, among the genes repressed in the absence of thelqs cluster, as many as 22% encode factors required for thetransmissive (virulent) phase of L. pneumophila, including vir-ulence and motility factors (Fig. 7B). Among the downregu-lated virulence factors are Icm/Dot-secreted effector proteins,such as SidC, RalF, SidM/DrrA, LidA, or members of the SidEfamily of paralogues (53). Icm/Dot-independent (putative) vir-ulence factors, such as the enhanced entry proteins (Enh) (14),the 24-kDa macrophage-induced major protein (42), or eu-karyote-like proteins (8, 16), were also repressed. Eight per-cent of the genes repressed in the lqs mutant strain encodestructural and regulatory components of the flagellum, which isa major trait of the transmissive (stationary) phase. It is note-worthy that the gene encoding the major structural componentof the flagellum, flaA, was downregulated as much as 50-fold,and some flagellar genes organized in operons, e.g., lpg1218 tolpg1222, were also found to be repressed. Furthermore, 7% ofthe genes downregulated in the lqs mutant are predicted toencode regulatory or signal transduction proteins, suggestingthat the lqs cluster is part of a complex regulatory network.Finally, while 16% of the genes repressed in the lqs mutant instationary phase are involved in metabolic pathways, the vastmajority of the downregulated genes (46%) are unknownand/or hypothetical. Many of these unclassified ORFs are pre-dicted to encode small proteins (�100 amino acids) (see TableS1B in the supplemental material).

Proteome analysis of proteins produced by wild-type and lqsmutant L. pneumophila strains. As a comparison with the geneexpression data obtained by DNA microarray analysis, we alsoperformed a proteomic analysis of proteins produced in thestationary growth phase by wild-type L. pneumophila or the lqsmutant strain. Differently produced proteins were identified by2-DE coupled to mass spectroscopy-based sequencing. Sincethe mRNA expression patterns for the wild-type and lqs mu-tant L. pneumophila strains differed only in the stationary

FIG. 6. The lqs genes regulate lqsR promoter activity. lqsR pro-moter activity was quantified by �-galactosidase activity (bars) at theOD600s indicated (symbols) in wild-type L. pneumophila (black bars,F), an lqs mutant (white bars, Œ), or an lqsR mutant (gray bars, f)harboring plasmid pTS-14, which contains the lacZ gene under thecontrol of the lqsR promoter. Similar results were obtained in at leasttwo independent experiments.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

growth phase, we extracted proteins from stationary culturesand separated the proteins by 2-DE (Fig. 8A).

Software-based analysis of the resolved proteins resulted in1,040 spots detected in wild-type L. pneumophila versus 960spots in the lqs mutant. While 816 protein spots (wild type,78%; lqs mutant, 85%) were statistically identified as matches,

224 out of 1,040 spots (22%) were exclusive or predominatelyassigned to the wild-type strain, and 144 out of 960 spots (15%)were predominantly found in the lqs mutant (Fig. 8B). Toidentify protein spots specific for the wild type or the lqs mu-tant strain, about 30 spots each were picked and analyzed byMALDI-TOF MS. Thus, 28 different proteins specific for wild-

FIG. 7. Classification and graphic representation of the lqs mutant strain transcriptome. DNA microarray analysis of the stationary-phase L.pneumophila lqs mutant or the wild-type strain JR32 revealed 190 or 196 genes that were induced or repressed, respectively, at least twofold. Thegenes induced (A) or repressed (B) in the lqs mutant strain compared to the levels in wild-type L. pneumophila were classified into functionalgroups and further divided into subgroups (y axis) based on their annotation or prediction by use of the InterPro database. The percentages ofgenes regulated are indicated with a bar graph (x axis) and represented as a pie graph (inset). The analysis is based on Table S1 in the supplementalmaterial.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

type L. pneumophila and 25 different proteins specific for thelqs mutant were identified (see Table S2 in the supplementalmaterial). A total of 50% or 36% of the proteins predomi-nantly produced by wild-type L. pneumophila or the lqs mutantstrain, respectively, were found to be expressed with the samepattern in the transcriptome analysis (Table 2), indicating thatthere is a substantial overlap between the proteome and tran-scriptome data. Interestingly, both proteome and transcrip-tome analyses revealed that the productions of the Icm/Dot-secreted effectors SidC, SdcA, RalF, SidM/DrrA, and SdeD

were downregulated in the lqs mutant, while stress responseand outer membrane proteins were preferentially produced inthe absence of the lqs gene cluster.

DISCUSSION

In the current work, we demonstrate that disruption of allfour genes of the L. pneumophila lqs cluster (lqsA-lqsR-hdeD-lqsS) affects the morphology of L. pneumophila and perturbstransmissive traits, including virulence. The lqs mutant strain

FIG. 8. Comparative 2-DE analysis of soluble intracellular proteins extracted from wild-type L. pneumophila or an lqs mutant strain grown inAYE to stationary phase at 37°C. (A) Proteins were separated in the first dimension by isoelectric focusing on IPG strips with nonlinear pHgradients from 3 to 10, followed by SDS PAGE on 13% polyacrylamide gels in the second dimension. The gels were stained with Coomassiebrilliant blue G-250. (B) The resulting spot patterns were analyzed with the Proteomeweaver software program. About 30 spots with increasedintensities in either wild-type L. pneumophila (red circles) or the lqs mutant strain (blue circles) were picked, processed, and analyzed usingMALDI-TOF MS-based sequencing. The protein spots identified are listed in Table S2 in the supplemental material. Asterisks indicate proteinsregulated with the same pattern as in DNA microarray experiments. The gels shown are representatives of two independent experiments.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

replicated at the same rate as wild-type bacteria in a richmedium (Fig. 2A), ruling out that a general growth defectaccounts for the intracellular replication defect observed (Fig.4). When directly compared to phenotypes of an lqsR singlemutant, the mutant strain lacking the lqs cluster showed more-severe defects, including an aberrant morphology (Fig. 2B),impaired intracellular replication (Fig. 4), altered regulation oflqsR promoter activity (Fig. 6), and changes in the transcrip-tome (see Table S1 in the supplemental material) (70). Theseresults indicate that in addition to lqsR the other genes of thelqs cluster synergistically contribute to the pleiotropic pheno-types observed. An hdeD mutant strain did not show any mor-phological, physiological, or virulence-related phenotypes (Fig.4 and 5 and data not shown), and therefore, the hdeD genelikely does not contribute to these phenotypes.

The lqsA and lqsS gene products, an autoinducer synthaseand a putative sensor kinase, might contribute to the lqs phe-notypes by participating upstream of LqsR in a quorum sensing

circuit. However, to account for the synergistic effects of the lqsdeletion compared to what was found for the lqsR deletion,other regulatory pathways likely also play a role (Fig. 1B). Theputative sensor kinase LqsS possibly signals to other (un-known) response regulators, which target a set of genes differ-ent from the LqsR-regulated genes. Alternatively or addition-ally, the -hydroxyketone signaling molecule(s) produced bythe autoinducer synthase LqsA (68) might trigger other recep-tor kinases in addition to LqsS.

While the L. pneumophila lqs mutant strain was attenuatedin a number of virulence assays, the mutant showed reducedcytotoxicity against RAW264.7 macrophages but not A. castel-lanii when a dye reduction assay was used (Fig. 3B). Macro-phages but not amoebae are sensitive to Icm/Dot-dependentimmediate cytotoxicity (33), and therefore, it is not unexpectedthat, compared to free-living amoebae, the mammalian cellsare more susceptible to wild-type L. pneumophila and also toattenuated mutants. Since in the dye reduction assay the lqs

TABLE 2. Selection of differentially produced proteins in the proteomes of wild-type L. pneumophila and the �lqs mutanta

Spot no. Locus tag Gene Protein identification or functiond Classification

wt-1b lpg2510 sdcA SdcA, paralog of SidC, binds to host cell PtdIns(4)P Virulence, Icm/Dot substratewt-3 lpg2511 sidC SidC, binds to host cell PtdIns(4)P Virulence, Icm/Dot substratewt-5 lpg2464 sidM SidM/DrrA, Rab1 GEF Virulence, Icm/Dot substratewt-8 lpg2509 sdeD SdeD Virulence, Icm/Dot substratewt-9 lpg1950 ralF RalF, Arf1 GEF Virulence, Icm/Dot substratewt-16 lpg2813 vipE VipE, disturbs membrane trafficking in yeast Virulencewt-7 lpg2971 maeA Malate dehydrogenase (NAD-linked), TPR Carbohydrate metabolismwt-10 lpg1889 Lipase Lipid metabolismwt-15 lpg0672 ADC Metabolism, solventogenesiswt-28 lpg0499 Carboxypeptidase Proteolysis and peptidolysiswt-12 lpg0858 ccmC Heme exporter protein CcmC, cytochrome c assembly

proteinTransport, bioenergetics

wt-2 lpg1750 clpB ClpB protein, endopeptidase Clp ATP-binding chain B Stress resistance, chaperonewt-24 lpg2493 Small heat shock protein HspC2 Stress resistance, chaperonewt-27 lpg0935 UspA, universal stress protein A Stress resistance, chaperonewt-14 lpg0013 Pirin-like protein Regulationwt-18 lpg1960 Hypothetical protein, coiled-coil domain Unclassifiedwt-29 lpg1385 Hypothetical small protein Unclassified�lqs-3c lpg1860 clpX ATP-dependent Clp protease, ATP binding subunit ClpX Stress resistance, chaperone�lqs-30 lpg0688 hptB Hsp60, 60-kDa chaperonin (GroEL protein, heat shock

protein B)Stress resistance, chaperone

�lqs-32 lpg0687 htpA Hsp10, 10-kDa chaperonin (GroES, heat shock protein A) Stress resistance, chaperone�lqs-16 lpg1587 Thiol-disulfide isomerase, thioredoxin family Stress resistance, antioxidant�lqs-17 lpg2967 sodB Superoxide dismutase SodB Stress resistance, antioxidant�lqs-8 lpg0138 gap GAPDH Carbohydrate metabolism�lqs-12 lpg0905 3-Oxoacyl-(acyl carrier protein) reductase Lipid metabolism�lqs-11 lpg1724 minD MinD, septum site determinant, cell division inhibitor,

activator of MinCCell division, chemotaxis, motility

�lqs-5 lpg2042 Outer membrane protein, TPR (also �lqs-6) Cell envelope�lqs-14 lpg2961 Major outer membrane protein Cell envelope�lqs-21 lpg0507 ompH Outer membrane protein OmpH (also �lqs-22, -23, and -24) Cell envelope�lqs-9 lpg2854 Hypothetical protein, TPR, coiled-coil domain Regulation�lqs-27 lpg1698 ProQ-like, activator of ProP osmoprotectant transporter

(also �lqs-28)Regulation

�lqs-29 lpg2755 Putative transcription factor, DUF149 Regulation�lqs-34 lpg1743 fis Fis transcriptional activator (fis3) Regulation�lqs-2 lpg1836 Similar to eukaryotic protein, coiled-coil domain Unclassified�lqs-7 lpg2874 Hypothetical protein, coiled-coil domain Unclassified�lqs-10 lpg2577 Hypothetical protein Unclassified�lqs-31 lpg1520 Hypothetical protein Unclassified

a Bold font indicates a match between proteome and transcriptome data.b wt, preferentially produced in wild-type L. pneumophila over the �lqs mutant strain.c �lqs, preferentially produced in the �lqs mutant strain over wild-type L. pneumophila.d TPR, tetratricopeptide repeat; ADC, acetoacetate decarboxylase; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

mutant strain was as cytotoxic as wild-type bacteria, and sincethe lqs mutant strain still grew intracellularly in contrast to anicmT mutant strain (Fig. 4A to C), the Icm/Dot T4SS is at leastpartially functional in the mutant strain, suggesting that theproduction of the T4SS is not significantly affected by the lqsgenes. This finding is in agreement with transcriptome (seeTable S1 in the supplemental material) and proteome (seeTable S2 in the supplemental material) analyses, revealing thata number of Icm/Dot substrates but not structural componentsof the T4SS are downregulated in the lqs mutant strain. Theseresults also suggest that the defect in efficient phagocytosis ofthe lqs and lqsR mutant strains is due to downregulation ofspecific effector proteins rather than a nonfunctional T4SS,even though the lqs and to a smaller extent the lqsR mutantstrains are not more efficiently phagocytosed than an icmTmutant (Fig. 4D).

The virulence defects of the lqs mutant are reflected in thegene expression profile and proteome of the mutant strain.Both transcriptome and proteome analyses revealed down-regulations of the Icm/Dot-secreted effectors SidC, SdcA,RalF, SidM/DrrA, and SdeD in the lqs mutant (Table 2). SidCand its paralogue SdcA specifically bind the host cell lipidphosphatidylinositol-4 phosphate, which accumulates on theLCV, where it serves as a membrane anchor for L. pneumo-phila effector proteins (56, 72). RalF and SidM/DrrA are gua-nine nucleotide exchange factors for the small GTPases Arf1(49) and Rab1 (36, 48), respectively, which recruit their cog-nate GTPase to the LCV membrane.

Additional differentially regulated Icm/Dot substrates wereidentified either by transcriptome (see Table S1 in the supple-mental material) or by proteome (see Table S2 in the supple-mental material) analysis: LidA, SidD, SidG, SidH, a proteinsimilar to SidE, SdeA, and SdeC. LidA interacts with Rab1,promotes structural alterations of the Golgi apparatus, andthus contributes to the subversion of the early secretory path-way by L. pneumophila (15, 36). SidG, SidH, and SdeA belongto a subgroup of Icm/Dot substrates interacting with the IcmS/IcmW complex in the bacterial cytoplasm (6, 54). SidH and itsparalogues SdhA and SdhB were found to promote intracel-lular replication of L. pneumophila in macrophages by prevent-ing host cell apoptosis rather than being required for the for-mation of the LCV (34). Finally, SidE, SdeA, SdeC, and SdeDform a paralogous family of Icm/Dot substrates with an un-known function (35). Taken together, the Icm/Dot substratescoordinately downregulated in the attenuated lqs mutant strainmight identify a set of effector proteins critical for L. pneumo-phila virulence. In agreement with this notion, an lqsR mutantstrain was attenuated less severely than the lqs mutant, and asjudged by transcriptome analysis, no known Icm/Dot substrate(except SdbB) was found to be downregulated in the absenceof only lqsR (70). As a corollary, the expression of Icm/Dotsubstrates might critically depend on signaling via the autoin-ducer synthase LqsA (68) and the putative sensor kinase LqsS.

Other virulence factors downregulated in the absence of thelqs cluster include VipE, which was identified in a screen for L.pneumophila genes interfering with vesicle transport in Sac-charomyces cerevisiae (67), and paralogous members of theEnhC family of enhanced entry proteins. The EnhC proteinsfeature several Sel-1 domains, which are characteristic of asubfamily of eukaryotic tetratricopeptide repeat proteins and

are implicated in protein-protein interactions (25). An EnhCparalogue termed LpnE (lpg2222) was recently found to bedefective for efficient entry into but not intracellular replica-tion within THP-1 macrophages (52). However, it is unlikelythat downregulation of multiple enh genes accounts for thephagocytosis defect of the lqs mutant, since the expressionlevels of the enhA and enhB genes are upregulated in an lqsRmutant strain (70), which is impaired for efficient phagocytosisto an extent similar to that for the lqs mutant (Fig. 4D). Incontrast, the major macrophage infectivity potentiator Mip wasfound to be upregulated in the lqs (see Table S1A in thesupplemental material) and in the lqsR (70) mutant strains.

It is noteworthy that the 24-kDa macrophage-induced majorprotein and a number of eukaryote-like genes were downregu-lated in the lqs mutant strain (see Table S1B in the supple-mental material). The L. pneumophila genome encodes a highnumber of eukaryote-like proteins (11), the acquisition ofwhich by horizontal gene transfer was proposed to result fromthe coevolution of the bacteria with eukaryotic phagocytes(16). Several of these proteins possess conserved protein-pro-tein interaction motifs preferably found in eukaryotes, such asthe ankyrin or Sel-1 domains, and might subvert signal trans-duction or transcriptional control in host cells (8).

Of the 196 genes downregulated in the lqs mutant in thestationary growth phase, as many as 21% encode proteinsinvolved in the manifestation of transmissive traits (Fig. 7B). Inaddition to the effector proteins outlined above, gene productsrequired for bacterial motility belong to this group (8%). Theinduction of the flagellum apparatus is a major characteristic ofthe transmissive form of L. pneumophila. Several flagellargenes organized in operons, and flaA (encoding the majorflagellar component flagellin) and the alternative sigma factorfliA are repressed in the lqs mutant strain. Interestingly, whilethe expression of the flaA gene is downregulated 50-fold in thelqs mutant strain, this gene is downregulated only 4-fold in thelqsR mutant, and in contrast to the lqs mutant, no other flagel-lar genes were downregulated (some were even slightly up-regulated) in the lqsR mutant strain (70).

The elongated form observed for the lqs (but not lqsR)mutant bacteria might be a consequence of a downregulationof the bolA gene (see Table S1B in the supplemental material).In E. coli, bolA is induced during the transition from the rep-licative into the stationary growth phase, and the correspond-ing protein controls the switch between cell elongation andseptation during cell division (61). An elongated form was alsoobserved in wild-type L. pneumophila ectopically expressingthe major positive regulator of the replicative growth phase,CsrA (21, 47), or the response regulator LqsR (70) or in a letAor letE mutant strain (5, 28).

Another indication that in the lqs mutant the transition fromreplicative to transmissive phase is impaired is the fact thatmultiple GGDEF regulatory proteins are downregulated.These proteins produce the second messenger cyclic di-GMPand seem to be implicated in the switch to the transmissivephase (9). Interestingly, in E. coli the GGDEF protein CsrDpromotes the degradation of the CsrB and CsrC regulatoryRNAs, which negatively regulate the global replication activa-tor CsrA (69). In L. pneumophila, the RNA binding proteinHfq is involved in posttranslational control of CsrA (40) anddownregulated 15-fold in the absence of lqs (see Table S1B in



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

the supplemental material). Together with the result that thelqs genes and also lqsR alone positively regulated the expres-sion of the lqsR promoter, these findings underscore the factthat the lqs genes are components of a complex regulatorynetwork that critically contribute to the regulation of L. pneu-mophila metabolism and the transition from the replicative tothe transmissive phase.

ACKNOWLEDGMENTS

We thank the members of the Electron Microscopy facility of ETHZurich and the Functional Genomics Center Zurich, in particular,Peter Gehrig, for providing images and help with proteome analysis,respectively.

This work was supported by grants awarded to H.H. from the SwissNational Science Foundation (631-065952 and PP00A-112592), ETHZurich (TH 17/02-3), the Commission for Technology and Innovation(6629.2 BTS-LS), and UBS AG on behalf of a client. Grants from theAgence Francaise de Securite Sanitaire de l’Environment et du Travail(ARCL-2005-002) and NIH (AI044212) were awarded to C.B. TheH.H. group participates in the NEMO (nonmammalian experimentalmodels for the study of bacterial infections) network, supported by theSwiss 3R foundation. H.B. was a holder of a fellowship of the GermanAcademy of Natural Scientists Leopoldina (BMBF-LPD9901/8-101).

REFERENCES

1. Albers, U., K. Reus, H. A. Shuman, and H. Hilbi. 2005. The amoebae platetest implicates a paralogue of lpxB in the interaction of Legionella pneumo-phila with Acanthamoeba castellanii. Microbiology 151:167–182.

2. Albers, U., A. Tiaden, T. Spirig, D. Al Alam, S. M. Goyert, S. C. Gangloff, andH. Hilbi. 2007. Expression of Legionella pneumophila paralogous lipid A bio-synthesis genes under different growth conditions. Microbiology 153:3817–3829.

3. Altman, E., and G. Segal. 2008. The response regulator CpxR directly reg-ulates expression of several Legionella pneumophila icm/dot components aswell as new translocated substrates. J. Bacteriol. 190:1985–1996.

4. Bachman, M. A., and M. S. Swanson. 2004. Genetic evidence that Legionellapneumophila RpoS modulates expression of the transmission phenotype inboth the exponential phase and the stationary phase. Infect. Immun. 72:2468–2476.

5. Bachman, M. A., and M. S. Swanson. 2004. The LetE protein enhancesexpression of multiple LetA/LetS-dependent transmission traits by Legion-ella pneumophila. Infect. Immun. 72:3284–3293.

6. Bardill, J. P., J. L. Miller, and J. P. Vogel. 2005. IcmS-dependent translo-cation of SdeA into macrophages by the Legionella pneumophila type IVsecretion system. Mol. Microbiol. 56:90–103.

7. Bassler, B. L. 2002. Small talk. Cell-to-cell communication in bacteria. Cell109:421–424.

8. Bruggemann, H., C. Cazalet, and C. Buchrieser. 2006. Adaptation of Legion-ella pneumophila to the host environment: role of protein secretion, effectorsand eukaryotic-like proteins. Curr. Opin. Microbiol. 9:86–94.

9. Bruggemann, H., A. Hagman, M. Jules, O. Sismeiro, M. A. Dillies, C.Gouyette, F. Kunst, M. Steinert, K. Heuner, J. Y. Coppee, and C. Buchrieser.2006. Virulence strategies for infecting phagocytes deduced from the in vivotranscriptional program of Legionella pneumophila. Cell. Microbiol. 8:1228–1240.

10. Camilli, A., and B. L. Bassler. 2006. Bacterial small-molecule signalingpathways. Science 311:1113–1116.

11. Cazalet, C., C. Rusniok, H. Bruggemann, N. Zidane, A. Magnier, L. Ma, M.Tichit, S. Jarraud, C. Bouchier, F. Vandenesch, F. Kunst, J. Etienne, P.Glaser, and C. Buchrieser. 2004. Evidence in the Legionella pneumophilagenome for exploitation of host cell functions and high genome plasticity.Nat. Genet. 36:1165–1173.

12. Chen, J., K. S. de Felipe, M. Clarke, H. Lu, O. R. Anderson, G. Segal, andH. A. Shuman. 2004. Legionella effectors that promote nonlytic release fromprotozoa. Science 303:1358–1361.

13. Chien, M., I. Morozova, S. Shi, H. Sheng, J. Chen, S. M. Gomez, G. Asamani,K. Hill, J. Nuara, M. Feder, J. Rineer, J. J. Greenberg, V. Steshenko, S. H.Park, B. Zhao, E. Teplitskaya, J. R. Edwards, S. Pampou, A. Georghiou, I. C.Chou, W. Iannuccilli, M. E. Ulz, D. H. Kim, A. Geringer-Sameth, C. Gold-sberry, P. Morozov, S. G. Fischer, G. Segal, X. Qu, A. Rzhetsky, P. Zhang,E. Cayanis, P. J. De Jong, J. Ju, S. Kalachikov, H. A. Shuman, and J. J.Russo. 2004. The genomic sequence of the accidental pathogen Legionellapneumophila. Science 305:1966–1968.

14. Cirillo, S. L., J. Lum, and J. D. Cirillo. 2000. Identification of novel lociinvolved in entry by Legionella pneumophila. Microbiology 146:1345–1359.

15. Conover, G. M., I. Derre, J. P. Vogel, and R. R. Isberg. 2003. The Legionellapneumophila LidA protein: a translocated substrate of the Dot/Icm system

associated with maintenance of bacterial integrity. Mol. Microbiol. 48:305–321.

16. de Felipe, K. S., S. Pampou, O. S. Jovanovic, C. D. Pericone, S. F. Ye, S.Kalachikov, and H. A. Shuman. 2005. Evidence for acquisition of Legionellatype IV secretion substrates via interdomain horizontal gene transfer. J.Bacteriol. 187:7716–7726.

17. Delmar, P., S. Robin, and J. J. Daudin. 2005. VarMixt: efficient variancemodelling for the differential analysis of replicated gene expression data.Bioinformatics 21:502–508.

18. Feeley, J. C., R. J. Gibson, G. W. Gorman, N. C. Langford, J. K. Rasheed,D. C. Mackel, and W. B. Baine. 1979. Charcoal-yeast extract agar: primaryisolation medium for Legionella pneumophila. J. Clin. Microbiol. 10:437–441.

19. Fettes, P. S., V. Forsbach-Birk, D. Lynch, and R. Marre. 2001. Overexpress-sion of a Legionella pneumophila homologue of the E. coli regulator csrAaffects cell size, flagellation, and pigmentation. Int. J. Med. Microbiol. 291:353–360.

20. Fields, B. S., R. F. Benson, and R. E. Besser. 2002. Legionella and Legion-naires’ disease: 25 years of investigation. Clin. Microbiol. Rev. 15:506–526.

21. Forsbach-Birk, V., T. McNealy, C. Shi, D. Lynch, and R. Marre. 2004.Reduced expression of the global regulator protein CsrA in Legionella pneu-mophila affects virulence-associated regulators and growth in Acanthamoebacastellanii. Int. J. Med. Microbiol. 294:15–25.

22. Fuqua, C., and E. P. Greenberg. 2002. Listening in on bacteria: acyl-homo-serine lactone signalling. Nat. Rev. Mol. Cell Biol. 3:685–695.

23. Gal-Mor, O., and G. Segal. 2003. Identification of CpxR as a positive regu-lator of icm and dot virulence genes of Legionella pneumophila. J. Bacteriol.185:4908–4919.

24. Glockner, G., C. Albert-Weissenberger, E. Weinmann, S. Jacobi, E. Schun-der, M. Steinert, J. Hacker, and K. Heuner. 2008. Identification and char-acterization of a new conjugation/type IVA secretion system (trb/tra) ofLegionella pneumophila Corby localized on two mobile genomic islands. Int.J. Med. Microbiol. 298:411–428.

25. Goebl, M., and M. Yanagida. 1991. The TPR snap helix: a novel proteinrepeat motif from mitosis to transcription. Trends Biochem. Sci. 16:173–177.

26. Greub, G., and D. Raoult. 2004. Microorganisms resistant to free-livingamoebae. Clin. Microbiol. Rev. 17:413–433.

27. Hales, L. M., and H. A. Shuman. 1999. The Legionella pneumophila rpoSgene is required for growth within Acanthamoeba castellanii. J. Bacteriol.181:4879–4889.

28. Hammer, B. K., E. S. Tateda, and M. S. Swanson. 2002. A two-componentregulator induces the transmission phenotype of stationary-phase Legionellapneumophila. Mol. Microbiol. 44:107–118.

29. Henke, J. M., and B. L. Bassler. 2004. Three parallel quorum-sensing sys-tems regulate gene expression in Vibrio harveyi. J. Bacteriol. 186:6902–6914.

30. Hilbi, H. 2006. Modulation of phosphoinositide metabolism by pathogenicbacteria. Cell. Microbiol. 8:1697–1706.

31. Hilbi, H., G. Segal, and H. A. Shuman. 2001. Icm/Dot-dependent upregula-tion of phagocytosis by Legionella pneumophila. Mol. Microbiol. 42:603–617.

32. Hilbi, H., S. S. Weber, C. Ragaz, Y. Nyfeler, and S. Urwyler. 2007. Environ-mental predators as models for bacterial pathogenesis. Environ. Microbiol.9:563–575.

33. Kirby, J. E., J. P. Vogel, H. L. Andrews, and R. R. Isberg. 1998. Evidence forpore-forming ability by Legionella pneumophila. Mol. Microbiol. 27:323–336.

34. Laguna, R. K., E. A. Creasey, Z. Li, N. Valtz, and R. R. Isberg. 2006. ALegionella pneumophila-translocated substrate that is required for growthwithin macrophages and protection from host cell death. Proc. Natl. Acad.Sci. USA 103:18745–18750.

35. Luo, Z. Q., and R. R. Isberg. 2004. Multiple substrates of the Legionellapneumophila Dot/Icm system identified by interbacterial protein transfer.Proc. Natl. Acad. Sci. USA 101:841–846.

36. Machner, M. P., and R. R. Isberg. 2006. Targeting of host Rab GTPasefunction by the intravacuolar pathogen Legionella pneumophila. Dev. Cell11:47–56.

37. Mampel, J., T. Spirig, S. S. Weber, J. A. J. Haagensen, S. Molin, and H.Hilbi. 2006. Planktonic replication is essential for biofilm formation by Le-gionella pneumophila in a complex medium under static and dynamic flowconditions. Appl. Environ. Microbiol. 72:2885–2895.

38. Masuda, N., and G. M. Church. 2003. Regulatory network of acid resistancegenes in Escherichia coli. Mol. Microbiol. 48:699–712.

39. Mates, A. K., A. K. Sayed, and J. W. Foster. 2007. Products of the Escherichiacoli acid fitness island attenuate metabolite stress at extremely low pH andmediate a cell density-dependent acid resistance. J. Bacteriol. 189:2759–2768.

40. McNealy, T. L., V. Forsbach-Birk, C. Shi, and R. Marre. 2005. The Hfqhomolog in Legionella pneumophila demonstrates regulation by LetA andRpoS and interacts with the global regulator CsrA. J. Bacteriol. 187:1527–1532.

41. Miller, M. B., K. Skorupski, D. H. Lenz, R. K. Taylor, and B. L. Bassler.2002. Parallel quorum sensing systems converge to regulate virulence inVibrio cholerae. Cell 110:303–314.

42. Miyamoto, H., S. Yoshida, H. Taniguchi, M. H. Qin, H. Fujio, and Y.Mizuguchi. 1993. Protein profiles of Legionella pneumophila Philadelphia-1



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

grown in macrophages and characterization of a gene encoding a novel 24kDa Legionella protein. Microb. Pathog. 15:469–484.

43. Moffat, J. F., and L. S. Tompkins. 1992. A quantitative model of intracellulargrowth of Legionella pneumophila in Acanthamoeba castellanii. Infect. Im-mun. 60:296–301.

44. Molmeret, M., M. Horn, M. Wagner, M. Santic, and Y. Abu Kwaik. 2005.Amoebae as training grounds for intracellular bacterial pathogens. Appl.Environ. Microbiol. 71:20–28.

45. Molofsky, A. B., L. M. Shetron-Rama, and M. S. Swanson. 2005. Compo-nents of the Legionella pneumophila flagellar regulon contribute to multiplevirulence traits, including lysosome avoidance and macrophage death. Infect.Immun. 73:5720–5734.

46. Molofsky, A. B., and M. S. Swanson. 2004. Differentiate to thrive: lessonsfrom the Legionella pneumophila life cycle. Mol. Microbiol. 53:29–40.

47. Molofsky, A. B., and M. S. Swanson. 2003. Legionella pneumophila CsrA is apivotal repressor of transmission traits and activator of replication. Mol.Microbiol. 50:445–461.

48. Murata, T., A. Delprato, A. Ingmundson, D. K. Toomre, D. G. Lambright,and C. R. Roy. 2006. The Legionella pneumophila effector protein DrrA is aRab1 guanine nucleotide-exchange factor. Nat. Cell Biol. 8:971–977.

49. Nagai, H., J. C. Kagan, X. Zhu, R. A. Kahn, and C. R. Roy. 2002. A bacterialguanine nucleotide exchange factor activates ARF on Legionella phago-somes. Science 295:679–682.

50. Nash, T. W., D. M. Libby, and M. A. Horwitz. 1984. Interaction between theLegionnaires’ disease bacterium (Legionella pneumophila) and human alve-olar macrophages. Influence of antibody, lymphokines, and hydrocortisone.J. Clin. Investig. 74:771–782.

51. Neuhoff, V., N. Arold, D. Taube, and W. Ehrhardt. 1988. Improved stainingof proteins in polyacrylamide gels including isoelectric focusing gels withclear background at nanogram sensitivity using Coomassie Brilliant BlueG-250 and R-250. Electrophoresis 9:255–262.

52. Newton, H. J., F. M. Sansom, V. Bennett-Wood, and E. L. Hartland. 2006.Identification of Legionella pneumophila-specific genes by genomic subtrac-tive hybridization with Legionella micdadei and identification of lpnE, a generequired for efficient host cell entry. Infect. Immun. 74:1683–1691.

53. Ninio, S., and C. R. Roy. 2007. Effector proteins translocated by Legionellapneumophila: strength in numbers. Trends Microbiol. 15:372–380.

54. Ninio, S., D. M. Zuckman-Cholon, E. D. Cambronne, and C. R. Roy. 2005.The Legionella IcmS-IcmW protein complex is important for Dot/Icm-me-diated protein translocation. Mol. Microbiol. 55:912–926.

55. Perkins, D. N., D. J. Pappin, D. M. Creasy, and J. S. Cottrell. 1999. Prob-ability-based protein identification by searching sequence databases usingmass spectrometry data. Electrophoresis 20:3551–3567.

56. Ragaz, C., H. Pietsch, S. Urwyler, A. Tiaden, S. S. Weber, and H. Hilbi. 15August 2008, posting date. The Legionella pneumophila phosphatidylinosi-tol-4 phosphate-binding type IV substrate SidC recruits endoplasmic retic-ulum vesicles to a replication-permissive vacuole. Cell. Microbiol. [Epubahead of print.] doi:10.1111/j.1462–5822.2008.01219.x

57. Reiner, A., D. Yekutieli, and Y. Benjamini. 2003. Identifying differentiallyexpressed genes using false discovery rate controlling procedures. Bioinfor-matics 19:368–375.

58. Riedel, K., P. Carranza, P. Gehrig, F. Potthast, and L. Eberl. 2006. Towardsthe proteome of Burkholderia cenocepacia H111: setting up a 2-DE referencemap. Proteomics 6:207–216.

59. Riedel, K., and A. Lehner. 2007. Identification of proteins involved in os-motic stress response in Enterobacter sakazakii by proteomics. Proteomics7:1217–1231.

60. Sadosky, A. B., L. A. Wiater, and H. A. Shuman. 1993. Identification ofLegionella pneumophila genes required for growth within and killing ofhuman macrophages. Infect. Immun. 61:5361–5373.

61. Santos, J. M., P. Freire, M. Vicente, and C. M. Arraiano. 1999. The station-ary-phase morphogene bolA from Escherichia coli is induced by stress duringearly stages of growth. Mol. Microbiol. 32:789–798.

62. Segal, G., M. Feldman, and T. Zusman. 2005. The Icm/Dot type-IV secretionsystems of Legionella pneumophila and Coxiella burnetii. FEMS Microbiol.Rev. 29:65–81.

63. Segal, G., M. Purcell, and H. A. Shuman. 1998. Host cell killing and bacterialconjugation require overlapping sets of genes within a 22-kb region of theLegionella pneumophila genome. Proc. Natl. Acad. Sci. USA 95:1669–1674.

64. Segal, G., and H. A. Shuman. 1998. Intracellular multiplication and humanmacrophage killing by Legionella pneumophila are inhibited by conjugalcomponents of IncQ plasmid RSF1010. Mol. Microbiol. 30:197–208.

65. Segal, G., and H. A. Shuman. 1999. Legionella pneumophila utilizes the samegenes to multiply within Acanthamoeba castellanii and human macrophages.Infect. Immun. 67:2117–2124.

66. Shin, S., and C. R. Roy. 2008. Host cell processes that influence the intra-cellular survival of Legionella pneumophila. Cell. Microbiol. 10:1209–1220.

67. Shohdy, N., J. A. Efe, S. D. Emr, and H. A. Shuman. 2005. Pathogen effectorprotein screening in yeast identifies Legionella factors that interfere withmembrane trafficking. Proc. Natl. Acad. Sci. USA 102:4866–4871.

68. Spirig, T., A. Tiaden, P. Kiefer, C. Buchrieser, J. A. Vorholt, and H. Hilbi.2008. The Legionella autoinducer synthase LqsA produces an -hydroxy-ketone signaling molecule. J. Biol. Chem. 283:18113–18123.

69. Suzuki, K., P. Babitzke, S. R. Kushner, and T. Romeo. 2006. Identificationof a novel regulatory protein (CsrD) that targets the global regulatory RNAsCsrB and CsrC for degradation by RNase E. Genes Dev. 20:2605–2617.

70. Tiaden, A., T. Spirig, S. S. Weber, H. Bruggemann, R. Bosshard, C.Buchrieser, and H. Hilbi. 2007. The Legionella pneumophila response regu-lator LqsR promotes host cell interactions as an element of the virulenceregulatory network controlled by RpoS and LetA. Cell. Microbiol. 9:2903–2920.

71. Vogel, J. P., H. L. Andrews, S. K. Wong, and R. R. Isberg. 1998. Conjugativetransfer by the virulence system of Legionella pneumophila. Science 279:873–876.

72. Weber, S. S., C. Ragaz, K. Reus, Y. Nyfeler, and H. Hilbi. 2006. Legionellapneumophila exploits PI(4)P to anchor secreted effector proteins to thereplicative vacuole. PLoS Pathog. 2:e46.

73. Wiater, L. A., A. B. Sadosky, and H. A. Shuman. 1994. Mutagenesis ofLegionella pneumophila using Tn903dlllacZ: identification of a growth-phase-regulated pigmentation gene. Mol. Microbiol. 11:641–653.

74. Yang, Y. H., S. Dudoit, P. Luu, D. M. Lin, V. Peng, J. Ngai, and T. P. Speed.2002. Normalization for cDNA microarray data: a robust composite methodaddressing single and multiple slide systematic variation. Nucleic Acids Res.30:e15.

75. Zusman, T., G. Aloni, E. Halperin, H. Kotzer, E. Degtyar, M. Feldman, andG. Segal. 2007. The response regulator PmrA is a major regulator of theicm/dot type IV secretion system in Legionella pneumophila and Coxiellaburnetii. Mol. Microbiol. 63:1508–1523.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Synergistic Contribution of the Legionella pneumophila lqs Genes … · LqsA was recently...

Documents

Transcript of Synergistic Contribution of the Legionella pneumophila lqs Genes … · LqsA was recently...