Syndromic approaches to infection detection: TaqMan...

Syndromic approaches to infection detection: TaqMan® array cards Dr Martin D Curran, National Infection Service, Clinical Microbiology Laboratory, Addenbrooke’s Hospital, Cambridge BSAC Spring Conference 2018

Why adopt a syndromic approach to testing ? Ø  The same clinical symptoms can be the result of different infecting aetiologic agents

Ø  Infections in infants, the elderly and the immunocompromised host can present differently than in an otherwise healthy individual

Ø  Under-diagnosis of co-infections

Ø  Rapid pathogen identification (<24h)/ Rapid infection control practices

Ø  The appropriate patient management can be initiated

Ø  Unnecessary medical procedures

Ø  Assist the public health authorities in investigating outbreaks

Ø  Marry front-line diagnosis with a comprehensive surveillance system

Ø  Cost effective

Ø  Positive impact on growing problem of antibiotic resistance

Ø  Clinicians are able to reassure anxious parents

Ø  Learning curve for clinicians…….

Ø  Define the appropriate test selection - uniformity

2

Evolution of PCR

Monoplex Duplex Real-time PCR Internal Control (multiplex)

Agarose gel electrophoresis

Real-time PCR Diagnosis of Respiratory viruses •  Panel 1 Flu A, Flu B, H5 and Internal Control (MS2)

•  Panel 2 RSV, HPIV 1 & 3 and Adenovirus •  Panel 3 Enterovirus, Rhinovirus,

Metapneumovirus and HPIV 2 & 4

•  Panel 4 Coronaviruses GP1 (NL63, 229E), GP2

(OC43, HKU1) and SARS •  Panels 5/6 H1/N1 pandemic 2009 strain •  Panel 7 H1/H3 seasonal virus typing

7 panels Rotorgene (72) 8 specimens (primers/probes)

Target list expansion

Panels Specimen numbers

Diagnostic real-time PCR array card •  Proof of principle for a syndromic approach to pathogen ID

•  Applied Biosystems / Thermofisher ViiA 7 or Quant Studio 7

• 48 separate PCRs per sample

• 8 samples per plate

• primers/probes already in wells

• 1 µl reaction volume

1st respiratory viruses, plus difficult to ID atypical bacteria

•  Our assay primer/probe sequences sent off for evaluation (design and target specificity) by life technologies™ bioinformaticians in the USA

•  Monoplex assays first evaluated on the 384 plate using dilutions series of positive control specimens/plasmids

•  All probes contain a 5’ Fam label and a minor groove binder (MGB) with Quencher

•  Ordered the custom made plates containing our lyophilised primers/probes – 50 plates (400 tests)

Sealed plates with 2 year shelf life

Array card layout for respiratory assays 1, 25 RSV A & B Flu B Quad

2, 26 RSV #2 Flu B ABI

3, 27 HPIV 1 Flu A Quad

4, 28 HPIV 2 Flu A CDC DC

5, 29 HPIV 3 H1sw 2009

6, 30 HPIV 4 N1sw 2009 CFI

7, 31 Enterovirus H1 2009 ABI

8, 32 Rhinovirus Tamiflu Sensitive (H1 2009)

9, 33 SARS Tamiflu Resistant (H1 2009)

10, 34 GP2 OC43/HKU1 H1 seasonal CFI

11, 35 18s rRNA IC ABI

H1 ABI

12, 36 GP1 NL63 H3 seasonal CFI

13, 37 GP1 229E H3 ABI

14, 38 hMPV H5 CFI

15, 39 MS2 IC H5 FRET

16, 40 Adenovirus H5 ABI

17, 41 Bocavirus H7

18, 42 Adenovirus # 2 H7 ABI

19, 43 Legionella pneumophila

H9

20, 44 M. pneumoniae H9 #2

21, 45 C. pneumoniae RNAse P

22, 46 Coxiella burnetii HPIV 1 #2

23, 47 C. psittaci HPIV 3 #2

24, 48 C. abortus Rhinovirus #2

How – The Technical Process

TaqMan®ArrayCards

TaqMan® Assays pre-spotted

48 wells per channel

1 2 3 4 5 6 7 8

384 wells (1µl reaction volume)

1 to 8 samples

1 32

LoadtheTAC Centrifugation Sealing

• 20ulofnucleicacidextract• 25ulofTaqman®Fastvirus1-step• 55ulofRnasefreewater • 2x2min300g/1200rpm

Trimtheportstrip Amplification Dataanalysis

• 50/5min(RT)95°C/20sec• 95°C/1sec60°C/20secX45cycles• 53minruntime • Approx.10min

HPA H5 Influenza Proficiency Panel (2011) ; Centre for Infections, London

1 Mean Ct value from pre-testing using HPA NSM 25 primers/probes 2 Mean Ct value from pre-testing using HPA NSM 29, 48 and 50 primers/probes

ID Virus Type/

Subtype Flu A

Expected Ct value1

Flu B Expected Ct value1

H5 Expected Ct value1

Non-H5 Subtyping HA Expected Ct

Value2

Oseltamivir Susceptibility

Respiratory Array Card Results

A

A/Brisbane/59/2009

H1N1

34.61

-

-

H1 35.65

-

Flu A QUAD 36.45 18s 4.86 Flu A CDC 33.84 MS2 31.36 H1 CFI 32.54 H1 ABI 32.75 Rn P 23.56

B

A/Perth/16/2009

H3N2

35.27

-

-

H3 33.54

-

Flu A QUAD ---- 18s 5.43 Flu A CDC 35.30 MS2 30.89 H3 CFI 32.01 H3 ABI 33.30 Rn P 23.44

C

B/Brisbane/60/2008

B

-

33.39

-

-

-

18s 7.08 Flu B QUAD 35.51 MS2 29.69 Flu B ABI 33.89 Rn P 24.45

D*

A/England/107/2010

H1N1 (2009)

32.21

-

-

H1 27.18 N1 30.50

Sensitive

Flu A Quad 33.10 Tamiflu Sens 33.04 18s 5.89 Flu A CDC 29.91 MS2 32.29 H1v 30.9 H1v ABI 31.02 N1CFI 32.81 Rn P 23.91

E

A/England/90/2011

H1N1 (2009)

34.36

-

-

H1 28.97 N1 31.66

Resistant

Flu A QUAD 35.70 Tamiflu Resis 33.04 18s 5.71 Flu A CDC 32.25 MS2 32.08 H1v 32.04 H1v ABI 32.36 N1 CFI 32.81 Rn P 23.98

F*

B/England/176/2010

B

-

21.04

-

-

-

18s 7.60 Flu B QUAD 29.15 MS2 31.70 Flu B ABI 22.20 Rn P 26.50

G*

A/England/107/2010 & A/England/90/2011

H1N1 (2009)

30.87

-

-

H1 25.95 N1 28.45

Sensitive Resistant Mixture

Flu A QUAD 30.86 Tamiflu S/R 32.18 / 31.27 18s 5.16 Flu A CDC 27.99 MS2 31.60 H1v 28.96 H1v ABI 28.53 N1CFI 28.71 RN p 23.40

H

A/Aragon/3218/2008

H1N1

32.92

-

-

H1 36.08 N1 37.94

Sensitive

Flu A QUAD 33.79 18s 6.18 Flu A CDC 32.32 MS2 30.66 N1 31.81 H1 ABI 38.70 Rn P 23.44

I

Hep 2 cells (Negative)

-

-

-

-

-

-

All Negative bar the controls

J

A/Swine/Italy/1477/96

H3N2

31.95

-

-

H3 32.97

-

Flu A QUAD 30.73 18s 6.01 Flu A CDC 23.75 MS2 31.14 H3 CFI 27.36 H3 ABI 32.94 RN p 24.56

K

A/Pennslyvania/14/2010

H3N2

20.55

-

-

H3 35.56

-

Flu A QUAD 21.37 18s 6.29 Flu A CDC 20.75 MS2 30.24 H3 CFI 24.30 H3 ABI 19.35 Rn P 24.60

L

A/Egypt/3300NAMRUS/

2008 (RG13)

H5N1

24.20

-

33.49

-

-

Flu A QUAD 24.55 Tamiflu Sens 28.43 18s 7.04 Flu A CDC 23.70 N1CFI 38.22 MS2 30.84 H5 CFI 29.59 H5 FRET 24.14 H5 ABI 24.54 Rn P 24.49

M

A/ck/Vietnam/NCVD-

016/2008 (RG12)

H5N1

24.39

-

27.72

-

-

Flu A QUAD 25.25 Tamiflu Sens 34.04 18s 6.19 Flu A CDC 24.18 N1CFI 28.37 MS2 31.32 H5 CFI 25.37 H5 FRET 25.23 H5 ABI 23.27 Rn P 25.02

Intra Card Reproducibility (n=8)

hMPV RSV RNase P C.abortus

H7

Comparison of the TLDA card results to routine real-time multiplex PCR testing

(417 consecutive specimens Dec14/Jan15)

Pathogen True Positive True Negative Positive array False Positive False Negative Sensitivity % Specificity %

Flu A 15 402 14 0 1 93.75 100.0

RSV 92 325 103 11 0 100.0 96.73

HPIV 1-4 12 405 12 1 1 92.3 99.75

Adenovirus 9 408 16 8 1 90.0 98.08

Rhinovirus 84 333 85 6 5 94.38 98.23

HMPV 10 407 10 1 1 90.91 99.75

Coronavirus (Gp 1 & 2)

18 399 19 2 1 94.74 99.5

Overall

205

212

213

27

10

95.35

88.7

The discrepant results are low titre viral loads with late Ct values For adenovirus, the array detected an additional 8 positives, and 7/8 of these only came up with 1 of the 2 adenovirus assays with Ct values ranging from 33.31-36.17 RSV more sensitive/superior on the array

ZeptoMetrix NATtrol™ Flu Verification Panel (NATFVP-C)

Panel member Strain Multiplex RT-PCR†

Routine Results Ct

Xpert® Flu/RSV assay Results Ct

BioFire FilmArray Results

TLDA Array Card Results Ct

Influenza A H1 (1:100)* A/ New Caledonia /20/99 Flu A 29.1 Flu A 30.6/31.3 Flu A Pos

H1 pos Flu A 33.6/32.9

H1 seasonal 31/32.3

Influenza A H1 (1:100) A/ Brisbane /59/07 Flu A 29.6 Flu A 33.6/33.4 Flu A Pos equivocal Flu A 35.2/34.5 H1 seasonal 36.2/34.1

Influenza A H3 (1:100) A/ Brisbane /10/07 Flu A 28.8 H3 28.6 Flu A 27.0/28.9 Flu A pos

H3 Pos Flu A 33.3/33.5

H3 seasonal 31.7/31.1

Influenza A H3 (1:100) A/ Wisconsin /67/05 Flu A 29.3 H3 28.8 Flu A 30.5/32.8 Flu A Pos equivocal Flu A 34/33

H3 seasonal 31.9/31.3

Influenza A 2009 H1N1 (1:100) Canada /6294/09 Flu A 26.7 H1 2009 25.6 Flu A 32.3/32.7 Flu A Pos

H1 2009 Pos Flu A 32.3/30.3

H12009 30.9/28.7 Tamiflu Sens 32.5

Influenza A 2009 H1N1 (1:100) NY /02/09 Flu A 29.5 H1 2009 27.8 Flu A 31.4/32.6 Flu A Pos equivocal

Flu A 35/32.6 H12009 33.8/29.9

Tamiflu Sens 35.2

Influenza B (1:100) B/ Florida /02/06 Flu B 27.1 Flu B 29.4 FluBPos Flu B 31.4/31.1

Influenza B (1:100) B/ Malaysia /2506/04 Flu B 25.4 Flu B 28.8 FluBPos Flu B 30.6/30

Respiratory Syncytial Virus A NA RSV 14.8 RSV 25.2 RSV A Pos RSV A 19.5 RSV 19.7

Respiratory Syncytial Virus B CH93 (18)-18 RSV 13.9 RSV 22.4 RSV B Pos RSV B 18.1 RSV 19.2

Rhinovirus 1A NA Rhino 21.9 Flu A, Flu B & RSV negative Rhinovirus Pos Rhino 28/39.6

Parainfluenza virus type 1 NA HPIV1 22.9 Flu A, Flu B & RSV negative HPIV 1 Pos HPIV 1 27.9/26.7

Echovirus type 30 NA Enterovirus 20.4 Flu A, Flu B & RSV negative Enterovirus Pos Enterovirus 24.8

Coxsackievirus type A9 NA Enterovirus 18.6 Flu A, Flu B & RSV negative Enterovirus Pos Enterovirus 24.9

M.pneumoniae M129 Negative (NT) Flu A, Flu B & RSV negative M.pneumoniae Pos M.pneumoniae 29.3

N.meningitidis serotype A NA Negative (NT) Flu A, Flu B & RSV negative Negative (NT) N. meningitidis 25.0

*Influenza samples diluted 1:100 and then processed in all assays † In house routine multiplex real-time respiratory PCR assays (Clark TW, Medina MJ, Batham S, Curran MD, Parmar S, Nicholson KG. 2014. C-reactive protein level and microbial aetiology in patients hospitalised with acute exacerbation of COPD. Eur Respir J;45(1):76-86.

ID Type Date TestRequestedbyClinician

TestResult

RetrospectiveArrayCardResult

2XXDX46 Sputum 09/10/16 RespArray C.psittaciCt33.02

C.psittaciCt33.78

2XXDX00 Sputum 07/10/16 PCPPCR PCRNegative C.psittaciCt34.56

2XXDX81 BAL 05/10/16 PCPPCR PCRNegative C.psittaciCt28.38

2XXDX63 Swab O4/10/16 RESPPCR PCRNegative PCRNegative

Analytical Sensitivity (limit of detection)

•  Limit of detection (LOD) is ~ one log behind our routine multiplex/monoplex real-time PCR for each assay

•  Similar LOD findings observed by CDC study TLDA plate

{Kodani M, Yang G, Conklin LM et al. J Clin Microbiol. 2011 49 :2175-82}

•  Relates to the reduced input of nucleic acid into each PCR reaction pod in the array i.e. 0.2ul compared to 5ul in our routine real-time assays (25 fold reduction)

•  Improvements can be made to minimise this reduction to 5 fold by increasing the specimen extraction volume (1ml) and nucleic acid input to 0.5ul per PCR reaction pod

•  Clinical relevance of pushing the detection limit further is doubtful as the TAC’s performance on the clinical specimens was exceptional.

CDC Study

Application of Taqman low-density arrays for simultaneous detection of multiple respiratory pathogens

  Kodani M, Yang G, Conklin LM et al. J Clin Microbiol. 2011; 49 : 2175-82.

Field evaluation of TaqMan Array Card (TAC) for the simultaneous detection of multiple respiratory viruses in children with acute respiratory infection

  Weinberg GA et al. J Clinical Virology 2013 57:254-260 •  21 pathogen assays, spotted in duplicate

•  292 clinical specimens examined

•  Excellent Intra and Inter array plate reproducibility •  Overall Sensitivity 89% and Specificity 98%

•  Limit of detection – 10 fold less sensitive than individual real-time PCR assay, although 4/21 gave an identical LOD for both formats

Five Multi Control Array Plasmids : Target Sequences GenScript (www.genscript.com)

Multicontrol array No2 Order HPIV#1 168bp TamS 129bp HKU1 251bp CMV Cambridge 400bp FluA matrix H3 269bp CMV Bruges 163bp RSV A 165bp Aspergillus fumigatus 214bp Measles NP 269bp Rhino A7 145bp RSV total 115bp CMV jaundice 102bp HPIV#2 129bp measlesHN 98bp Adeno type 2 200bp Total 2817bp

One Plasmid to Synthesise : Please insert into the EcoRV site of PUC57 1)RESP array multiplex control No2 2817bp tcaaagggagcccgagccccttttatatgtatactcagagacccagtccatggagaatttgcccctggaaattatccagc actatggagttatgcaatgggtgttgctgtggtacaaaacaaagctatgcaacaatatgtaactggaagaacatatttgg acatggaaagaatagaaaagggaaagatagtcaaatcagtcgaaatgaatgcccctaattatcactatgaggaatgctcc tgttatcctgattctagtgaaatcacatgtgtgtgcagggataactggcatggctcggacaaccctgttcttatgggttg ggattatcctaaatgtgatcgtgctatgccaaatattttgcgtattgttagtagtttagttttggcccgcaaacatgaat tttgttgttcacatggtgatagattttatcgccttgcgaatgaatgtgctcaagttttgagtgaaatagttatgtgtggc ggttgctattatgttaagcctggtggtactagcagtggtgatgcaactactgcttttgctaattctgtgcgccgtgcgct ctagcatgtcgcgaccgatgcgcgtgatgctggcggcgatgggcagacacggcatcataccgttgaccacgccggtaaaa ccgtagaaagcgttgcacgttactttgagcgccatctgttccttgtcgagcagcatacggcgcacagggtcttgacactc gcgcatgcattcgcgcacggcacgccgctgcgaaacccacttgttgagcagttccgagagcaccgagacgcgcaccgaag cacgcacaaagcggtgggtcacgccgttctctagcgtgacgctgtatacgtcggcggggtccacagggtactcgccaccc ggcaccagcagggtggagtagcagaggttgtgggccatgatgatggaagggtagaggctggcaaagtcattgaaagatga gccttctaaccgaggtcgaaacgtatgttctctctatcgttccatcaggccccctcaaagccgagatcgcgcagagactt gaagatgtctttgctgggaaaaacacagatcttgaggctctcatggaatggctaaagacaagaccaattctgtcacctct gactaaggggattttggggtttgtgttcacgctcaccgtgcccagtgagcgaggactgcagcgtagacgctttgtccaaa atgccctcaatgggaatcacctgcccgcaggtgccgatcgtaaagagatgaagacccgagtgcccaaagatcacaccctc cgaagtgcagccccgaccatcgttcccgtttgggatcccctgatccacggcggtgtttccccccgtctcgtagcacacgc acgagatctgaatgacaatgtatgcccaaaaattgggtggtgaagcaggattctaccatatattgaacaacccaaaagca tcattattatctttgactcaatttcctcacttctccagtgtagtattaggcaatgctgctggcctaggcataatgggaga gtacagaggtacaccgaggaatcaaaaagagagttaaacagcacgtgaaattgttgaaagggaagcgtttgcgaccagac tcgcccgcggggttcagccggcattcgtgccggtgtacttccccgtgggcgggccagcgtcggtttgggcggccggtcaa aggccctcggaatgtatcacctctcggggtgtcttatagccgagggtgcaatgcggcctgcctggaccgaggaacgcgca tcatttctacacggtgatcaaagtgagaatgagctaccgagattggggggcaaggaagataggagggtcaaacagagtcg aggagaagccagggagagctacagagaaaccgggcccagcagagcaagtgatgcgagagctgcccatcttccaaccggca cacccctagacattgacactgcatcggagtccagccaagatccgcaggacagtcgaaggtcagctgacgccctgcttagg ctgcaagccatggcaggaatctcggaagttggtgtgagtcctccggcccctgaatgtggctaaccttaaccctgcagcca ttgctcataatccaatgagttagtggtcgtaatgcgcaagtgcgggatgggaccaactactttgggtgtccgtgtttctt atttttctttcataaaaaggaaagggtggggcaaatatggaaacatacgtgaacaagcttcacgaaggctccacatacac agctgctgttcaatacaatgtcttagaaaaagacgatgaccctgcatctcatcaggggagcactgaggcaagttctgcag tgccgccatggcctgactgcagccattggtggtcttagggaaggctgagttcttggtaaagaactctatacaatagatta gaagcattcagacaggatggaaccgttaaaagtgccctggtcttcacgggagacacagttgaaggcattggtgcagtgat gaggtcacaacaaagcttagtatctcttatggtggaaacaccttatgttttgctggctgttctgtttgtcatgtctctga gcttgatcgggttgctagccattgcaggcattagacttcatcgggcagccatctacagatggctaccccttcgatgatgc cgcagtggtcttacatgcacatctcgggccaggacgcctcggagtacctgagccccgggctggtgcagtttgcccgcgcc accgagacgtacttcagcctgaataacaagtttagaaaccccacggtggcacctacgcacgacgtaaccacagaccggtc ccagcgtttgacgctgc

18 Presentation title - edit in Header and Footer

3 Different Influenza B assays Multi-target plasmid construct control -6 3,624 copies/rnx -7 362 copies/rnx -8 36 copies/rnx -9 3 copies/rnx

-6 -7 -8 -9

19

HSV IDENTIFIED IN 5/6 OF THE 72 PATIENTS - RE-ACTIVATION, AND POSSIBLY 2 LEADING TO ECMO TREATMENT INCLUDE HSV ON NEXT PLATE?

Array card layout for ECMO patients 1, 25 RSV A ****** Flu B Quad

2, 26 RSV B ****** Flu B ABI

3, 27 HPIV 1 Staph PVL

4, 28 HPIV 2 Flu A CDC DC

5, 29 HPIV 3 Flu A Quad AM2******

6, 30 HPIV 4 Streptococcus pneumoniae

7, 31 Enterovirus Streptococcus pyogenes

8, 32 Rhinovirus Staphylococcus aureus (Nuc gene)

9, 33 B.pertussis ptxS1**** Aspergillus (28S RNA gene)

10, 34 GP2 OC43/HKU1 Staphylococcus Species (Tuf gene)

11, 35 18s rRNA IC ABI

Mec A gene

12, 36 GP1 NL63 N. meningitidis

13, 37 GP1 229E H. influenzae (all types)

14, 38 hMPV Mycobacterium species (generic)

15, 39 MS2 IC M. pneumoniae #2 ***

16, 40 Adenovirus B.pertussis IS481****

17, 41 Bocavirus Parechovirus ******

18, 42 Adenovirus # 2 Pneumocystis ****** jiroveci

19, 43 Legionella pneumophila

M. abscesscus

20, 44 M. pneumoniae GP2 OC43

21, 45 C. pneumoniae RNAse P

22, 46 Coxiella burnetii HPIV 1 #2

23, 47 C. psittaci HPIV 3 #2

24, 48 TB 16S Rhinovirus #2

Array card tailored to our Papworth Hospital ECMO patients •  Between 15th November 2013 – 7th October 2015, 72 patients (211 specimens) receiving extracorporeal membrane oxygenation for severe respiratory failure due to a suspected infectious agent have been examined on the ECMO array card in parallel with routine investigations. •  Array card confirmed all routine investigative findings •  39/72 (54.2%) were found to have a respiratory pathogen •  Array identified M. pneumoniae infection in two cases, changing clinical management 9 (12.5%) Rhinovirus ( 5 dual infections - 1. P. jirovecii 2. Streptococcus pneumoniae X2,

3. H. influenzae X2) 9 (12.5%) Strep pneumoniae (4 dual infections 1. Rhino X2 2. Flu A H12009 3. Staph aureus) 8 (11.1%) Influenza A (6 x H12009 and 2 x H3) 8 (11.1%) Haemophilus influenza ( 5 dual infections 1. Flu A H12009 2. Rhino X2 3. HPIV type 3 4. P. jirovecii) 3 (4.2%) Strep pyogenes (two dual infections 1. Flu A H12009 2. Flu A H3 and one multiple infection with HPIV 2, HPIV 3 and Rhino) 2 (2.7%) Mycoplasma pneumoniae 1 RSV (subtype A) 1 Mycobacterium tuberculosis 1 P. jirovecii 1 Aspergillus fumigatus 1 Legionella pneumophilia

1. RSV A 2. RSV B 3. HPIV 1 4. HPIV 2 5. HPIV 3 6. HPIV 4 7. Enterovirus 8. Rhinovirus 9. B. pertussis ptx S1 10. HCoV OC43/HKU1 11. 18S RNA 12. HCoV NL63 13. HCoV 229E 14. hMPV 15. MS2 IC 16. Adenovirus #1 17. Bocavirus 18. Adenovirus #2 19. L. pneumophilia 20. M. pneumoniae 21. C. pneumoniae 22. Coxiella burnetii 23. C. psittaci 24. M. tuberculosis

25. Flu B #1 26. Flu B #2 27. Staph PVL 28. Flu A #2 29. Flu A #3 30. S. pneumoniae#1 31. S. pyogenes#1 32. S. aureus (Nuc ) 33. Aspergillus 28S 34. Flu A H12009 35. Flu A H3 36. Legionella species#1 37. H. influenzae #1 38. Enterovirus Br 39. M. pneumoniae #2 40. B. pertussis IS481 41. Parechovirus 42. P.jiroveci #1 43. RSV #3 44. HCoV OC43 45. Rnase P IC 46. HPIV 1 #2 47. HPIV 3 #3 48. Rhinovirus #2

Respiratory Card: Version 9 – ECMO

49. HSV#1 50. HSV#2 51. HSV#3 52. HSV type 1 53. HSV type 2 54. EBV#1 55. EBV#2 56. VZV#1 57. VZV#2 58. CMV#1 59. CMV#2 60. BK#1 61. BK#2 62. BK/JC 63. Aspergillus 28S 64. Measles#1H 65. Measles#2 N 66. Measles#3 N rev 67. Tamiflu S 68. Tamiflu R 69. IS481#2 70. L. pneumophilia #2 71. S. pneumoniae #2 72. H. influenzae #2

73. S. pyogenes# 2 74. N. meningitidis 75. Mec A 76. S. aureus (Nuc) 77. TB#2 78. TB#3 79. P.jiroveci #2 80. P.jiroveci #3 81. MS2 82. EVD68 83. HHV 6 84. HHV 7 85. HHV 6#2 86. HHV 8 87. A. fumigatus new 88. B19 89. MERS #1 90. MERS #2 91. MERS #3 92. Leptospirosis #1 93. Leptospirosis #2 94. Legionella species #2 95. Legionella species #3 96. Legionella species #4

4specimensperplate:loadedtwice

1.  Influenza B initially, followed by MRSA PVL pneumonia with possible reactivation of HSV too!

ECMO 96 card : BAL specimen from ECMO patient

18S control RNase P

Staph aureus (Nuc) Mec A PVL gene

HSV Flu B

Staph Ct 20.5 Mec A Ct 20.9 PVL Ct 19.7 HSV Ct 32.6 HSV type1 Ct 32.9 Flu B #1 Ct 35.0 Flu B #2 Ct 35.2

!1. RSV A 2. RSV B 3. HPIV 1 4. HPIV 2 5. HPIV 3 6. HPIV 4 7. Enterovirus 8. Rhinovirus 9. B. pertussis ptx S1 10. HCoV OC43/HKU1 11. 18S RNA 12. HCoV NL63 13. HCoV 229E 14. hMPV 15. MS2 IC 16. Adenovirus #1 17. Bocavirus 18. Adenovirus #2 19. L. pneumophilia 20. M. pneumoniae 21. C. pneumoniae 22. Coxiella burnetii 23. C. psittaci 24. M. tuberculosis

!25. Flu B #1 26. Flu B #2 27. Flu A #1 28. Flu A #2 29. Flu A #3 30. Flu A H1 2009 #1 31. Flu A H1 2009 #2 32. Tamiflu Sensitive 33. Tamiflu Resistant 34. Flu A H5 35. Flu A H3 #1 36. Flu A H3 #2 37. Flu A H7 38. CMV 39. M. pneumoniae #2 40. B. pertussis IS481 41. Parechovirus 42. P.jiroveci 43. RSV #3 44. HCoV OC43 45. Rnase P IC 46. HPIV 1 #2 47. HPIV 3 #3 48. Rhinovirus #2

!1. RSV A 2. RSV B 3. HPIV 1 4. HPIV 2 5. HPIV 3 6. HPIV 4 7. Enterovirus 8. Rhinovirus 9. B. pertussis ptx S1 10. HCoV OC43/HKU1 11. 18S RNA 12. HCoV NL63 13. HCoV 229E 14. hMPV 15. MS2 IC 16. Adenovirus #1 17. Bocavirus 18. Adenovirus #2 19. L. pneumophilia 20. M. pneumoniae 21. C. pneumoniae 22. Coxiella burnetii 23. C. psittaci 24. M. tuberculosis

!25. Flu B #1 26. Flu B #2 27. Staph PVL 28. Flu A #2 29. Flu A #3 30. S. pneumoniae 31. S. pyogenes 32. S. aureus (Nuc ) 33. Aspergillus 28S 34. Staph spp (Tuf) 35. MecA gene 36. N. meningiditis 37. H. influenzae 38. Mycobacteria spp 39. M. pneumoniae #2 40. B. pertussis IS481 41. Parechovirus 42. P.jiroveci 43. RSV #3 44. HCoV OC43 45. Rnase P IC 46. HPIV 1 #2 47. HPIV 3 #3 48. Rhinovirus #2

!1. HAV #1 2. HAV #2 3. HBV #1 4. HBV #2 5. HDV 6. HGV 7. HEV #1 8. HEV #2 9. HCV #1 10. HCV #2 11. 18S RNA 12. HCV gt 1 #1 13. HCV gt 1 #2 14. HCV gt 2 #1 15. HCV gt 2 #2 16. HCV gt 3 #1 17. HCV gt 3 #2 18. HCV gt 3 #3 19. HCV gt 3 #4 20. HCV gt 4 21. B19 22. Sen V/TTV 23. SV40 24. Dengue virus

!25. Rnase P IC 26. Adenovirus #1 27. Adenovirus #2 28. JC virus 29. BK virus 30. HSV #1 31. HSV #2 32. HSV type 1 33. HSV type 2 34. VZV #1 35. VZV #2 36. EBV #1 37. EBV #2 38. CMV #1 39. CMV #2 40. HHV 6 A /B 41. HHV 7 42. HHV 8 43. Mycobacteria spp 44. M. tuberculosis 45. Coxiella burnetii 46. Toxoplasma gondii 47. C. psittaci 48. MS2 IC

!1. Adenovirus #1 2. Adenovirus 40/41 #1 3. Astrovirus #1 4. Sapovirus #1 5. Sapovirus #2 6. Enterovirus #1 7. Parechovirus 8. HEV #1 9. PDV IC 10. Rotavirus #1 11. 18S RNA 12. Norovirus GII 13. Norovirus GI #1 14. Norovirus GI #2 15. C. difficile GDH 16. C. difficile Tox B 17. E. coli vtx 1 18. B. thuringiensis IC 19. E.coli vtx 2 20. Campylobacter spp 21. Salmonella ttr 22. Cryptosporidium #1 23. GFP IC 24. Adenovirus #2

!25. Adenovirus 40/41 #2 26. Astrovirus #2 27. Giardia lambia #1 28. Rotavirus #2 29. Enterovirus #2 30. HAV 31. HEV #2 32. MS2 IC 33. Rotarix vaccine NSP2 34. CMV 35. RNase P IC 36. Salmonella hil A 37. Shigella ipa H 38. Entero Agg E. coli 39. C. jejuni 40. C. coli 41. Y. enterocolitica 42. Bacterial 16S 43. A. hydrophilia 44. V. cholerae 45. Dientamoeba fragilis 46. Entamoeba histolytica 47. Cryptosporidium #2 48. Giardia lambia #2

Resp TAC ECMO TAC

Jaundice TAC Gastro TAC

!1. Enterovirus #1 2. Enterovirus #2 3. S. pneumoniae 4. S. pyogenes 5. S. aureus (Nuc) 6. H. influenzae 7. Parechovirus 8. S. pyogenes #2 9. N. meningiditis 10. S. agalactiae #1 11. 18S RNA 12. E. coli 13. L. monocytogenes #1 14. L. monocytogenes #2 15. LCMV 16. Staph spp (Tuf) 17. S. agalactiae #2 18. C. neoformans 19. Cryptococcus ITS 20. Rubella virus 21. B19 22. B. thuringiensis IC 23. BK/JC virus 24. Measles virus

!25. RNase P IC 26. Mumps virus 27. West Nile virus 28. JC virus 29. BK virus 30. HSV #1 31. HSV #2 32. HSV type 1 33. HSV type 2 34. VZV #1 35. VZV #2 36. EBV #1 37. EBV #2 38. CMV #1 39. CMV #2 40. HHV 6 A/B 41. HHV 7 42. HHV 8 43. Mycobacteria spp 44. M. tuberculosis 45. B. burgdorferi 46. T. gondii 47. HSV #3 48. MS2 IC

CNS TAC

!1. HAV #1 2. HAV #2 3. HBV #1 4. HBV #2 5. HDV 6. HGV 7. HEV #1 8. HEV #2 9. HCV #1 10. HCV #2 11. 18S RNA 12. Aspergillus 18S 13. Aspergillus 28S 14. Fungal 18S 15. HPV generic 16. HPV 16 E6 17. HPV 18 E6 18. WU PyV 19. KI PyV 20. MC PyV 21. B19 22. SENV 23. BK/JC virus 24. HPV gp 16

!25. RNase P IC 26. Adenovirus #1 27. Adenovirus #2 28. JC virus 29. BK virus 30. HSV #1 31. HSV #2 32. HSV type 1 33. HSV type 2 34. VZV #1 35. VZV #2 36. EBV #1 37. EBV #2 38. CMV #1 39. CMV #2 40. HHV 6 A/B 41. HHV 7 42. HHV 8 43. Mycobacteria spp 44. M. tuberculosis 45. Coxiella burnetii 46. Toxoplasma gondii 47. C. psittaci 48. MS2 IC

Transplant TAC

Smörgåsbord of validated RT-PCR assays


QCMD 2017 Neonatal Infections EQA Pilot Study

Sample Code

Sample Content

Matrix*

Detection Frequency

Sample Status

Neonate Taqman (V5) array card Results Ct Value

NEO17S-01 Coxsackievirus Type B3 TM

Enterovirus #1 27.509 Enterovirus #2 29.370

NEO17S-02 Parechovirus Type 1 TM Parechovirus 29.370

NEO17S-03 Cytomegalovirus (AD169) Plasma CMV #1 33.775 CMV #2 32.556

NEO17S-04 Cytomegalovirus (clinical) Plasma CMV #1 33.609 CMV #2 35.320

NEO17S-05 Echovirus Type 11 TM Enterovirus #1 29.922 Enterovirus #2 33.928

NEO17S-06 Negative TM Negative

NEO17S-07 Herpes Simplex virus Type 2 TM HSV gly D 26.256 HSV#2 27.206 HSV #3 29.232 HSV type 2 31.460

NEO17S-08 Streptococcus agalactiae TM S. agalactiae #2 34.200 S. agalactiae #3 36.576

NEO17S-09 Parechovirus Type 2 TM

Parechovirus 29.444

NEO17S-10 Herpes Simplex virus Type 1 TM

HSV gly D 31.664 HSV#2 32.540 HSV #3 32.887 HSV type 1 33.272

* Transport Medium (TM).

!

1. Adenovirus #1 2. C.cayetanensis #1 3. Astrovirus #1 4. Sapovirus #1 5. Sapovirus #2 6. Enterovirus #1 7. Parechovirus 8. C.cayetanensis #2 9. Campy coli - jejuni 10. Rotavirus #1 11. 18S RNA 12. Norovirus GII 13. Norovirus GI 14. Norovirus GI mod33 15. C difficile GDH 16. C difficile Tox B 17. E.coli vtx1 18. BT control IC 19. E.coli vtx2 20. C.perfringens α toxin 21. Salmonella ttr 22. Cryptosporidium #1 23. Campy jejuni #2 24. Adenovirus #2

!

25. Adenovirus 40/41 26. Astrovirus #2 27. Giardia lamblia #1 28. Rotavirus #2 29. Enterovirus #2 30. Hepatitis A virus 31. HEV #2 32. MS2 IC control 33. Strongyloides 34. CMV 35. Rnase P IC control 36. Salmonella hil A 37. Shigella ipa H 38. Enteroagg E. coli 39. V parahaemolyticus 40. Campy coli 41. Y enterocolitica 42. Bacterial 16S rRNA 43. Aeromonas hydrophilia 44. V. cholerae 45. Cystoisospora belli 46. Entamoeba histolytica 47. Cryptosporidium #2 48. Giardia lamblia #2

Enteric TAC IV

EvaluationofversionIVCardat5PHEsitesisnowunderway–400specimenspersite

Sites:Cambridge,Newcastle,Bristol,SouthamptonandLondon

Gastro array version 1 : specimen Result Multiple pathogens detected : a new complexity to now negotiate !

16S Giardia#2 Campy Sal hil Entero Agg

Enterovirus#1 Enterovirus#2

Giardia#1

18S

Sal ttr

Rnase P

Specimen 266 Giardia lamblia Ct 11.4/15.0 Campylobacter sp Ct 18.6 Salmonella sp Ct 25.8/26.9 Enterovirus Ct 28.9/29.2 Entero Agg E.coli Ct 30.7

Returning traveller from Kenya : stool sample processed on gastrointestinal TaqMan® array card IV



QCMD 2017 Parasitic Gastroenteritis EQA Pilot Study

Sample Code

Sample Content

Matrix*

Detection Frequency

Sample Status

Gastro Taqman (V4) array card Results Ct Value

GASTROP17S-01 Negative SFM Negative

Educational Negative

GASTROP17S-02 Entamoeba histolytica SFM Detected Educational E histolytica 33.783

GASTROP17S-03 Entamoeba histolytica SFM Detected

Educational E histolytica 28.295

GASTROP17S-04 Giardia lamblia SFM Frequently detected

Educational G lamblia#1 29.969 G lamblia#2 27.771

GASTROP17S-05 Cryptosporidium parvum SFM Detected

Educational C parvum #1 24.782



GASTROP17S-07 Cryptosporidium parvum SFM

Frequently detected

Educational C parvum #1 24.782 C parvum #2 32.904




QCMD 2017 Bacterial Gastroenteritis EQA Pilot Study

Sample Code

Sample Content

Matrix*

Detection Frequency

Sample Status

Gastro Taqman (V4) array card Results Ct Value

GASTROB17S-01

Salmonella enteric Serovar Enteritidis SFM

Frequently detected

Educational

Salmonella ttr 33.246 Salmonella hil 30.725

GASTROB17S-02 Campylobacter jejuni SFM Frequently detected

Educational

C.coli/C.jejuni 35.742 C.jejuni -----

GASTROB17S-03 Yersinia enterocolitica SFM Detected

Educational Y. enterocolitica 27.604

GASTROB17S-04 Campylobacter coli SFM Frequently detected

Educational C.coli/C.jejuni 31.677 C.coli 29.815

GASTROB17S-05 Negative SFM Frequently detected

Educational

Negative

GASTROB17S-06 Campylobacter lari SFM Infrequently Detected

Educational

Negative

GASTROB17S-07 Plesiomonas shigelloides SFM Infrequently Detected

Educational

Negative

GASTROB17S-08 Shigella flexneri SFM Frequently detected

Educational

Shigella IPA 25.574

GASTROB17S-09 Clostridium difficile 027 SFM

Infrequently Detected

Educational C difficile GDH 33.243 C difficile ToxB 33.038

Gastro array card review summary •  ~ 4500 specimens processed to date on the cards

•  Sensitivity/Specificity ~95%

•  QCMD panels ~95% concordance to date

•  Data so far is equal to/or superior to our routine molecular tests (Norovirus)

•  Analytical sensitivities determined using the designed Gastro Multi Control Array plasmids copies per reaction for all targets

•  Study completed at Addenbrooke’s Hospital which examined ~2000 stool specimens sent for routine diagnostic examination – analysis currently underway

•  Interpretation guidance will be crucial - e.g. Dientamoeba fragilis, Enteroaggregative E coli

•  Significant numbers of gastrointestinal infections are currently missed with our current diagnostic algorithms i.e. Sapovirus, Astrovirus, Norovirus, Enterovirus/Parechovirus, C difficile, Campylobacter

•  Proved helpful in a number of outbreaks i.e. Clostridium perfringens

“Weneedtouseantibioticsmoresparinglyinhumansandanimals,toreducetheunnecessaryusethatspeedsupdrugresistance.Todothis,weneedastepchangeinthediagnostictechnologyavailable”IntensiveCareUnit(ICU)<10%oftotalhospitalbedsyetmorethan20%ofallnosocomialinfectionsareacquiredinICU.Approximately50%ofallantibioticsadministeredinICUsarefortreatmentofventilatorassociatedpneumonia(VAP).

QCMD 2017 Extended Spectrum β-lactamase (ESBL) and Carbapenemase EQA Pilot Study

Sample Code

Sample Content

ESBL / Carbapenemase Status

ESBL/Carbapenemase Type Taqman array card Results Ct Value

TEM

SHV

CTX-M

Carba

ESBL17S-01 K. pneumoniae Carbapenemase

-

SHV-1 (non ESBL)

-

KPC-3, OXA-48

KPC #1 16.210 KPC #2 16.080 OXA-48 15.708

ESBL17S-02 E. coli Carbapenemase

-

-

-

OXA-244

OXA-48 15.155

ESBL17S-03

E. coli

Carbapenemase

TEM-1 (non ESBL)

-

-

IMP-1

IMP#1 17.070

ESBL17S-04 E. coli Negative -

-

-

-

Negative

ESBL17S-05 E. cloacae ESBL/Carbapenemase

-

SHV-12 (ESBL)

CTX-M-9

(ESBL)

OXA-48

OXA-48 15.477

ESBL17S-06 C. brakii Carbapenemase -

-

-

VIM-1

VIM #1 16.187 VIM #2 14.024

ESBL17S-07 K. pneumoniae ESBL/Carbapenemase

TEM-1 (non ESBL)

SHV-1 (non ESBL)

CTX-M-2

(ESBL)

KPC-2

KPC #1 13.210 KPC #2 13.093

ESBL17S-08 E. cloacae ESBL/Carbapenemase

TEM-1 (non ESBL)

SHV-12 (ESBL)

CTX-M-15

(ESBL)

NDM-1

NDM #1 15.410 NDM #2 12.152

100%concordanceforCarbapenemasegenes

QCMD 2017 Vancomycin Resistant Enterococci EQA Pilot Study

Sample Code

Sample Content

Sample Relationship

Sample Conc. (CFU/ml)

Vancomycin Resistance Status/type

Taqman array cards Results Ct Value

VRE17S-01 E. faecium (LMG 16165) DS1_2 1 x 10E3

POS Van A Van A#1 35.113 Van A#2 36.887 E faecium #1/#2/#3 27.855/32.711/32.364

VRE17S-02 E. faecalis (ATCC51299) DS2_3 1 x 10E4

POS Van B Van B#1 32.181 Van B#2 34.175 E faecalis #1/#2/#3 30.722/30.318/31.955

VRE17S-03 S. aureus (ATCC25923) 1 x 10E5 Negative

VRE17S-04 E. faecalis S (ENT20130032) 1 x 10E6 VAN A/B Negative E faecalis #1/#2/#3 24,174/24.700/22.870

VRE17S-05 E. faecium S (Ml204339) E. gallinarum (LMG16165)

1 x 10E5 1 x 10E5

POS Van C VAN A/B Negative E faecium #1/#2/#3 30.196/30.462/29.971

VRE17S-06 E. faecium (LMG 16165) DS1_1 1 x 10E4




VRE17S-08 E. faecium (IOWA 2) 1 x 10E4

POS Van B Van B#1 31.127 Van B#2 28.100 E faecium #1/#2/#3 29.971/31.050/29.995

VRE17S-09 Negative Negative



VRE17S-11 E. faecium (IOWA 1) 1 x 10E4


VRE17S-12 E. gallinarum (ENT20120142) 1 x 10E5

POS Van B/C Van B#1 26.805 Van B#2 24.373


QCMD 2017 Bacterial Sepsis EQA Pilot Study

Sample Code

Sample Content

Matrix*

Detection Frequency

Sample Status

Taqman array cards Results Ct Value

BSEPSIS 17S-01 Klebsiella pneumoniae TM Detected

Educational K pneumoniae #1 25.039 K pneumoniae #2 25.982 Enterobacteriaceae 26.199

BSEPSIS 17S-02 Streptococcus pneumoniae TM Frequently Detected

Educational S pneumoniae #1 27.615 S pneumoniae #2 28.008

BSEPSIS 17S-03 Enterococcus spp TM Detected

Educational E faecalis #1 23.632 E faecalis #1 26.532 E faecalis #1 25.197

BSEPSIS 17S-04 Pseudomonas aeruginosa TM Detected

Educational P aeruginosa #1 26.769 P aeruginosa #1 25.974

BSEPSIS 17S-05 Streptococcus pneumoniae Blood Detected

Educational S pneumoniae #1 30.353 S pneumoniae #2 32.160

BSEPSIS 17S-06 Enterococcus spp Blood Detected

Educational E faecalis #1 32.159 E faecalis #1 32.821 E faecalis #1 29.660

BSEPSIS 17S-07 Pseudomonas aeruginosa Blood Detected

Educational P aeruginosa #1 29.488 P aeruginosa #1 29.740

BSEPSIS 17S-08 Negative Blood Negative


BSEPSIS 17S-09 Streptococcus pneumoniae Blood Detected


BSEPSIS 17S-10 Klebsiella pneumoniae Blood Detected

Educational K pneumoniae #1 26.715 K pneumoniae #2 27.203 Enterobacteriaceae 27.612

ECMO VAP 96 Array Card ICU Study


001 Coronavirus OC43 002 Legionella pneumophilia 003 Influenza B and Staphylococcus aureus 004 Influenza A H3 and Staphylococcus aureus 005 PCR negative 006 PCR negative

Title:The Taqman Microarray Card for Rapid Pathogen Identification in Ventilated Patients with Pneumonia 100 Patients BAL specimens Conventional Virology/Microbiology tests

VAP 96 TaqMan® Array Card Next Generation Sequencing Shotgun and 16S metagenomic NGS

Addenbrooke’s Charitable Trust

Conclusions •  Surpassed expectations - Proof of principle ! •  Opens the door for a syndrome led approach to diagnosis, harnessing your own in-house assays •  HCV genotyping array card, Respiratory/ECMO array card in routine use - Gastro-intestinal pathogen array card recent paper PHE Gastro plate currently in validation phase ! ( Liu J and colleagues J Clin Micro 2013 51:472-480) Ventilator Associated Pneumonia array card ! - Exotic virus array card (West African array card) Jaundice/Transplant pathogen array card ! - The list goes on…Eye Infections………… STI/Neonatal sepsis array card in validation phase !

CNS pathogen array card in validation phase ! •  Standardisation of assays across a network of laboratories •  Outbreak investigations & surveillance •  Sepsis array card - Intensive care units •  Crème de la crème of assays to the card; evolutionary process •  Parachute in the technology •  Exciting future in infectious disease diagnosis

Collaborators/Contributorsontheprojects: CambridgePHElaboratory:

SurendraParmar, JaneGreatorexJumokeSule,DavidEnoch, HamidJalal,

MadalenaSantos,NicholasBrown

UniversityofCambridge:LydiaDrumwright,LuigiMarongui

JudeHeaney,GraemeAlexander

VilasNavarpurkar,JurgenHerre

GordonDougan,VanessaWong,

EsteeTorok,JosefinBartholdsonScott

AndrewConway-Morris

AppliedBiosystems/Thermofisher:AstridFerlinz,MarkBeresford

AzSint-JanHospital,Bruges,Belgium:

MarijkeReydners,PatrickDescheemaeker

CentreforInfections,Colindale:

KathieGrant,ClaireJenkins,DavidJamesAllen

VickiChalker,SarahAlexander,PamelaSandu,

MarisaLaranjeira

CryptosporidiumReferenceUnit,PublicHealthWales:

RachelChalmers,KristinElwin

BristolPHELaboratoryBarryVipond,PeterMuirManchesterPHELaboratoryMalcolmGuiver,AndrewTurnerAndrewFox,JacquelineWellsNewcastlePHELaboratory:

GaryEltringham,AndySailsJohnMagee

LondonPHElaboratory:

DerrenReady,JohnHaigh

SouthamptonPHElaboratory:

PeterMarsh,SimonFriar

Syndromic approaches to infection detection: TaqMan...

Documents

Transcript of Syndromic approaches to infection detection: TaqMan...