Sxxx,2012 12-02,tr,011,bs-c-4 c,e1.0
-
Upload
adriana-zehbrauskas -
Category
Documents
-
view
1.758 -
download
5
description
Transcript of Sxxx,2012 12-02,tr,011,bs-c-4 c,e1.0
TR 11THE NEW YORK TIMES, SUNDAY, DECEMBER 2, 2012
By AUSTIN CONSIDINE
SOMEWHERE between the
grilled watermelon with pan-ela cheese and my second tacode cochinita — a Yucatecantaco stuffed with pork, black
beans and pickled onions — I put downmy fork. I couldn’t eat another bite.
“Maybe you didn’t notice how heavythe food is here?” said my friend Gui-llaume Guevara. We were sitting in theTaberna de los Frailes in Valladolid, acolonial city of Spanish arcades and16th-century spires on the Yucatán Pen-insula. Guillaume was right: the foodwas filling. The two days I spent therein March were punctuated with rich,sleep-inducing meals: deep-fried torti-llas, cream-based soups and enoughbeans, pork and nopal cactus to keepme teetering on the edge of a constantfood coma.
A few days earlier, we had celebratedGuillaume’s wedding in the eco-chicbeach resort town of Tulum, an hour’sdrive to the southeast; several of us inthe wedding party had come to Vallado-lid to recover from 72 hours of tirelesspartying. The city, often overlooked bytravelers making a beeline to the Yuca-tán’s flashier hot spots, provided justthe right antidote to the fashion-con-scious whirlwind in Tulum. Here wefound artists and artisans peddlingtheir wares in mom-and-pop shops,friendly residents and a refreshinglyunpretentious night life.
Of course, cool, undiscovered placesrarely stay cool and undiscovered, andone might expect Valladolid to becomethe next Tulum or even Cancún, whichisn’t that far away. But its distance fromthe beach means that Valladolid prom-ises to remain a sophisticated refuge.
There is a budding cosmopolitan spir-it these days, as some expatriate taste-makers restore old haciendas and startbusinesses. Ariane Dutzi, for instance, aformer correspondent from Germanywho now runs her own line of locallyhandmade bags, Dutzi Design, justopened her first boutique in Valladolid(Calle 42 No. 217; dutzidesign.com).Tulum had become “overrun” with tour-ists, she said, but in Valladolid, she hasfound “something more authentic.”
Authentic: it’s a word that is fre-quently used when describing Vallado-lid. Culturally speaking, it’s a layeredauthenticity. The city is deeply Mayan,from the cuisine — sweet and spicy,heavy on the beans and slow-roastedpork — to the guttural consonants of theMayan language heard on its streets.Many women wear the traditional Ma-yan huipil — white cotton blouses ordresses adorned with bright, floweredembroidery and sold in places like theMercado de Artesanias, a block fromthe city’s beautiful, newly refurbishedParque Principal, or central square.
It is also distinctly Spanish: Foundedby invading Spaniards in 1543, its colon-nades, pastel stucco and paving-stonestreets give Valladolid an Iberian feel.The central cathedral, a fortress of as-cetic Franciscan architecture, is stand-ing room only on Sunday evenings. Asin Spain, shops are often shuttered eachafternoon for siesta.
“This is a nice place because you canhave everything without all the noise,”said Alejandra Rivero Flores, whoworks at her family’s business, Tequile-ria Poncho Villa, a little liquor store thatI stumbled upon on bustling Calle 41(No. 216), drawn in by the life-size, col-orfully dressed skeleton doll proppedout front. Inside, surrounded by count-less varieties of tequilas, Ms. Floresticked off Valladolid’s attributes: greatshopping and food, a close-knit commu-nity for raising children and an urbanitythat has developed in tandem with thecity’s recent efforts to restore its build-ings and byways.
You can also find the natural splendorof the Yucatán, which not only sur-rounds the city, but also permeates it.The flat, porous limestone shelf of thepeninsula is penetrated by thousands ofsinkholes, or cenotes, filled with freshwater. I found one of them, the CenoteZaci, about three blocks east of the cen-tral square. Though it’s not exactly re-mote, the stone steps leading down tothe sinkhole, which lies within a cave-like formation surrounded by jungle fo-liage, delivered me to another world.Lizards and birds were perched in thenooks and crannies of the limestonewalls that rose up around the sinkhole;the cool, blue water, about 280 feet deep,was perfect for diving. (Less confidentdivers like me can do cannonballs offthe cenote’s 23-foot-high walls.) Athatched roof cafe beside the cavemouth is a great place to unwind with acerveza and a taco.
I was often reminded that the Yuca-tán jungles lay just beyond Valladolid’sspired horizons. From my room at theMesón del Marqués at sunrise, I couldhear birds hidden in the laurel trees ofthe central square screech and whistle
— at once beautiful and primordial in away that reminded me that Mayansonce practiced human sacrifice atop thepyramids of nearby Chichen Itza.
When the birds fall silent, Valladolidbuzzes with the hum of scooters weav-ing among brightly colored taxis andvintage Volkswagen bugs. Occasionally,a man on horseback pokes out of an al-ley and clip-clops down the street.
“You see what it’s like here all thetime,” said Francesca Bonato upon see-ing one such horseback rider on the Cal-zada de los Frailes (another name forCalle 41/A), a long, narrow street linedwith colorfully painted, single-story ha-ciendas, many of which have been re-cently restored or converted into bou-tiques. Ms. Bonato, an Italian accessoryline owner, and her husband, NicolasMalleville, an Argentine fashion model,are attracting a trickle of friends andwell-heeled creative types into Vallado-lid, just as they did nearly a decade agoin Tulum, when they opened the first offour Coqui Coqui residences there (itsfirst guest, Ms. Bonato told me, wasJade Jagger).
MS. BONATO and I sippedcoffee amid the gardensblooming with frangipa-nis, gardenias and limetrees behind the couple’s
Valladolid perfumery. Their variousprojects on the Yucatán began, she said,when Mr. Malleville fell in love withTulum and bought his “little piece ofsand” there in 2002, the year before thecouple met. Around that time, he beganresearching perfume formulas devel-
oped by Franciscan monks who colo-nized the Yucatán in the 16th century;he attempted to blend those formulaswith ingredients prized in ancient Ma-yan medicine, the fruits of which led tothe founding of Coqui Coqui perfumes.
In 2005, Hurricane Katrina destroyedmuch of their property at Tulum (whichhas since been restored) and the couplemoved to Valladolid, where they turneda run-down old colonial house on theCalzada de los Frailes into the gorgeousnew perfumery, showroom, spa andguest suite. All the fragrances aremixed, and bottled and sold on site ($49for bottles of eau de perfume withscents like “lavender and camomile,” or“mint and lime”). Ms. Bonato also is anowner of Hacienda Montaecristo (Calle41/A No. 224; montaecristo.com), a lineof accessories featuring hand-stitchedleather wares made locally and sold in arustic showroom a few doors down.
Also on the Calzada de los Frailes, the
Cacao organic chocolate collective pro-duces handmade chocolates, drawingfrom a tradition that goes back to theancient Mayans. Farther down thestreet is the Convento de San Bernardi-no de Siena, built in the 16th century.Here, I wandered within its stone wallsat sunset, exploring the dark stairwaysas the fading light streamed in throughsmall windows, imagining the hermeticlife of the Spanish monks who residedthere centuries ago.
One thing I quickly learned in Valla-dolid: To properly enjoy the local cui-sine, keep some antacids handy. Thisshould be little surprise on the Yucatán,which is home to one of the world’s hot-test chile peppers, the habanero. Add tothat the local reliance on black beans,melted cheese and deep-fried tortillas.
For fine Yucatecan food in the peace-ful garden setting of a hacienda court-yard, there’s nowhere better thanTaberna de los Frailes (Calle 49 No. 235;
tabernadelosfrailes.com), across thestreet from the monastery. Try the pookchuuk — grilled pork fillets marinatedin Mayan white spices and sour orange,or the tikin xic, snapper grilled in annat-to sauce. At Las Campanas on thesquare, I was treated to traditionalsongs accompanied by two marimbasas I feasted on queso relleno, a chunk ofhard aged cheese stuffed with pork,swimming in a white cream-based soup.After that meal, my ambitions for thenext few hours were thwarted.
It’s possible to spend the equivalentof a few dollars for a filling meal, as Idiscovered at the covered market on thecentral square’s northeast corner. Iloved the panuchos — deep-fried bean-stuffed tortillas. And if you’re hankeringfor pizza, try the Casa Italia (Calle 35,lote 202-J; casaitaliamexico.com), a piz-zeria on the Parque de La Candelaria, apark anchored by the Iglesia de Cande-laria, with its high arches in the Moorishstyle and bright, salmon-colored stucco.
The architecture, the quiet eveningsspent strolling down narrow streets,and the endless rounds of feasting areamong the charms that led my friendGuillaume and his wife, Olivia Villanti,who live in Brooklyn, to bring their wed-ding party to Valladolid after Tulum. “InValladolid, you’re in the middle of thecity and you can take a walk down thestreet and you’ll end up somewherebeautiful,” Olivia said.
An occasional walk is certainly notthe worst idea after all that eating. Nei-ther was the running regimen I vowedto revive as soon as I got back to NewYork. Æ
N E X T S T O P
Valladolid, a City of Yucatán Cool
PHOTOGRAPHS BY ADRIANA ZEHBRAUSKAS FOR THE NEW YORK TIMES
ABOVE In the showroom of their leather-goods store Hacienda Montaecristo, Francesca Bonato, seated center, and Jacopo Janniello Ravagnan, with beard.BELOW The sound of motor scooters punctuates Valladolid. BELOW RIGHT Tacos de cochinita at Taberna de los Frailes.
MMMMMM
Mérérrididaidadaaa nnCaC úcúCancún
ululu uumumTuValladolid
YUCYUCCATÁATÁTÁNNN
Gulf of Mexico
Pacific OOcean
MEXMEXMEXMEXMEXMMEXEXXEXICOICOICOICOICOICOCOCC
P ifi OO
G AG AGG AG AG AAAAAATETTETETEE A AA AA AAAA AGUAGUAGGUAGUAGUAGUAGUAGUG AAAAAAAATEMTEMTEMTEMTEMTEMTEMMTEMTT ALAALAALAALAALAALAALAALAL
ASASASSSSASSHONHONHONHONHONONHONO DURDURDURDURDURDURDURDDU AAAA
IIZZZEEIZBELBELBELBELBBELELIIZZ
RROROROEL SALSALSALALALVADAVADVADVAVA OOALLVADVADVADVADVADVADADORORORORORORORRR
100MILES
THE NEW YORK TIMES
FROM LEFT At Dutzi Design, which sells handmade bags, workers go through fabric to complete an order; the showroom at Hacienda Montaecristo; the Coqui Coqui perfumery.
The 90-room Mesón del Marqués (Calle 39 No. 203; 52-985-856-2073;mesondelmarques.com) has rooms with magnificent views of the centralsquare. Dining in the garden is recommended even if you aren’t spending thenight. Rooms start at 735 pesos a night (about $58 at 12.8 pesos to the dollar).
The pink, colonnaded Hotel Maria de la Luz (Calle 42 No. 193; 52-985-856-1181; marialuzhotel.com.mx) has 70 rooms across the square; from $40.
For something a bit more private, try the single suite at the Coqui Coquiresidence, spa and perfumery, spacious, gorgeous and spare, with high ceil-ings and white tiles (Calle 41/A No. 207; 52-985-856-5129; coquicoquispa.com).The suite starts at $230 a night, depending on the season.
Where to Stay
C M Y K Sxxx,2012-12-02,TR,011,Bs-4C,E1