Sw. occidentalis invertase structure and specificity Miguel Álvaro ...

Sw. occidentalis invertase structure and specificity

1

STRUCTURAL AND KINETIC ANALYSIS OF SCHWANNIOMYCES OCCIDENTALIS INVERTASE REVEALS A NEW OLIGOMERIZATION PATTERN AND THE ROLE OF ITS SUPPLEMENTARY

DOMAIN IN SUBSTRATE BINDING

Miguel Álvaro-Benito1, Aitana Polo2, Beatriz González2, María Fernández-Lobato1 and Julia Sanz-Aparicio2*

1 Centro de Biología Molecular Severo Ochoa, Departamento de Biología Molecular (CSIC-UAM), Universidad Autónoma de Madrid, Cantoblanco, 28049 Madrid, Spain.

2 Grupo de Cristalografía Macromolecular y Biología Estructural, Instituto de Química-Física "Rocasolano", CSIC, Serrano 119, 28006-Madrid, Spain.

* To whom correspondence should be addressed: J. Sanz-Aparicio. Tel: (+34) 91 561 9400. Fax: (+34) 91 564 2431. e-mail: [email protected]

Running title: Sw. occidentalis invertase structure and specificity

http://www.jbc.org/cgi/doi/10.1074/jbc.M109.095430The latest version is at JBC Papers in Press. Published on February 24, 2010 as Manuscript M109.095430

Copyright 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on March 13, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/cgi/doi/10.1074/jbc.M109.095430

http://www.jbc.org/


2

STRUCTURAL AND KINETIC ANALYSIS OF SCHWANNIOMYCES OCCIDENTALIS INVERTASE REVEALS A NEW OLIGOMERIZATION PATTERN AND THE ROLE OF ITS SUPPLEMENTARY

DOMAIN IN SUBSTRATE BINDING

Miguel Álvaro-Benito1, Aitana Polo2, Beatriz González2, María Fernández-Lobato1, Julia Sanz-Aparicio2*

1 Centro de Biología Molecular Severo Ochoa, Departamento de Biología Molecular (CSIC-UAM), Universidad Autónoma de Madrid, Cantoblanco, 28049 Madrid, Spain. 2 Grupo de

Cristalografía Macromolecular y Biología Estructural, Instituto de Química-Física "Rocasolano", CSIC, Serrano 119, 28006-Madrid, Spain.

Running title: Sw. occidentalis invertase structure and specificity * To whom correspondence should be addressed: J. Sanz-Aparicio. Instituto Rocasolano, CSIC, Serrano 119, 28006 Madrid. Tel: (+34) 91 561 9400. Fax: (+34) 91 564 2431. E-mail: [email protected]

ABSTRACT

Schwanniomyces occidentalis invertase is an extracellular enzyme that hydrolizes sucrose and releases β-fructose from various oligosaccharides and essential storage fructan-polymers such as inulin. We report here the three-dimensional structure of Sw. occidentalis invertase at 2.9 Å resolution, and its complex with fructose at 1.9 Å resolution. The monomer presents a bi-modular arrangement common to other GH32 enzymes, with an N-terminal fivefold β-propeller catalytic domain and a C-terminal β-sandwich domain with up to now unknown function. However, the dimeric nature of Sw. occidentalis invertase reveals a unique active-site cleft shaped by both subunits that may be representative of other yeast enzymes reported to be multimeric. Binding of the tetrasaccharide nystose and the polymer inulin has been explored by docking analysis, which suggests that medium and long-size substrates are recognized by residues from both subunits. The identified residues have been mutated and the enzymatic activity of the mutants against sucrose, nystose and inulin has been investigated by kinetic analysis. The replacements that showed the largest effect on

catalytic efficiency are Q228V, a residue putatively involved in nystose and inulin binding, and S281I, involved in a polar link at the dimer interface. Moreover, a significant decrease of catalytic efficiency against inulin is observed in the mutants Q435A and Y462A, both located in the β-sandwich domain of the second monomer, highlighting the essential function that oligomerization plays in substrate specificity and assigning, for the first time, a direct catalytic role to the supplementary domain of a GH32 enzyme.

INTRODUCTION

Fructans, the fructose-rich polymers biosynthetically derived from sucrose, are important storage oligosaccharides and polysaccharides in many bacteria, fungi, and numerous plant species. Furthermore, sucrose is one of the most widespread disaccharides in nature and especially ubiquitous in higher plants as the first free sugar resulting from photosynthesis. It is the major transport compound to bring energy and carbon skeletons from source to sink tissues. Carbohydrate partitioning and sugar sensing are intimately connected to sucrose metabolism and


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


3

these processes are vital throughout plant development. Therefore, the enzymes involved in fructans and sucrose processing are essential in plant cell metabolism.

The enzymes that hydrolyze sucrose are collectively referred to as invertases or β-fructofuranosidases (EC 3.2.1.26) and catalyze the release of β-fructose from the non-reducing end of various β-D-fructofuranoside substrates (Figure 1). The cleavage of the β-glycosidic bond is carried out by a double displacement catalytic mechanism that retains the configuration of the fructose anomeric carbon, two conserved residues, an aspartic and a glutamic acid, being the nucleophile and the general acid-base catalyst, respectively. Based on the amino acid sequences (1) they are classified into family 32 of the glycosyl-hydrolases (GH32), which are included into the GHJ clan together with the GH68 (inulosucrase family).

To date, the three-dimensional structures of exoinulinase from Aspergillus niger (var. awamori)) (AaEI) (2), a β-fructofuranosidase from Thermotoga maritima (TmInv) (3), a plant FEH from Chichorium intybus (CiFEH) (4), and a cell-wall invertase from Arabidopsis thaliana (AtInv) (5), all included in the GH32 family, have been solved by X-ray crystallography. These studies showed a common bimodular arrangement for this family, being folded into a catalytic and a β-sandwich domain with unknown function. In addition, the complexes of these enzymes with short substrates, i.e. fructose (2), sucrose (6), and the three-saccharides 1-kestose (7) and raffinose (8) have also been reported. These studies provided insights into the fructose binding pocket, i.e. the -1 subsite following the nomenclature used for sugar-binding substrates (9), which defines that the cleavage occurs between subsites -1 and +1. Some general features of the +1 and +2 subsites were also described and, hence, while the +1 subsite was found to be formed by several residues making hydrophobic and polar interactions with the substrates, the sugar unit bound at subsite +2 seemed more loosely recognized mostly through a few polar interactions mediated by water molecules. Moreover, additional binding subsites for longer substrates have been discarded (8).

It is worth noting that a GH32 yeast invertase structure has not been reported until now, and this is a remarkable fact taking into account that yeast invertases have been described to be multimeric.

As shown by electron microscopy (10) the basic structural unit of external and internal yeast invertase is a dimer, but it seems able to associate into larger oligomers upon mannose binding (11). These studies suggested that the extent of glycosylation of invertase appears to determine its oligomeric state, but the molecular mechanisms involved in higher aggregation are uncertain. It remains to be elucidated whether the supplementary β-sandwich domain of the enzyme plays the role of a carbohydrate recognition domain and, therefore, it is involved in oligomerization, at least in yeast enzymes.

The non-conventional yeast Schwanniomyces occidentalis (also Debaryomyces occidentalis) has been regarded for years as a biotechnological interesting organism due to its ability of growing in a broad range of inexpensive carbon sources, such as starch and inulin, by using a number of activities (12, 13, 14, 15), as well as for the efficient extracellular secretion of high molecular mass proteins (16, 17) and its low attached glycosylation (18). An extracellular invertase/fructofuranosidase activity has also been reported in this yeast when lactose is used as the carbon source (14). This secreted protein showed broad substrate specificity, hydrolyzing sucrose, 1-kestose, nystose or raffinose (Figure 1). In addition, the enzyme is able to catalyze the synthesis of fructooligosaccharides (FOS), mainly the prebiotic 6-kestose (a β-(2-6)-linked FOS), with 1-kestose (a β-(2-1)-linked FOS) being a side product of the reaction (19). Currently the main industrial FOS producer is the fructosyltransferase from Aspergillus (20, 21), that provides a mixture of FOS of the inulin-type structure β-(2-1), without production of 6-kestose. The protein amino acid sequence from Sw. occidentalis shares considerable sequence similarity with other yeast invertases, inulinases, levanases and fructosyltransferases, included into family GH32 (22). In this paper we report the crystal structure of the invertase produced by Sw. occidentalis (SoInv) that can serve as a model for other yeast GH32 enzymes. Computational docking studies have been done to identify the putative position for long substrates binding into the active site. Potential oligosaccharide-binding residues were mutated and the activities of the mutants were characterized. Our results illustrate the dimeric structure of yeast invertase and led to the


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


4

conclusion that this oligomerization is directly involved in substrate recognition and specificity.

EXPERIMENTAL PROCEDURES

Protein purification, crystallization and data collection- Extracellular SoInv was purified from Sw. occidentalis ATCC26077 and crystallized in an orthorhombic crystal form as described before (23). Equal amounts of protein solution (7 mg ml-1 SoInv in 20 mM Tris-HCl, pH 7.5 and 150 mM NaCl) and precipitant buffer (15 % (w/v) PEG 3350 in 100 mM Hepes, pH 7) were mixed and vapour equilibrated against a reservoir containing the later solution, in a sitting drop setup. These rod-shaped crystals belong to P212121 space-group, with 2 molecules per asymmetric unit and 67 % solvent content in the cell. For data collection, native crystals were transferred to cryoprotectant solutions containing 18 % (w/v) PEG 3350 and 30 % (w/v) glycerol before being cooled to 100 K in a stream of nitrogen. A full data set was collected at the European Synchrotron Facility (ESRF, Grenoble, France) using ID14-1 beamline, up to 2.9 Å. Additional data sets collected at beamlines ID23-1 and ID23-2 yielded lower resolution data. In an attempt to increase the diffraction power of the crystals, the sample was deglycosylated by treatment with endoglycosidase H (New England Biolabs), which reduced the molecular weight from 73 kDa, as determined by mass-spectrometry, to an apparent molecular mass below 66 kDa, as deduced from the SDS-PAGE analysis. The sample was concentrated to 10 mg ml-1 and screening of new crystallization conditions was performed with the PACT Suite from Qiagen. Small cubes and thick plates grew in drops containing 20 % PEG 6000, 0.2 M MgCl2 and pH ranging from 6 to 8. These crystals belong to P21 space group with 2 molecules in the asymmetric unit and 42 % solvent content. For data collection, a plate grown at pH 7 was soaked in a solution containing mother liquor and 50 mM nystose for 3 minutes before being transferred to cryoprotectant solution consisting of 25 % PEG 6000, 0.2 M MgCl2 and 15 % PEG400, and cooled to 100 K in a nitrogen stream. A full data set was collected to 1.9 Å at the ESRF ID14-4 beamline. Analysis of the diffraction patterns were performed using MOSFLM (24) and data merged with the CCP4 suite (25). A summary of data

collection and data reduction statistics is shown in Table 1.

Structure solution and refinement- The structure of SoInv was solved by molecular replacement method using data to 2.9 Å collected from the orthorhombic crystal form. Initial phases were obtained with the MOLREP program (26) using the atomic coordinates of AaEI as the search model (PDB code: 1Y4W). The best solution was obtained by using the sequence alignment of both enzymes to correct the model, which after rigid-body fitting produced an R-factor of 0.49 with a correlation coefficient of 0.49. Crystallographic refinement was performed by using Refmac (27) in the CCP4 suite (25) with flat bulk-solvent correction, including low-resolution data to 50 Å, and using maximum likelihood target features. A subset of 5 % randomly selected structure-factor amplitudes was excluded from automated refinement to compute a free R-factor throughout the refinement. Large regions of the β-sandwich domain were removed from the model since no electron density was observed at the polypeptide chain. These regions were mainly the loops of the β-sandwich but also some of the β-strands. Several rounds of refinement applying tight NCS restraints between both molecules in the asymmetric unit were alternated with major rebuilding of these regions using the program O (28), after which the final 2Fo–Fc maps showed continuous density for the whole polypeptide chain. At the last stage, water molecules, and several N-acetylglucosamine and glycerol molecules were included, combined with more rounds of positional and individual restrained B-factor refinement and TLS correction. When the monoclinic high resolution crystal form became available, additional rounds of refinement using the same strategy but applying loose NCS restraints between both molecules in the asymmetric unit were carried out, and minor corrections were introduced in the model, mainly concerning the orientation of the peptide bond. This led to a final R-factor of 0.21 (Rfree=0.25) for all data set up to 1.9 Å resolution. Final refinement parameters are reported in Table 1. Stereochemistry of the model was checked by using PROCHECK (29) and MOLPROBITY (30) and the figures were generated with PYMOL (31).

Automated docking of ligands into SoInv structure- The nystose coordinates were retrieved from the crystal structure (32) deposited in the


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


5

Cambridge Strutural Database (CSD). All hydrogen atoms were added to the ligand and charges were assigned by the Gasteiger method using AutoDockTools program (33). All bonds of hydroxyl groups and glycoside linkages, but not those of the sugar rings were defined as rotatable bonds. The inulin chain coordinates were also retrieved from the crystal structure determined from electron diffraction data (34) and deposited in the CSD. In this case, only hydroxyl groups were allowed to rotate, the glycoside linkages being maintained in a fixed helical conformation. The protein model contains the coordinates of the crystals structure of dimeric SoInv here presented, after removing water molecules and all heteroatoms. Polar hydrogen atoms were then added using AutoDockTools.

Autodock 4.0 (33) was executed 50 times with the Lamarckian genetic algoritm (LGA), a population size of 150, elitism set at 1, mutation rate at 0.02, and crossover rate of 0.80. Simulations were performed with a maximum of 2,500,000 energy evaluations and a maximum of 27,000 generations. Docking results were clustered using a cut off of 2 Å RMSD. In the case of inulin, additional manual docking was followed by optimization of inulin using the local search (LS) algorithm (Autodock 4.0), executed 30 times with 300 iterations and size of local search space set at 1. In these calculations, the eleven C1-C2 angles linking two fructose units were allowed to rotate, as this has been suggested to be the most flexible of the three glycoside torsions within each fructose-fructose pair (34).

Mutagenesis and protein purifications-The sequence SoINV (GenBank accession nº CQ890277) was amplified using the forward primer 5’-TAGGATCCAACATGGTACAAGTTTTAAGTGTATTAG-3’ and the reverse primer 5’-CATCTCTAGACTAGCCCTACTTATTTAGTTCTCT-3’. Restriction sites for BamHI and XbaI (shown in bold) were included in these primers for cloning the PCR product into the pYES2.0 shuttle vector (Invitrogen), under the control of the yeast GAL1 promoter. The generated construct was used as template for site directed mutagenesis using the method described previously (35) and the primers listed in Table 2. Saccharomyces cerevisiae EUROSCARF Y02321 [BY4741; Mat a; his3∆1; leu2∆0; met15∆0; ura3∆0; YIL162w::kanMX4]

(accession code Y02321) was used as the expression host and it was transformed by the lithium acetate method (36). Yeasts were growth on YPGal medium (Yeast Extract 1%, Peptone 1%, galactose 2%) to the beginning of the stationary phase (A660=6-7). Culture filtrates (1 L) containing invertase activity were concentrated through a HY200 filter (30000MWCO) using a VivaFlow 50 system (Vivascience). The concentrated fractions (50 ml) were applied to a DEAE-Sephacel chromatography column (10 ml) equilibrated with 20 mM HCl-Tris pH7 (buffer A). The proteins were eluted with a 0 to 0.5 M NaCl gradient at 1 ml min-1. The 0.1 M fractions (2 ml) were pooled, dialyzed in buffer A, concentrated to the desired volume by using the Microcon YM-10 (Amicon) system and stored at -70ºC. SDS-PAGE (8%) of the samples confirmed the proteins purification, and protein concentration was estimated photometrically at 280 nm (NanoDrop Spectrophotometer ND-1000). Enzyme activities of all mutants were also detected by Zymogram analysis (Figure 2) using non-denaturing gradient gels (4-15%) from BioRad, subsequently stained with 1% (w/v) 2,3,5-triphenyltetrazolium chloride (19).

Enzyme and kinetic analysis- All the enzymatic assays were done by the dinitrosalicylic acid (DNS) method adapted to a 96-well microplate scale as described previously (19). One unit (U) of activity was defined as that catalysing the formation of 1 µmol of reducing sugar per minute and ml. For kinetic analysis, velocity measurements were performed with 0.3-5.3 mg ml-

1 of enzyme in triplicate at 2.5-100 mM sucrose or nystose and 1-10 mM inulin. Reactions were performed during 20 min in 50 mM NaAc, pH 5. Curve plotting and analysis of the curves was carried out using SigmaPlot program (version 7.101). Kinetic parameters were calculated fitting the initial rate values to the Michaelis-Menten equation.

Analytic ultracentrifuge analysis- Sedimentation equilibrium experiments were performed in a Beckman Optima XL-A ultracentrifuge using a Ti50 rotor and six channel centerpieces of Epon-charcoal (optical path length 12 mm). Samples of purified SoInv in the concentration range 0.2-0.5 mg ml-1 were equilibrated against 20 mM citrate pH 4.5, 20 mM Tris pH 7, 20 mM Hepes pH 7, and 20mM Tris pH


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


6

9, and were centrifuged at 8000, 10000 and 14000 rpm at 293 K. Radial scans at 280 nm were taken at 12, 14 and 16 hours. The three scans were identical (equilibrium conditions were reached). The weight-average molecular mass (Mw) of SoInv was determined by using the program EQASSOC with the partial specific volume of SoInv set to 0.71 at 293 K as calculated from its amino acid composition, and referred to that reported for the monomer, 72 kDa (23).

RESULTS AND DISCUSSION

Crystal structure of SoInv shows a bimodular folding- Previous attempts to crystallize the native form of SoInv expressed in S. cerevisiae failed in obtaining untwined, good quality diffracting crystals, as it was previously reported; therefore, the extracellular enzyme was directly isolated and purified from Sw. occidentalis (23). This sample gives crystals belonging to the orthorhombic P212121 space group, and producing a diffraction pattern up to 2.9Å resolution. The three-dimensional structure of the enzyme was solved by molecular replacement and refined. To improve the crystal quality, the sample was partially deglycosylated with endoglycosidase H, a treatment that yielded a monoclinic crystal form giving data to 1.9Å resolution. Experimental details and structure determination procedures are given in the Experimental section. The model of the native crystals contains six glycerol molecules from the cryoprotectant solution bound at the active site, while the deglycosylated protein crystal was soaked in the substrate nystose prior to data collection, and contains the product fructose at the active site (Figure S1 of Supplementary Material). The SoInv structure obtained from both crystals is essentially the same and, therefore, all following structural description will be based on the high resolution deglycosylated form.

As the other GH32 family enzymes structurally known, the molecule of invertase is bimodular, and folds into a catalytic five-bladed β-propeller (residues 24-356) and a C-terminal β-sandwich (residues 365-535) linked by a short 10-residues segment (Figure 3). The propeller is assembled from five blades (named I to V) each composed of four antiparallel β-strands (A to D from the axis towards the outside of the propeller), connected by turns in a classical “W” pattern. This domain

belongs to the β-furanosidase superfamily (37), which contains four other members: GH43 arabinase, GH62 arabinofuranosidase (with no 3-D structure known up to now), GH68 levansucrase, and a group of hypothetical proteins some of which also predicted to be glycosyl hydrolases. Interestingly, this was the first glycosyl hydrolase superfamily shown to include enzymes with both inversion (GH43) and retention (GH32 and GH68) mechanism of action (37). Furthermore, this clan shares the five-bladed β-propeller fold with tachylectin II, which was the first described protein showing this folding (38), and human apyrase (39).

The second domain of invertase is composed of two antiparallel six-stranded β-sheets folded into a β-sandwich topology. This domain is the region most variable in sequence along GH32 family (sequence identity of SoInv as low as 10-12 % with enzymes from bacteria or plants) and belongs to the wide Concanavalin A-like lectins/glucanases superfamily, to which it shares similar levels of identity.

Five over the eight predicted glycosylation sites were visible in the electron density and were assigned to Asn72, Asn119, Asn219, Asn334 and Asn394. Four of them are located in the catalytic domain linked to blades I, II, III and V, and one is at the β-sandwich domain. They are all at the surface of SoInv and far from the active site. A different glycosylation pattern is possibly found in the enzyme expressed in S. cerevisiae, and this is likely preventing proper crystal growth as it was previously reported (23). In this regard, a single extracellular protein band of about 95 kDa was detected in SDS-PAGE analysis when SoInv was expressed and purified from S. cerevisiae cells, 20 kDa higher than the wild-type protein expressed in Sw. occidentalis.

The loops that confer specificity to enzymes within GH32 family- As explained before, the 3D structure of four other members of the GH32 family have been reported: AaEI (2), TmInv (3), CiFEH (4) and AtInv (5). These structures are good representatives of several of the diverse enzymatic functionalities found along GH32 family, and also correspond to different organisms. SoInv shares the highest identity with the fungal enzyme, 35 %, while only 25 and 23 % identity is found with respect to enzymes from bacteria and


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


7

plant. However, the sequence conservation within the family is not equally distributed along the polypeptidic chain, the identity being higher in the catalytic domain (39 and 24 % in the catalytic and the β-sandwich domain, in the case of SoInv as compared to AaEI). The Cα atoms of AaEI, TmInv and CiFEH structures superimposed onto SoInv with RMSD of 1.9, 2.1, and 2.6 Å, respectively (based on the overlap of 468, 408, and 449 atoms).

Structural superimposition of these enzymes onto SoInv is shown in Figure 4a (AtInv is highly similar to CiFEH and has been omitted for clarity). In spite of the moderate sequence identity along the family, the core of the propeller is very similar in shape, with blade I being the most, and blade IV the least conserved regions. Moreover, an insertion is observed in strand D4 (Figures 4 and 5) creating a significant disruption of blade IV in AaEI and CiFEH that is not observed in the enzymes from bacteria and yeast, although this is the least regular sheet in the propeller. It is worth noting that this region is directly involved in oligomerization of SoInv, as it will be explained below.

Furthermore, the analysis of the largest differences observed in the surroundings of the β-propeller centre enables the identification of the determinants of substrate binding specificity. As it is shown in Figure 4, the topology of this folding leads to the catalytic active site being shaped by the loops connecting the different blades of the propeller (L1 to L4) and the turns linking strands B to C within each blade (TI to TV). Structural alignment of the sequences with known structure greatly helps in delimiting the segments involved in shaping these loops (Figure 5). As it can be seen in the figure, with the exception of TI and L4 these loops are highly variable in length and sequence, with those in AaEI being the longest and those in SoInv the shortest, and contour a different environment to the catalytic pocket within the family (Figure 4). Interestingly, loop Tv is shaping the interface with the β-sandwich domain and the different conformation presented by this loop in the plant enzymes produces a wide cleft than has been postulated to be the inulin binding-site (4). On the contrary, this loop protrudes into the active site in the other enzymes and contains a tryptophan (Trp314 in SoInv), which is likely involved in substrate recognition. Moreover, loop TIV contains a long insertion in SoInv and AaEI

that interacts with the β-sandwich domain to a higher extent, consequently making a deeper pocket in the yeast and fungal enzymes. All the relevant residues found at the active site of SoInv are located in these loops as will be discussed later.

A last remarkable structural feature of SoInv is an extended ten-residues loop linking strands C5 to D5 in blade V of the propeller (Tyr339-Leu349) located at the opposite side of the active site, which is longer than in the other enzymes (figure 4a) and is involved in the oligomerization of the enzyme, as it will be seen below.

SoInv is a dimeric enzyme- Two units associate in a “butterfly” shape, to form a tight dimer related by non-crystallographic two-fold symmetry, as it is shown in Figure 3. The total surface area for this dimer is 36680 Å2, with a buried surface of 3990 Å2 (Pisa server, 40). 60 % of the contacts shorter than 4 Å in this interface are produced by interaction of the two catalytic domains, mainly through blade IV from each unit. This region contains the only two hydrogen bonds linking the main chain of both subunits within the dimer (Table 3), Gly223-O,N from L3 in one unit being linked to S281-O and T283-N, from strand D4 of the other. In addition, the above mentioned extended loop Tyr339-Leu349 from one subunit, significantly longer in SoInv as commented before, makes a large number of contacts with L3 and also with TIII, from the other subunit, and interestingly all these contacts arise at the active site surface as it is shown in Figure 6. Furthermore, the catalytic pocket of one monomer is surrounded by loops from the β-sandwich domain of the other, and so, 16 % of the total contacts within the dimer interface arise from interaction between these two domains, which occurs essentially through TV. There are only two hydrogen bonds in this region, one in this TV through Trp314 main-chain, and the other from Asn227 located in loop L3. However, it is interesting to note that these interactions participate in a net of polar interactions linking residues from the different domains in a fix conformation that stabilizes the interface and make the ground of the active site cavity within the dimer (Figure 6). As Figure 5 shows, all the residues of the catalytic domain participating in polar interactions or short contacts to the other


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


8

subunit within the dimer are variable along GH32 of different sources.

The rest of the interface is made up of direct contact between both β-sandwich domains, as it is seen in Figure 3b. It has been previously proposed that this supplementary domain of yeast invertase might play the role of a carbohydrate recognition domain involved in the higher oligomerization formation (3). As we have seen before, the SoInv structure reveals additional functions for this domain but, even though, the arrangement in which both domains are found in SoInv dimer suggests that such a role could be cooperatively performed by them.

Previous work on S. cerevisiae invertase (ScInv) has reported different oligomerization states of the internal isoform at different pH´s, the enzyme being a monomer at pH 9.4, a dimer at pH 8.3 and an apparent octamer at pH 4.9 (41). It has also been reported that external ScInv exists as a dimer that self-associates into higher aggregates in a proportion that vary with pH, time and concentration of the enzyme (11). As we have previously observed (23), SoInv is a dimer at neutral pH, but to further investigate the oligomeric state of SoInv at different conditions, a series of analytical ultracentrifugation experiments have been performed using buffers at different pH values, i.e. 4.5, 7, and 9, always leading to a molecular mass corresponding to the dimer (Figure S2, Supplementary Material). These results indicate that oligomerization of SoInv is apparently not pH dependent. Moreover, higher aggregates have not been detected in SoInv. The polypeptide sequence of SoInv is only two residues longer than ScInv, both sequences being 66 % identical. Even though, an analysis of the alignment between both sequences (not shown) points to the conclusion that only half of the hydrogen bonds found in SoInv could be present in a putative ScInv dimer and, therefore, this dimer might present some structural differences which would lead to a different higher-aggregation pattern than the one observed in SoInv.

The active site is made-up from both subunits- SoInv presents a narrow pocket 12 Å deep and 11 Å wide, typical for an exo-enzyme and similar to that found in AaEI. In the bacterial and plant enzymes, the shorter TIV loop above mentioned makes the interface between the catalytic and the β-sandwich domains more

opened to the solvent, leaving a wider gate to the active-site (Figure 4). Furthermore, the previously reported analysis on the TmInv-raffinose complex

(8) showed that the terminal α-galactose unit is located in the active-site pocket close to the protein surface, suggesting that longer substrates would situate the additional units dangling out into the solvent with no links to the enzyme. However, oligomerization of SoInv situates the β-sandwich domain of the other subunit facing this pocket (see Figure 3c) and makes a straight cavity 25 Å deep, which is accessible to the solvent by a slot placed between both subunits with maximum width of 18 Å. Therefore, additional subsites may be defined in this groove and SoInv seems able to recognize oligosaccharide units distal from the scissile bond, as it will be shown below.

Figure 7a shows a close-view of the active site pocket of SoInv showing the six glycerol molecules found in the native crystals, and the position for the substrates, inferred from structural superimposition of the TmInv-raffinose (8) and CiEI-1kestose complexes (7) onto the SoInv coordinates. As it can be observed, the substrates are located in putative subsites close to three of the glycerol moieties that, as it is generally accepted, are considered a good indicator of sugar-binding sites. This suggests that the other glycerol molecules could reveal additional binding sub-sites able to recognize longer substrates. It is remarkable that these glycerol molecules are interacting with the other subunit of the dimer.

Failure in crystallizing the recombinant form of SoInv prevents the genetic replacement of the catalytic residue in order to obtain crystals from the inactivated enzyme-substrates complexes. To overcome this impediment, we tried an alternative strategy that has been proposed for the crystallographic analysis of glycosidases exploiting the potential use of sugars as a cryoprotectant substituting glycerol (42), and which yielded successful results to us in previous studies (43). Following this procedure, we soaked the deglycosylated crystals for a short time within cryo-solutions containing as high as possible concentrations of nystose and frutosyl-nystose, which should saturate the active site of all protein molecules and are subsequently immobilized by flash cryo-cooling in a nitrogen stream. As we observed some ice-formation, a small amount of PEG400 was also added to the cryo-protectant


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


9

solution. However, after trying different soaking times we were not able to avoid the substrates to be processed, and only the product fructose was bound at the active site.

Automatic docking of substrates suggests relevant details of the active site- In view of the impossibility of getting crystals from the complexes, the binding of long substrates as the tetrasaccharide nystose and the polymeric inulin was investigated by docking analysis. The first trials of automatic docking of the substrates into the SoInv active site, as obtained in the crystal structure, failed in producing productive complexes, as the ligands were positioned with the fructose of the non-reducing end out from the catalytic -1 subsite. An inspection of the active site of SoInv showed a different orientation of Glu230 and Tyr293 side-chains to that found in the above mentioned reported complexes from GH32 family. Therefore, these two residues were modelled in the same conformation to that experimentally observed in the complexes, this change leading to the nystose molecule being successfully docked into the SoInv active site in a biologically significant position. In the case of the polymer inulin, only an additional change in the Arg178 side-chain allowed the substrate to enter into the active site.

Using nystose as a ligand, the lowest total docking energy of -11.9 kcal/mol was obtained for a position (yellow in Figure 7c) in the highest ranked cluster, which contained 24 out of 50 runs and had a mean docking energy of -9.0 kcal/mol. The second ranked cluster contains only 3 positions presenting a less-extended oligosaccharide chain (not shown) with mean docking energy of –9.7 kcal/mol. Finally, the third-ranked cluster (with mean binding energy of -7.58 kcal/mol) accounts for 20 conformations that situate the non-reducing fructose ring significantly shifted away from the -1 binding site, and were not considered as they are not biologically productive conformations. In the case of the polymeric inulin, a segment containing twelve fructose units was docked into a position with the lowest docking energy of -6.6 kcal/mol (Figure 7d) included within the highest ranked cluster that contains 37 out of 50 runs. As this model displayed the terminal fructose of inulin slightly flipped with respect to that observed in the SoInv-fructose complex, this position was further improved by

manual docking followed by local optimization (Figure 7d).

In summary, docking analysis of the substrates nystose and inulin, into the SoInv active-site locates these ligands in energetically favourable positions, which situate the non-reducing end in the fructose site observed in the SoInv-fructose complex, and the distal oligosaccharide units in the positions occupied by glycerol molecules in the native crystals. Docking of these ligands involves a rearrangement in some residues of the SoInv active site, in particular Arg178, Glu230 and Tyr293, which therefore must be directly implicated in substrate binding. The modelled complexes suggest that nystose and inulin chains are directly interacting to residues from both subunits, and this is a unique feature of SoInv. Furthermore, the analysis of its molecular surface reveals that the dimer structure delineates an active-site channel that is perfectly adapted to accommodate the polymeric chain of inulin, as it is illustrated in Figure 8 showing the SoInv-inulin complex obtained by docking.

Substrate specificity is elucidated by kinetic analysis of mutants- An inspection of the SoInv active-site in the putative complexes points to the residues that may be involved in recognizing substrates of different length. Figure 7b shows the position of the substrate sucrose inferred from the structural superposition of the AtInv-suc complex (6) into the SoInv coordinates, while figures 7c and 7d show the nystose and inulin positions obtained by docking. As it can be observed, the pocket is surrounded by aromatic residues, i.e. Trp76, Phe110, Tyr293 and Trp314, which are strictly conserved along the GH32 family (see Figure 3), as is the Asp50/Glu230 pair that could be assigned as the catalytic residues. The residues Arg178 and Asp179 are also conserved and belong to the well-known RDP motif involved in substrate binding. All these residues must play a role in substrate recognition shared with the other GH32 enzymes. Therefore, we investigated the role of Asn142, Gln176, Gln228 and Asn254 in the enzymatic activity of SoInv, as these residues are not conserved and consequently must be responsible of the differences in specificity encountered along the family. The structure of the SoInv dimer interface (Figure 6) points to Gln435 and Tyr462 as possible candidates involved in substrate recognition and these residues were also


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


10

investigated by mutagenesis experiments. In addition, Ser281 involved in one of the two main-chain hydrogen bonds linking both subunits (Table 3) was also mutated to a bulky residue with the aim of investigating the possible existence of an active monomer, or at least, how a distortion in the dimer could affect the enzymatic activity.

Table 4 gives the mutants we have produced and their corresponding kinetic parameters. The expected absent activity of the mutants D50A and E230A confirm the catalytic role of these residues. Furthermore, the experimental results allow grouping the other mutants into four general groups. First of all, the Q228V and S281I mutants exhibit a striking large reduction in the catalytic efficiency (Kcat/Km) on sucrose and inulin, which is even larger when measured against nystose (at least a 100 fold decrease). Gln228 is a residue located at the highly variable L3, the equivalent TmInv Glu188 being previously described to link the glucose unit in the TmInv-raffinose complex (8). Indeed, our docking analysis of SoInv shows that Gln228 may be directly involved in binding the glucose at the reducing end of nystose through hydrogen bonds (Figure 7c), and also the third fructose unit of inulin (Figure 7d), therefore a decrease of catalytic efficiency against long substrates could be expected. However, there is also a five-fold reduction in activity against sucrose that is not explained by the putative SoInv-sucrose complex (Figure 7b), as Gln228 would not be interacting to the substrate in this case. Nevertheless, it is interesting to note that this residue is next to Asn227, involved in a network of polar links to the other molecule, and the Q228V substitution (a Val is found in AaEI) might alter the atomic interactions at the interface and, consequently, the active-site pocket leading to a less efficient enzyme. The key role of the dimer in the enzymatic activity is further supported by the fact that the S282I substitution, at the dimer interface and far from the active site, yields similar largely reduced kinetic parameters most probably by producing a somehow distorted dimer (this mutant still migrates as a dimer in a native electrophoresis analysis; see the Experimental section, and Figure 2).

A second group is formed by the mutants Q435A and Y462A, both leading to a three-fold decrease in catalytic efficiency against inulin, and a slighter effect against the other two substrates,

except in the Tyr462 activity vs. nystose, with lower Kcat and reduced affinity leading to a large twelve-fold decrease in the overall catalytic efficiency. Both residues are located at the β-sandwich domain of molecule B and participate in the polar interactions network that shapes the interface and the active-site pocket (Figure 6), therefore their substitution must be affecting the interface and the efficient positioning of the oligosaccharides within the catalytic pocket. As it is deduced from the complexes shown in Figures 7c and 7d, Gln435 could be hydrogen bonded to nystose and inulin, while Tyr462 might participate in nystose binding but seems too far from the inulin chain, and none of these residues participate in sucrose binding. This fact reinforces the idea that even a small change in the dimer interface have a deleterious effect in activity and the concerted action of both subunits determines the catalytic efficiency of SoInv.

The third group is composed of the N142Y and N254A mutants, which have a reduced catalytic efficiency most apparent when the activity is assayed against nystose. Asn142, located at the end of strand B2, is a Tyr in the fungal and bacterial enzymes and has been described to bind the terminal galactose moiety of raffinose, through a water molecule, in the TmInv-raffinose complex (8). As it can be seen in Figure 7, direct interaction of Asn142 to the substrates is not deduced from none of the complexes, but interaction through solvent molecules can not been discarded. Moreover, SoInv crystal structure shows that the side-chain of Asn142 is hydrogen bonded to Glu107, from loop L1, and Gln147, located at strand C2, and its replacement by a Tyr probably rearranges the conformation of the active site residues lowering the affinity for the substrates (Table 4). Unexpectedly, this lower affinity is compensated by a higher Kcat, when it was measured against sucrose or inulin. On the other hand, Asn254 from the variable loop TIV is located in the ground of the pocket and its side-chain could be hydrogen bonded to the fructose unit at subsite +2 in the putative SoInv-nystose complex (Figure 7c) and, accordingly, the substitution N254A decreases four-fold the affinity for nystose. No interaction is observed in the other complexes. It is noteworthy that the equivalent TmInv Thr208 has been previously described to interact also to the glucose unit of the TmInv-raffinose complex.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


11

However, our results show no significant influence in the activity against sucrose or inulin upon mutation and, therefore, this residue possibly plays a role on binding medium-size substrates.

Finally, we have studied the role of Gln176, located at the end of L2 and preceding the conserved RDP motif. This residue is linked to the essential Gln228 and, more significant, to Arg178 from this RDP motif that as explained before, was necessarily shifted to succeed in properly docking inulin into the SoInv active-site. However, the replacement of Gln176 by either Glu or Ser does not reveal any clear influence on SoInv catalytic efficiency, as it is slightly increased against nystose but somewhat reduced against the other two substrates in the Q176E mutant, but curiously shows the opposite effect in the Q176S mutant. Although the moderate magnitude of the changes in catalytic efficiency points to the fact that this residue may not be critical, the deviations observed in the Kcat and Km values of the Gln176 mutant suggest that this position should be investigated through the analysis of further mutants, to determine the precise role of this residue in the activity of SoInv.

In summary, docking and mutagenesis analysis of SoInv reveal that substrates longer than sucrose might be recognized by hydrogen links to residues Gln228 and Asn254, from one subunit, and Gln435 and Tyr462, from the other, but the amino acid replacements that have a deleterious effect in the catalytic activity, i.e. Q228V and S281I, seem to be related also with some change in the interface within the dimer or, at least, in the conformation of the active-site cavity, supporting that oligomerization is key in delineating the SoInv functionality.

CONCLUSIONS

Fructans and related compounds play a key role in metabolism and energy exchange, and may be employed as storage polymers in organisms as plants. Several microorganisms use them as regular energy and carbon source by the expression of hydrolytic enzymes. In this study, we have described the structure of dimeric Scwanniomyces occidentalis invertase, which is an example of how these proteins have adapted for the hydrolysis of fructans, in many yeasts. The crystal structure of SoInv subunit shows a

bimodular arrangement similar to that previously described for other GH32 enzymes. Detailed comparison of the catalytic domain to other known structures help in delimitating the regions that are essential in determining substrate specificity along the family. However, the active-site of SoInv is exceptional, as it is built-up by both subunits, and presents additional substrate binding sites to those described for known enzymes. This structure is an interesting example of how oligomerization can be a molecular mechanism to fine-tuning the functionality within a family of homologous enzymes. What is more, the supplementary β-sandwich domain was previously postulated to play a role as ancillary carbohydrate-recognition domain, owing to its lectin-like fold and to what is observed in other glycosyl hydrolases enzymes. However, the SoInv structure reveals that this domain is involved in contouring the active-site cleft and also plays a direct role in binding of the substrates, both, medium-size oligosaccharides and the polymeric chain of inulin. This is a unique feature of the structure here presented that can help in understanding the protein-carbohydrate recognition molecular mechanisms implicated in modularity, a pivotal property within the glycosyl hydrolases enzymes crucial to many biologically relevant degradative processes. The specificity of SoInv has been investigated by docking analysis of long substrates into its active-site, which points to the key role of residues from both subunits in substrate binding, and this has been supported by kinetic analysis of mutants. The replacements that presented the most deleterious effect on activity were Q228V, a residue directly involved in substrate recognition, and S281I, a residue responsible for one of the two main-chain hydrogen bonding links between both subunits, and therefore, significant in proper oligomerization. Mutation of the other identified residues, Asn142, Gln176, Asn254, from the catalytic domain, and Gln435 and Tyr462, from the β-sandwich domain of the other subunit, were also shown to have effect on substrate binding or catalytic rate, confirming their interactions with the substrate. Consequently, these results assign a direct catalytic role to the supplementary β-sandwich domain of SoInv, and this is the first time that such a role has been observed within GH32 enzymes.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


12


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


13

REFERENCES

1. Coutinho, P.M., and Henrissat, B. (1999). Carbohydrate-active enzymes: an integrated database

approach. In Recent Advances in Carbohydrate Bioengineering (Gilbert, H.J., Davies, G., Henrissat B. and Svensson B., eds.), 3-12, The Royal Society of Chemistry, Cambridge.

2. Nagem, R.A.P., Rojas, A.L., Golubev, A.M., Korneeva, O.S., Eneyskaya, E.V., Kulmisnkaya, A.A., Neustroev, K.N., and Polikarpov, I. (2004). J. Mol. Biol. 334, 471-480.

3. Alberto, F., Bignon, C., Sulzenbacher, G., Henrisat, B., and Czjzek, M. (2004). J. Biol. Chem. 279, 18903-18910.

4. Verhaest , M., Van den Ende, W., Le Roy, K., De Ranter, C., Van Laere, A., and Rabijns, A. (2005). Plant J. 41, 400-411.

5. Verhaest, M., Lammens, W., Le Roy, K., De Coninck, B., De Ranter, C.J., Van Laere, A., Van den Ende, W., and Rabijns, A. (2006). Acta Crystallog. D62, 1555-1563.

6. Mátrai, J., Lammens, W., Jonckheer, A., Le Roy, K., Rabijns, A., Van den Ende, W., and Maeyer, M. (2008). Proteins: Struct. Funct. Bioinf. 71, 552-564.

7. Verhaest, M., Laemmens, W., Le Roy, K., De Ranter, C.J., Van Laere, A., Rabijns, A., and Van den Ende, W. (2006). New Phytolog. 174, 90-100.

8. Alberto, F., Jordi, E., Henrissat, B., and Czjzek, M. (2006). Biochem. J. 395, 457-462. 9. Davies, G, J., Wilson, K.S., and Henrissat, B. (1997). Biochem. J. 321, 557–559. 10. Tammi, M., Ballou, L., Taylor, A., and Ballou, C.E. (1987). J. Biol. Chem. 262, 4395-4401. 11. Reddy, A.V., Mac Coll, R., and Maley, R. (1990). Biochemistry 29, 2482-2487. 12. Abarca, D., Fernández-Lobato, M., Claros, M.G., and Jiménez, A. (1989). FEBS Lett, 255, 455-

459. 13. Abarca, D., Fernández-Lobato, M., del Pozo, L., and Jiménez, A. (1991). FEBS Lett. 279, 41-44. 14. Klein, R.D., Deibel, M.R. Jr, Sarcich, J.L., Zurcher-Neely, H.A., Reardon, I.M., and Heinrikson,

R.L. (1989). Prep. Biochem. 19, 293-319. 15. Dohmen, J.R., Strasser, A.W.M., Dahlems, U.M., and Hollemberg, C.P. (1990). Gene 95, 111-

121. 16. Deibel, M.R. Jr, Hiebsch, R.R., and Klein, R.D. (1988). Prep. Biochem. 18, 77-120. 17. Wang, T.T., Lee, C.F., and Lee, B.H. (1999). Crit. Rev. Biotechnol. 19, 113-143. 18. Yánez, E., Carmona, T.A., Tiemblo, M., Jiménez, A., and Fernández-Lobato, M. (1998).

Biochem. J. 329, 65-71. 19. Álvaro-Benito, M., Abreu, M., Fernández-Arrojo, L., Plou, F.J., Jiménez-Barbero, J., Ballesteros,

A., Polaina, J., and Fernández-Lobato, M. (2007). J. Biotechnol. 1, 75-81. 20. Sangeetha, P.T., Ramesh, M.N. and Prapulla, S.G. (2005). Process. Biochem. 40, 1085-1088. 21. Ghazi, I., Fernandez-Arrojo, L., Garcia-Arellano, H., Plou, F. J., and Ballesteros, A. (2007). J.

Biotechnol. 128, 204-211. 22. Pons, T., Naumoff, D.G., Martínez-Fleites, C., and Hernández, L. (2004). Proteins: Struct.,

Funct. Bioinf. 54, 424-432. 23. Polo, A., Álvaro-Benito, M., Fernández-Lobato, M., and Sanz-Aparicio, J. (2009). Acta

Crystallogr. F65, 1162-1165. 24. Leslie, A.G.W. (1992). Molecular data processing. In Crystallographic Computing 5: From

Chemistry to Biology (Moras, D., Podjarny, A.D. and Thierri, J.C., eds), 39-50, Oxford University Press, Oxford, UK.

25. Collaborative Computational Project Number 4 (1994). The CCP4 suite: programs for protein crystallography. Acta Crystallog. D50, 760-763.

26. Vagin, A., and Teplyakov, A. (1997). J. Appl. Crystallogr. 30, 1022-1025. 27. Murshudov, G.N., Vagin, A.A., and Dodson, E.J. (1997). Acta Crystallog. D53, 240-255. 28. Jones, T.A., Zou, J.Y., Cowan, S.W., and Kjeldgaard, M. (1991). Acta Crystallog. A47, 110-119.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


14

29. Laskowsky, R.A., MacArthur, M.W., Moss, D.S., and Thornton, J.M. (1993). J. Appl. Crystallog. 26, 283-291.

30. Davis, I. W., Leaver-Fay, A., Chen, V.B., Block, J. N., Kapral, G.J., Wang, X., Murray, L. W., Arendall, W.B., Snoeyink, J., Richardson, J.S. and Richardson D.C. (2007) Nuc. Ac. Res. 35 Web Server issue, W375-W383

31. DeLano, WL. (2002). The PyMOL Molecular Graphics System. [http://pymol.sourceforge.net/], DeLano Scientific, San Carlos, CA, USA.

32. Okuyama, K., Noguchi, K., Saitoh, M., Ohno, S., Fujii, S., Tsukada, M., Takeda, H., and Hidano, T. (1993). Bull. Chem. Soc. Japan. 66, 374-379.

33. Morris, G.M., Huey, R., Lindstrom, W., Sanner, M.F., Belew, R.K., Goodsell, D.S., and Olson, A.J. (2009). J. Comput. Chem., 30, 2785-2791.

34. André, I., Mazeau, K., Putaux W., Winter, W.T., Taravel, F.R., and Chanzy, H. (1996). Macromolecules 29, 4626–4635.

35. Zheng. L., Baumann, U., and Reymond, J.L. (2004). Nuc. Ac. Res. 32, e115. 36. Burke, D., Dawson, D., and Stearns, T. (2000). Methods in yeast genetics. A Cold Spring Harbor

Laboratory Course Manual. 37. Naumoff, D.G. (2001). Proteins 42, 66-76. 38. Beisel, H.G., Kawabata, S., Iwanaga, S., Huber, R., and Bode, W. (1999). Embo J. 18, 2313-

2322. 39. Dai, J., Liu, Y., Deng, T., Smith, T.M., and Lu, M. (2004). Cell 116, 649-659. 40. Krissinel, E., and Henrick, K. (2007). J. Mol. Biol. 372, 774-797. 41. William, R.S., Trumbly, R.J., MacColl, R., Trimble, R.B., and Maley, F. (1985). J. Biol. Chem.

260, 13334-13341. 42. Schmidt, A., Gübitz, G.M., and Kratky, C. (1999). Biochemistry 38, 2403-2412. 43. Isorna, P., Polaina, J., Latorre-García, L., Cañada, F.J., González, B., and Sanz-Aparicio, J.

(2007). J. Mol. Biol. 371, 1204-1218. 44. Holm, L. (1998). Curr. Op. Struct. Biol. 8, 372-379. 45. Barton, G. J. (1993). Protein Eng. 6, 37–40.

FOOTNOTES

Work has been supported by the grants: BIO2007-67708-C04-04, -03 and BIO2004-67708-C04-04, -03 (Ministerio de Educación y Ciencia, Spain), and by an institutional grant from the Fundación Ramón Areces to the Centro de Biología Molecular Severo Ochoa. M.A.B. was supported by a Spanish Comunidad de Madrid program. We also thank the staff of the European Synchrotron Radiation source for provision of beam time and for technical assistance at the beamlines ID14-1, ID14-4, ID23-1 and ID23-2.

The abbreviations used are: GH32, Family 32 glycoside hydrolases; AaEI, exo-inulinase from Aspergillus awamori; TmInv, invertase from Thermotoga maritima; CiFEH, fructan 1-exohydrolase IIa from Cichorium intybus; AtInv, cell-wall invertase 1 from Arabidopsis thaliana; FOS, fructooligosaccharides; SoInv, invertase from Schwanniomyces occidentalis; RMSD, root-mean-square deviation; ScInv, invertase from Saccharomyces cerevisiae; NCS, non-crystallographic symmetry


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


15

FIGURE LEGENDS

Figure 1. Chemical structure of the general substrates hydrolized by fructofuranosidases from GH32 family. (The average polymerization degree of the inulin used in this study was n=35). Figure 2. Gel analysis of the SoInv mutants. Cultures filtrates (500 ml) of the S. cerevisiae transformants that expressed the wild type or the mutant SoInv proteins (indicated on the top of the image) were processed for protein purification as referred in the Experimental section. Purified proteins (5-20 µg) were subjected to PAGE analysis and the enzyme activities were revealed in situ. Numbers at the left indicate the positions of the BSA molecular masses used as a control (in kDa). Figure 3. The structure of SoInv. a) Ribbon diagram of the monomeric unit of SoInv showing the bimodular arrangement, the cataltytic β-propeller domain coloured according to its five blades (I to V) and the C-terminal β-sandwich domain coloured in red. A fructose bound at the active site of the deglycosylated form crystals is shown in spheres representation and the glycosylation moieties are represented as sticks. b) Two SoInv units (blue and orange) associate to form a tight dimer by many polar and hydrophobic interactions between the four domains within the dimer (shaded differently). c) Molecular surface of SoInv dimer showing one of the two active site pockets, which is surrounded by the β-sandwich domain from the other monomer. Figure 4. The active-site shape of the GH32 family. a) Superimposition of the structures of SoInv (blue), AaEI (violet), TmInv (brown) and CiFEH (green), showing that the biggest differences of the catalytic domain concentrate in the highly variable loops connecting the different blades of the propeller (L1 to L4) and the turns linking strands B to C within each blade (TI to TV). A long insertion in a SoInv loop located in blade V, involved in dimer formation, is pointed with an arrow. Molecular surface of the SoInv-fructose (b), AaEI-fructose (c), TmInv-raffinose (d) and CiEI-1kestose (e) complexes highlighting the above mentioned loops that shape the active-site. Loops Tiv and Tv, commented in the text, are marked in SoInv surface. The bound ligands are represented in a spheres model. Figure 5. Structural alignment of known GH32 catalytic domain. SoInv superimposed to AaEI (PDBcode 1y4w), TmInv (1uyp) and CiFEH (1st8), as given by DALI server (44). The black squares indicate amino acid similarity as calculated by the program ALSCRIPT (45). Secondary structure elements for SoInv as suggested by PROCHECK (29) are shown above the amino acid sequences. A, B, C and D indicate the β-strands, from the axis towards the outside of the propeller, within each blade. L1-L4 connecting the different blades of the propeller, and TI-TV linking strands B to C within each blade, are marked with an orange bar. Catalytic residues are highlighted with a black asterisk. Residues of SoInv involved in hydrophobic (angle) and polar (asterisk) interactions within the dimer interface are marked in green. Residues of SoInv involved in substrate recognition and mutated in this work are highlighted in brown. Figure 6. Close view of the interface at the active site. A zoom of the SoInv active-site pocket showing three of the six glycerol molecules bound in the native crystals, which occupy subsites -1, +1, +2. Gln199 (TIII), Asn227 (L3) and Trp314 and Asp318 (TV) from one molecule form a network of polar interactions with the loop Tyr339-Leu349 and the β-sandwich domain from the other subunit at the dimer interface, which built-up the active-site pocket. The molecular surface of a subunit is shown, while the other is in a ribbon representation for clarity (colour code as in Figure 3). The glycerol molecules are shown as spheres. Figure 7. Substrate specificity of SoInv. The active site of the SoInv showing both subunits in cyan and beige. a) The six glycerol molecules bound at the active site in the native crystals of SoInv and the putative position of 1-kestose (pink) and raffinose (green) inferred from structural superimposition of SoInv coordinates onto CiEI-1kestose (7) and TmInv-raffinose (8) complexes. The putative location of the


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


16

substrates sucrose (b) inferred from structural superposition of SoInv onto the AtInv-sucrose complex (6), and the positions of nystose (c) and inulin (d), as obtained from docking analysis, are shown as yellow and red sticks. Only six fructose units are shown in the inulin chain. The fructose found in the deglycosylated protein crystals and three of the glycerol molecules found in the native crystals are shown as white and red sticks. The residues that are suggested to interact with the substrates are shown, the catalytic residues being squared. The residues that are variable along GH32 family and that have been mutated are marked with a brown label. Figure 8. The binding of the polymeric substrate. Molecular surface of the free SoInv dimer (a) showing the electrostatic distribution, acidic regions in red and basic in blue, and the inulin positioned in the binding cleft by automated docking (b). A chain containing twelve fructose units has been used as a ligand. Several polar residues surround the entrance of the cavity, which is 25 Å deep and is accessible from the solvent by a slot of a maximum 18 Å width.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


17

Table 1. X-ray data collection and structure refinement statistics

Crystal Native SoInv

Deglycosylated SoInv-Fru

A. Data collection Unit cell dimensions (Å) 105.78, 119.49,

137,68 60.87,

92.27, 116.28 β=104.8˚

Space group P212121 P21 Molecules in the a.u. 2 2 Solvent content (%) 67 42 Limiting resolution (Å) (Outer shell)

2.9 (2.90-2.95)

1.9 (2.01-1.90)

Unique reflections 36939 98012 Rrima 0.19 (0.54) 0.13 (0.50) Rpimb 0.08 (0.30) 0.05 (0.22) Completeness (%) 99.7 (99.8) 99.7 (99.7) Mean multiplicity 6.9 (6.7) 7.1 (7.0) Mean I/σI 9.7 (2.9) 4.3 (1.9) B. Final refinement parameters Protein atoms (non-H) 8100 8100 Solvent molecules 326 823 Ligand molecules Glycerol (12) Fructose (2) Glycosylation molecules NAG (16) NAG (8) R-factorc 0.21 0.21 Rfree 0.27 0.25 r.m.s bonds(Å)/angles(º) 0.013/1.8 0.007/1.24 Averaged B-factors (Å2) Main chain 34.6 16.4 Side-chain 34.7 17.5 Ligand 58.9 27.6

Solvent 31.5 33.2

Ramatchandran Plot (30) Favoured (%) Outliers (%)

97.1 1.5

98.3 0.5

PDB code 3KF5 3KF3 a Rrim = ∑ [Ν/(Ν−1)]1/2 ∑ ⏐Ι (h)i − <I(h)>⏐/ ∑ ∑<I(h) > a Rpim = ∑ [1/(Ν−1)]1/2 ∑ ⏐Ι (h)i − <I(h)>⏐/ ∑ ∑<I(h) > c R-factor = ∑ ( ⏐Fobs – Fcalc ⏐) / ∑ ⏐Fobs⏐ (Rfree is equivalent to R factor for a randomly selected 5% subset of reflections not used in structure refinement)


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


18

Table 2. Oligonucleotides employed for mutagenesis

orientation SEQUENCE F TGGATGAATGCTCCGAATGGTCTATTCTACGATAAA

D50A R ATTCGGAGCATTCATCCATCCTTTTTCCGGAGTAAA F CCAACTATATACCAGATTTACAAACCCAAGACATTGC

N142Y R GGTATATAGTTGGTATAAATGGCAAGAATTCTTTGGTTTGG F CTCAAACTCTTTCCGTGATCCAAAAGTTTTCTGGC

Q176S R CACGGAAAGAGTTTGAGGAGACATCAATCACAGG F CTCAAACGAATTCCGTGATCCAAAAGTTTTCTGGC

Q176E R CACGGAATTCGTTTGAGGAGACATCAATCACAGG F TACGGAAATGTCTATGAATGTCCAGGTTTAATTGAA

Q228V R ACATTCATAGACATTTCCGTAATAACCAGAAGAAAA F AATCAGTATGCTTGTCCAGGTTTAATTGAAGTTCCTATTGAGAAT

E230A R ACCTGGACAAGCATACTGATTTCCGTAATAACCAGAAGAAAAATT F CAATTGCTCCTTTATCGCCTTTGGGTGGTTCG

N254A R CCCGGAGCAATTGCTAAAAACATAACCCACTTTG F CATCCGCTTCATCGTTTTATATCGATCGTCATATTCC

Q435A R CGATGAAGCGGATGAATCAAAACCAATTTTAATGGAATC F GCTGCAGCTCTTGAACCTTTAGACTACGATCAAGAC

Y462A R GTTCAAGAGCTGCAGCCAACTTATCAGTAAAGAATTGC F AGATGATATCCAAACTAGATTTGTTTGTTGATATTGGAAAAG

S281I R CTAGTTTGGATATGATCTGGAACAAACTGGAAGCCG

Forward and reverse sequences including the mutations in bold letters


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


19

Table 3. Hydrogen bonds in the dimer interface

Molecule A

Molecule B Dist. (Å)

c.d. c.d. GLN199 (NE2) ASN343 (OD1) 3.20 GLN199 (O ) ASN343 (ND2) 2.99 GLN199 (O ) THR346 (OG1) 2.51 SER221 (O ) SER281 (OG ) 3.25 SER222 (OG ) SER281 (O ) 3.11 SER222 (OG ) SER281 (OG ) 2.50 GLY223 (N ) SER281 (O ) 3.22 ASN227 (O ) ASN343 (ND2) 3.29 THR283 (N ) GLY223 (O ) 3.11 THR283 (OG1) THR283 (OG1) 2.36

c.d. β.d. ASN227 (OD1) TYR462 (OH ) 3.26 TRP314 (O ) GLN435 (NE2) 3.82

β.d. β.d. ARG451 (NE ) SER434 (OG ) 3.18 LYS452 (O ) LYS458 (NZ ) 3.45 GLN453 (NE2) TYR439 (OH ) 3.30 GLN453 (NE2) THR409 (OG1) 2.37 PHE455 (O ) LYS458 (NZ ) 3.86 THR456 (OG1) LYS458 (O ) 3.63

c.d. SoInv catalytic domain β.d. SoInv β-sandwich domain


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


20

Table 4. Kinetic analysis of SoInv mutants

kcat values were calculated assuming a protein molecular mass of 180 kDa. The ± refers to standard errors based on the curve fitting using SigmaPlot. The mutants D50A and E230A give no activity against none of the substrates.

kcat (s-1) Km (mM) kcat/ Km (s-1·mM-1)

SoINV sucrose nystose inulin sucrose nystose inulin sucrose nystose inulin

wt 106±7 84±14 25±4 6.4±0.4 2.4±0.4 12±2 16.6 35 2.1

N142Y 262±30 87±17 68±17 29±3 8±1 60±15 9 11 1.1

Q176E 88±6 92±11 39±5 7±0.5 1.8±0.2 24±3 12.6 51 1.6

Q176S 134±14 230±29 1710±172 5±0.5 11±1 575±58 26.8 21 3

Q228V 33±2 2±0.5 3±0.5 11±0.6 9±3 47±7 3 0.2 0.06

N254A 85±11 60±8 12±2 8±1 8±1 7±1 10.6 7.5 1.7

S281I 20±3 6±1 2±0.4 13±2 15±3 44±8 1.5 0.4 0.04

Q435A 99±16 76±6 10±1 9±1 3.8±0.3 14±2 11 20 0.7

Y462A 43±6 22±3 5±0.6 7±1 8±1 9±1 6 2.7 0.5


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Figure 1


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Figure 2


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

I

IIIII

IV

V

(b)(a)

(c)

Figure 3

180%


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

V

I

II

III

IVV

I

II

III

IV

Figure 4

(a)

(b) (c)

(d) (e)

Y339-L349

TIV

TV


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

A1 B1 C1

D1 A2 B2

B3A3C2 D2

C3 D3 A4 B4

B5A5C4 D4

C5 D5

TI

L1 TII

L2

TIII

TIV

TV

L4

L3

^

^

^ ^

^^ ^*

*

^ ^^* * * *

*

*

* *

**

93

8157

63

145

109105

156

253

310

256292

358

374297333

331

264207233

167

209

199

148

N142

Q176

Q228

N254

*

S

Figure 5


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Figure 6


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Figure 7

(a)

(b) (c)

Q435

F110N142

Y293

Y462

W76

W314

N227

Q228

Q176

R178D179

D50 D50

N254

Q435

F110N142

Y293

Y462

W76

W314

N227

Q228

Q176

R178

E230

D179

N254

(d)

E230

Q435

F110N142

Y293

Y462

W76

W314N227

Q228

Q176

R178

E230

D179

N254

D50


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

D471

N401

N403

D145N175

N106

Q78

D471

N175 D145

N106

Q78

N403

N401

Figure 8

(a)

(b)


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Julia Sanz-AparicioMiguel Alvaro-Benito, Aitana Polo, Beatriz Gonzalez, Maria Fernandez-Lobato and

bindingnew oligomerization pattern and the role of its supplementary domain in substrate

invertase reveals aSchwanniomyces occidentalisStructural and kinetic analysis of

published online February 24, 2010J. Biol. Chem.

10.1074/jbc.M109.095430Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

http://www.jbc.org/content/suppl/2010/02/24/M109.095430.DC1


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M109.095430

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M109.095430v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2010/02/24/jbc.M109.095430

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2010/02/24/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2010/02/24/jbc.M109.095430

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/suppl/2010/02/24/M109.095430.DC1

http://www.jbc.org/

Sw. occidentalis invertase structure and specificity Miguel Álvaro ...

Documents

Transcript of Sw. occidentalis invertase structure and specificity Miguel Álvaro ...