Survival Defects of Cryptococcus neoformans Mutants ... · human CSF. A series of mutants that...

INFECTION AND IMMUNITY, Oct. 2010, p. 4213–4225 Vol. 78, No. 100019-9567/10/$12.00 doi:10.1128/IAI.00551-10Copyright © 2010, American Society for Microbiology. All Rights Reserved.

Survival Defects of Cryptococcus neoformans Mutants Exposed toHuman Cerebrospinal Fluid Result in Attenuated Virulence

in an Experimental Model of Meningitis�†Anthony Lee,1 Dena L. Toffaletti,2 Jennifer Tenor,1 Erik J. Soderblom,3 J. Will Thompson,3

M. Arthur Moseley,3 Michael Price,2 and John R. Perfect1,2*Department of Molecular Genetics and Microbiology,1 Department of Medicine,2 and Proteomics Core Facility,3

Duke University Medical Center, Durham, North Carolina 27710

Received 24 May 2010/Returned for modification 10 June 2010/Accepted 30 July 2010

Cryptococcus neoformans is a fungal pathogen that encounters various microenvironments during growth in themammalian host, including intracellular vacuoles, blood, and cerebrospinal fluid (CSF). Because the CSF isisolated by the blood-brain barrier, we hypothesize that CSF presents unique stresses that C. neoformans mustovercome to establish an infection. We assayed 1,201 mutants for survival defects in growth media, saline, andhuman CSF. We assessed CSF-specific mutants for (i) mutant survival in both human bronchoalveolar lavage(BAL) fluid and fetal bovine serum (FBS), (ii) survival in macrophages, and (iii) virulence using both Caenorhabditiselegans and rabbit models of cryptococcosis. Thirteen mutants exhibited significant survival defects unique to CSF.The mutations of three of these mutants were recreated in the clinical serotype A strain H99: deletions of the genesfor a cation ATPase transporter (ena1�), a putative NEDD8 ubiquitin-like protein (rub1�), and a phosphatidyl-inositol 4-kinase (pik1�). Mutant survival rates in yeast media, saline, and BAL fluid were similar to those of thewild type; however, survival in FBS was reduced but not to the levels in CSF. These mutant strains also exhibiteddecreased intracellular survival in macrophages, various degrees of virulence in nematodes, and severe attenuationof survival in a rabbit meningitis model. We analyzed the CSF by mass spectrometry for candidate compoundsresponsible for the survival defect. Our findings indicate that the genes required for C. neoformans survival in CSFex vivo are necessary for survival and infection in this unique host environment.

Cryptococcus neoformans is a basidiomycete fungal pathogenthat frequently invades the central nervous system, causingmeningoencephalitis in severely immunocompromised pa-tients. Among these patients, such as those with HIV or solid-organ transplants, cryptococcosis results in one of the largestburdens of mortality and morbidity (10). There are now over 1million cases of cryptococcosis worldwide, with estimateddeaths of 700,000 per year (38). However, recent outbreaks ofcryptococcosis by a newly identified genotype of Cryptococcusgattii (a sister species of C. neoformans) in the Pacific North-west have emphasized that apparently immunocompetent in-dividuals are susceptible to this disease as well (17, 18, 32, 48).

Although the pathobiology of cryptococcosis within eachbody site is not fully understood, the ability of C. neoformans tosurvive in the cerebrospinal fluid (CSF) is critical for its pro-duction of life-threatening disease in the central nervous sys-tem. CSF performs a variety of essential functions: cushionsthe brain from physical impact, transports nutrients and wastesto and from cells, and circulates various signaling molecules,such as regulatory peptides (29). Due to the relative isolationof the CSF by the blood-brain and blood-CSF barriers, recentproteomic and metabolomic analyses support the hypothesis

that the CSF is a unique environment compared to other bodyfluids and sites, such as the alveolar spaces, intracellular vacu-oles, and blood, that C. neoformans encounters in the course ofan infection (55, 57, 60).

Three well-established virulence factors essential for crypto-coccal disease have been identified, namely, the production ofa polysaccharide capsule, melanin, and survival at 37°C. Manygenes controlling these phenotypes have also been identified(40). The use of random insertion mutagenesis has led to thediscovery of many essential virulence-associated genes, such asCNA1, VPH1, and CLC1 (14, 26, 27, 59), and site-directedtechniques have revealed the importance of urease and phos-pholipase genes for virulence (12, 13). Furthermore, the recentcompletion of the C. neoformans var. grubii genome presentsan exciting opportunity for accelerated discovery of genes en-coding virulence factors through the use of targeted geneticscreens. With these genomic tools, forward genetics can be apowerful strategy to better understand how C. neoformanscopes with various microenvironments within the host.

We hypothesized that the CSF presents unique stresses to C.neoformans in the host and that determination of specific fac-tors required for survival in CSF could shed light on noveldisease-producing mechanisms. Using a library of signature-tagged, site-directed mutant strains, we employed a forwardgenetics screen to assay for mutant-cell survival defects inhuman CSF. A series of mutants that displayed significantdeficiencies in survival when exposed to CSF were found. Ex-tensive characterization of these mutants suggests that CSFpresents a unique stress composite to this yeast, and the in-ability of certain C. neoformans mutants to survive CSF expo-

* Corresponding author. Mailing address: Department of MolecularGenetics and Microbiology, Duke University Medical Center,Durham, NC 27710. Phone: (919) 684-4016. Fax: (919) 684-8902. E-mail: [email protected].

† Supplemental material for this article may be found at http://iai.asm.org/.

� Published ahead of print on 9 August 2010.

4213

on June 16, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

https://crossmark.crossref.org/dialog/?doi=10.1128/IAI.00551-10&domain=pdf&date_stamp=2010-10-01

http://iai.asm.org/

sure in vitro correlates with attenuated virulence in the mam-malian host.

MATERIALS AND METHODS

Strains and media. The targeted deletion library of 1,201 mutants of the C.neoformans strain CM018 (a serotype A strain derived from H99) was obtainedfrom the Fungal Genetics Stock Center, and its use in screens has been previ-ously described (35). All other C. neoformans mutants were created in serotypeA strain H99. C. neoformans strains were grown in either yeast extract-peptone-dextrose (YPD) broth (46), phosphate-buffered saline, pH 7.4 (PBS), or tissueculture medium (Dulbecco’s modified Eagle’s medium [DMEM] with or without22 mM NaHCO3 buffer, 10% NCTC-109 medium (Invitrogen Corp., Carlsbad,CA), 10% FBS, 1% MEM nonessential amino acid solution, 1% penicillin-streptomycin). CSF and bronchoalveolar lavage (BAL) fluid were each pooledfrom Duke University Hospital patients; their inclusion was approved by re-quired Duke University Internal Review Board protocols for determining ex-empt status. Both biological fluid pools were collected anonymously from pop-ulations of at least 20 and 5 patients for CSF and BAL samples, respectively, inorder to ensure that the pools did not contain samples from a unique patient(s).Two to three additional CSF pools from at least 20 patients were used withselected mutants and controls, with similar results. All fluids were filter sterilizedprior to use. These samples came from unidentified patients whose medicalhistories were unknown. The CSF was fully characterized for contaminatingdrugs by proteomics and mass spectrometry (MS) analysis; only vancomycin andpipotiazine sulfoxide were present. Three independent C. neoformans strainswere recreated in the serotype A wild-type (WT) strain H99 after identificationin the mutant strain library. The Saccharomyces cerevisiae BW31 strain (ena1-4�nh1�) was a generous gift from Hana Sychrova.

CSF survival assay. For the initial assay screen, a library of 1,201 targetedmutants with known gene disruptions were replicated in 96-well plates with YPDbroth and incubated at 30°C for 4 days until saturation (�107 cells/ml). Strainswere then diluted 1:10 into YPD, PBS, or CSF and exposed at 37°C to air foranother 4 days. At days 1 and 4 of this incubation, strains were diluted 1:10 (1:100overall) in PBS and plated 1:10 and 1:100 onto YPD plates. Plates were scoredafter 2 days of growth at 30°C.

For repeat CSF assays of all hits positive for the lack of survival in CSF, strainswere grown in YPD broth for 1 to 2 days in a 30°C incubator at 225 rpm untilsaturation prior to CSF inoculation.

Recreation of the ena1�, rub1�, and pik1� mutants in H99. Site-directedmutations in the CM018 strain were identified in the screen and then recreated inour serotype A H99 strain. The gene knockouts of interest in the CM018 back-ground were PCR amplified for biolistic transformation into wild-type strain H99.The primers used were as follows: for the ena1 deletion, forward primer 1A10.F1and reverse primer 1A10.R1; for the rub1 deletion, forward primer 7F4.F1 and

reverse primer 7F4.R1; and for the pik1 deletion, forward primer 14A4.F1 andreverse primer 14A4.R1 (Table 1). These knockout constructs were amplified witha PCR of 5 min at 95°C and 40 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for4 min, with a final step of 72°C for 5 min with 1 �l of genomic CM018 mutant DNAfrom a standard genomic DNA preparation. The PCR product was then reduced toa 2-�l volume and adsorbed onto gold microparticles for biolistic transformation aspreviously described (51). Stable transformants were selected by plating cells ontoYPD plates containing 100 �g/ml nourseothricin. Gene deletions were verified byPCR using a primer within the NATR cassette and a primer flanking the deletionconstruct for the gene of interest (Table 1).

The reconstituted ena1�::ENA1 strain (MAT�) was made by biolistic trans-formation of the ena1� strain with a neomycin resistance marker (NEOR; am-plified from pJAF1 [18]) and the native ENA1 gene, amplified with 1A10.F1 and1A10.R2 from the WT. Transformants were selected on YPD-neomycin andYPD-nourseothricin plates. Three transformants did not grow on nourseothri-cin-containing plates but were isolated on neomycin-containing plates, indicatingthat there was a homologous-recombination event at the original ena1� locus.Reconstitution was confirmed by PCR, Southern hybridization, and reconstitu-tion of the CSF survival phenotype.

Southern hybridization. All mutants were reconfirmed using Southern hybrid-ization analysis for gene replacement. C. neoformans genomic DNA (20 �g) wasdigested with the restriction endonucleases HindIII (for the ena1� mutant), StuI(for the rub1� mutant), and PstI (for the pik1� mutant) and separated on a 0.7%agarose gel. The DNA was transferred to a positively charged nylon membrane(Roche Applied Science, Indianapolis, IN) by following established protocols(45). Membranes were hybridized with ENA1, RUB1, PIK1, or pCH233 digoxi-genin-labeled DNA probes overnight, as specified by the manufacturer (RocheApplied Science, Indianapolis, IN). Membranes were washed in an SDS-SSCsolution at a final stringency of 0.1% SDS and 0.1% SSC (1� SSC is 0.15 M NaClplus 0.015 M sodium citrate) before being incubated with anti-digoxigenin-alkaline phosphate Fab, followed by the addition of CDP-Star for chemilumi-nescent detection. DNA bands of interest were visualized on film following 3 to10 min of exposure.

Capsule and melanin production. Strains were incubated at 37°C in 5% CO2

for 2 days in tissue culture wells with 2 ml of Dulbecco’s modified Eagle’smedium for induction of capsule as previously described (42), and images werevisualized at �100 magnification. Melanin production was verified followinginduction of growth on Niger seed agar (NSA) for 2 to 5 days at 30°C to visuallyconfirm dark colonies.

In vitro stress assays. To determine whether the CSF defect of the mutants ispH sensitive, we grew the strains to saturation and then inoculated them intoYPD broth adjusted to various pHs for 5 days before plating them onto YPDagar for 2 days. To test the cell wall integrity of the mutants, strains were grownto saturation and then inoculated onto YPD agar with 1 M sorbitol for 3 days.Because ENA1 encodes a cation transporter, we tested the ena1� mutant for

TABLE 1. Oligonucleotides used in this study

Function Primer Sequence (5� to 3�)

Creation of knockout genomic DNA for biolistics 1A10.F1 AAGGCGAAGAGGGAAAGAAGtransformation (flanking the gene of interest) 1A10.R1 GCAGTGTTGTCCACCAGAGA

14A4.F1 CTGTGAGCTATGAGTTTGACC14A4.R1 CAGTTGGGACAGTTTATTGC7F4.F1 GCAGATGATCGGGTGACTTT7F4.R1 ACACCTTTTTGTGCCTCGTC

Analysis of proper homologous recombination of NAT.F1 ACCTCTGGCTGGAGGTCACgene construct NAT.R1 GTGACCTCCAGCCAGAGGT

1A10.F2 TGGGGATGACTCACATTATGG7F4.F3 CGTGCTAGGCTTCCTGATGT14A4.R2 GCTTGGGTTGTATGGATGGT

Creation of gene probe for Southern analysis NAT.probeF ACTGGATGGGTCCTTCACNAT.probeR GGGCATGCTCATGTAGAGC1A10.probeF GAAGTCGCTTTCCACAAAGA1A10.probeR GACATGGAAAACAACCTTCG7F4.probeF AGAACGGGTTGAAGAGAAGG7F4.probeR AGCAAGGACTAGATGGATGG14A4.probeF ACTCTTCCAAACCACCTTCC14A4.probeR TTTGACCTTGAGCTTGAACC

4214 LEE ET AL. INFECT. IMMUN.


.org/D

ownloaded from

http://iai.asm.org/

survival under cationic stress. We inoculated saturated mutant cultures into YPDbroth with either 1.5 M KCl or NaCl for 4 days. Strains were then plated ontoYPD agar for visualization.

CSF protein exclusion assays. We tested the CSF for proteins that may haveroles in affecting the CSF-defective mutants as previously described (8). Briefly,to estimate the size of the CSF lethal factor(s), CSF samples were seriallyfractionated using 30-, 10-, and 3-kDa-cutoff Centricon filters according to themanufacturer’s instructions (Millipore, Billerica, MA). Retentates and filtrateswere reconstituted to their original volumes with sterile distilled water and testedfor activity against the CSF survival-defective mutants in a CSF growth assay. Inaddition, the wild-type and CSF survival-defective mutants were tested in theCSF growth assay using boiled, clarified CSF. CSF samples were placed in adouble boiling-water bath for 20 to 30 min. Any insoluble denatured protein wasremoved by centrifugation at 3,000 rpm. Sterile distilled water was added toreconstitute the solution to the original concentration. The clarified, boiled CSFwas used in a liquid growth assay with wild-type and CSF-defective mutants.Lastly, we digested CSF proteins and peptides using 50 �g/ml proteinase K for16 h at 30°C and tested the digested samples for activity against wild-type andCSF-defective mutants in a liquid growth assay. As a control, YPD was alsotreated with proteinase K to see if active proteinase K had any influence on straingrowth.

Oxidation of CSF. CSF was treated with a final concentration of 50 mM H2O2

at room temperature for 2 min and then quenched with 25,000 units of catalaseat room temperature for 10 min. To remove the enzyme from the CSF, thesample was centrifuged through a 30-kDa-cutoff Centricon filter at 3,500 rpm for20 min at 4°C. The filtrate was then tested for activity with the CSF survival assay.

Susceptibility of C. neoformans to vancomycin. The MIC of vancomycin for C.neoformans was assessed via the Etest using a vancomycin Etest strip. Isolatedcolonies from a 3-day culture on YPD were mixed with PBS (pH 7.4) to obtaina 0.5 McFarland standard. The yeast suspension was then spread with a sterilecotton swab over the entire surface of a yeast nitrogen base (YNB) agar plate.After the plates were dry, the Etest strip was placed in the center of the plate.The plates were incubated at 30°C for 2 days and at 37°C for 3 days and thenobserved for survival inhibition.

Survival in macrophages. We assessed ena1�, rub1�, and pik1� mutant strainsfor survival of these yeasts within macrophages. The WT and the ena1�, rub1�,and pik1� mutant strains were incubated overnight at 30°C at 150 rpm asinoculum for the macrophage survival assay, as previously described (11, 42).

Briefly, 105 gamma interferon- and lipopolysaccharide-activated J774A.1 mac-rophages were coincubated with 105 yeast cells of each yeast strain for 1 h at 37°Cin 5% CO2 and DMEM to allow phagocytosis. Prior to coincubation, cells ofeach yeast strain were opsonized with the monoclonal antibody mAb18B7 (a giftfrom Arturo Casadevall) (56). Then, extracellular yeasts were washed away withPBS and the monolayers were incubated in DMEM overnight. A duplicatemonolayer was stained at 1 h after the washes, and numbers of yeasts associatedwith macrophages were counted by microscopy for each strain as previouslydescribed (11, 16). Macrophages for the intracellular killing assay were then lysedwith 0.5% SDS, and lysates were diluted and plated on YPD to count numbersof viable yeasts present following incubation at 30°C for 2 days.

Caenorhabditis elegans virulence assay. C. neoformans strains were assayed forvirulence in C. elegans as described previously (36). Briefly, a standard C. elegansstrain was maintained at 20°C on a lawn of E. coli strain OP50. Prior to thefeeding, C. neoformans strains were inoculated into 2 ml of YPD for 8 h, and 75�l of the culture was spread on a 6-cm plate of brain heart infusion (BHI) agarwith gentamicin (50 �g/ml). These plates of yeast lawns were allowed to growovernight at 30°C. Fifty 1-day-old hermaphrodites were transferred from thelawn of E. coli to the lawn of yeasts, incubated at 25°C, and then examined every12 h for the first 3 days, followed by every 24 h thereafter. Animals wereconsidered dead by a lack of reflex when touched. Data from the survival assayswere plotted using Kaplan-Meier survival curves and assessed by the log rank testwith GraphPad Prism (GraphPad Software, Inc., La Jolla, CA). Curve compar-isons with P values of �0.05 were considered significantly different.

In vivo virulence assay. Virulence of the C. neoformans mutant strains wereevaluated in a rabbit meningitis model as previously described (43). In brief, C.neoformans strains were grown in YPD for 18 to 36 h and diluted to 3.3 � 108

cells/ml, with 0.3 ml inoculum introduced via intracisternal injection into corti-sone-treated, male New Zealand White rabbits (n � 3). The CSF for each rabbitwas withdrawn via intracisternal tap at the days indicated, and fungal burdenswere determined by plating serial dilutions of CSF and assessing CFU growth.All assays were performed according to Duke University’s Institutional AnimalCare and Use Committee guidelines and approvals.

Mass spectrometry. For each heated and nonheated biological condition,three separate CSF samples were prepared by the 3-kDa-cutoff Centricon frac-

tionation protocol as described above. CSF fractions less than 3 kDa wereacidified to pH 3.0 with neat formic acid and subjected to solid-phase extractionon a reversed-phase HLB Oasis cartridge (Waters Corporation, Milford, MA) byfollowing the manufacturer’s protocol. Analytes were eluted in 100 �l of 50%isopropanol–50% acetonitrile and brought to dryness using vacuum centrifuga-tion. Samples were resuspended in 30 �l of 2% acetonitrile–0.1% trifluoroaceticacid (TFA; Thermo Scientific, Rockford, IL), and analyte quantities were nor-malized to 0.39 �g/�l with 2% acetonitrile, 0.1% TFA by following a micro-bicinchoninic acid (Pierce Biosciences, Rockford, IL) assay. To allow for aseparate qualitative-factor-only liquid chromatography–tandem-MS (LC-MS/MS) analysis, a pooled aliquot of all three samples from the same condition wascreated. All samples were stored at 4°C until LC-MS/MS analysis.

Each sample was analyzed by injecting analyte onto a 75-�m by 250-mmbridged ethyl hybrid (BEH) C18 column (Waters) and separated using a lineargradient of 5 to 40% acetonitrile with 0.1% formic acid at a flow rate of 0.3�l/min in 90 min on a nanoAcquity liquid chromatograph (Waters). Electrosprayionization was used to introduce the sample in real time to a Synapt HDMS massspectrometer (Waters) operating in the positive-ion mode. The instrument wasoperated in a high-energy-/low-energy-switching (MSE) acquisition mode foreach individual sample and in a data-dependent acquisition (DDA) mode forpooled samples.

To qualitatively identify peptide analytes in the mixture, DDA data weresearched against the Swiss-Prot 57.10 database with Homo sapiens taxonomy(http://ca.expasy.org/sprot/) using Mascot v2.2 (Matrix Science, Inc.). Mascotsearch parameters were 20 ppm for precursor ions and 0.04 Da for product ions,with no enzyme specificity and with differential mass modification correspondingto oxidation on all Met residues. Mascot search results were imported andinterpreted in Scaffold 2.6 (Proteome Software, Portland, OR). Label-free quan-titation of analytes across all biological samples was accomplished using theRosetta Elucidator v3.3 software package (Rosetta Biosoftware, Seattle, WA).Feature identification and chromatographic retention time alignment was per-formed using the PeakTeller algorithm. Visual scripting within Elucidator wasused to extract peak intensities for features above 1,000 counts and present in50% of the biological replicates. Monoisotopic masses of features with a mini-mum 5-fold increase in the nonheated samples and with P values less than 0.001were searched against the Human Metabolomics Database (http://www.hmdb.ca/) and Metlin (http://metlin.scripps.edu/), with a mass tolerance of 50 ppm.Preliminary matches were manually verified for the presence of unique isotopedistributions using ICR-2LS (PNNL Laboratories; http://omics.pnl.gov) andavailable high-energy fragmentation data from the Metlin database. The dataassociated with this paper may be downloaded from ProteomeCommons.orgTranche repository using the following hash: iC/qf/tZlLpRiGb3F4GpSNhoav52ia3mWjMTbp7D5EkD3TSaSANcOmggaJDlTRLndGWi0BOmljyinEsfIqPRZzNwChIAAAAAAAADVw � �. The hash may be used to prove exactly whatfiles were published as part of this study’s data set, and the hash may also be usedto check that the data have not changed since publication.

Statistical analysis. All statistical analyses, unless specifically noted below,were performed using JMP7 software (Cary, NC) and Student’s t test with an �of 0.05. Rabbit experiments were done with 3 rabbits in each group. All in vitrodata were collected at least in triplicate.

RESULTS

Identification of mutants with survival defects in CSF. Weassessed the ability of C. neoformans to survive in CSF due toits neurotropic nature and presence in clinical specimens. CSFis continuously made in the lateral ventricle of the brain andcirculates throughout the subarachnoid space, and it is envi-ronmentally isolated by the blood-brain and blood-CSF barri-ers (29). Using a site-directed mutant library of 1,201 individ-ual strains (35), we found 13 mutant strains that exhibitmarked survival defects compared to parental strain CM018when exposed to CSF at 37°C for 4 days (Fig. 1; Table 2).Survival defects were highly varied within these 13 strains,ranging from a 10-fold decrease in survival to completedeath. The survival defect observed in CSF was not due tonutrient starvation or absolute high-temperature sensitivity,as these mutant strains showed normal survival in YPDmedium and PBS.

VOL. 78, 2010 C. NEOFORMANS INFECTION REQUIRES SURVIVAL IN CSF 4215


.org/D

ownloaded from

http://iai.asm.org/

Mutants defective for survival in CSF show various degreesof virulence in Caenorhabditis elegans. To assess whether theCSF survival defects resulted in an inability to respond to thehost’s innate immune response, we performed the C. eleganskilling assay on our 13 CSF survival-defective mutant strains(36). Lacking an adaptive immune response and possessingtractable genetics, C. elegans has emerged as an efficient way toscreen for candidate genes that mediate virulence throughinteractions with innate immunity (15, 36, 37). This modelallows investigators to distinguish generally “sick” strains andappreciate possible differences in mutant susceptibility to hostresponses. Screening through our CSF survival-defective mu-tants revealed various degrees of virulence in the worm (Fig. 2;data not shown for all 13 strains): the ena1� mutant exhibitedwild-type (WT) virulence (P � 0.1532), whereas the virulenceof the rub1� and pik1� mutants was significantly attenuated(P � 0.0001). These results show that these mutants have somedifferences in response to the host but were not uniformlysusceptible to any host challenge.

Phenotypes of CSF-specific-survival-defective mutants. Wechose 3 mutants from the 13 candidates for further study usingthe following criteria: (i) the predicted functions of their pro-teins in one of three major functional groups (transporter,protein sorting/degradation, or signaling), (ii) their reduced

rates of survival in CSF (from a 10-fold reduction to completeinviability), and (iii) their overall vigor as determined by viru-lence in C. elegans survival assays, demonstrating that thesestrains are not generally sick and can cause disease. Threemutants in the CM018 background were recreated in the clin-ically relevant serotype A strain H99 background: ena1�,rub1�, and pik1� mutants (Table 3). The original CSF-specificsurvival defect for each strain was reconfirmed in the wild-typeH99 background strain when grown in CSF at 37°C for 4 days(Fig. 3A). The ena1� strain showed complete cell death after36 h of incubation, and the rub1� and pik1� strains also ex-hibited prominent survival defects in ex vivo CSF (Fig. 3B).Compared to the survival of the WT after 4 days, the ena1�mutant had no viable cells (a log10 CFU of 1 is consideredsterile) (compared to the WT value, P was �0.01) (Fig. 3C),and the rub1� and pik1� mutants exhibited 89.6% and 99.5%decreases of cells, respectively (P � 0.05 and P � 0.01, respec-tively) (Fig. 3C). Because the WT also exhibited a significantdecrease after 4 days of incubation in CSF, ratios of day 4 today 0 CFU were determined to see if the mutants had signif-icant differences in survival. Indeed, all three mutants showedsignificantly greater decreases in survival in CSF than the WT(P � 0.01) (Fig. 3D). The day 4 CFU/day 0 CFU ratio for H99was 0.088, while the ena1�, rub1�, and pik1� mutants hadratios of 1.07E9, 0.028, and 0.005, respectively. Interestingly,no survival defect was seen when these strains were grown inYPD, PBS (Fig. 3A), or BAL fluid (Fig. 3E). Mutant survivalin fetal bovine serum (FBS) was improved in comparison withthat in CSF but was not restored to WT survival levels for theena1� mutant (P � 0.01) (Fig. 3E).

Three critical factors influencing C. neoformans pathogene-sis are capsule formation, melanin production, and the abilityto grow at 37°C. When all three mutant strains were incubatedunder capsule-inducing conditions (DMEM containing 22 mMNaHCO3 at 37°C in 5% CO2), no defects in capsule formationwere observed (data not shown). When grown on NSA, theena1� and pik1� mutants exhibited normal development ofmelanin production, but the rub1� mutant remained white,suggesting impaired melanin production. It is interesting thatthe original pik1� mutant in the CM018 background showedan increase in melanin production (data not shown). Therub1� mutant also exhibited a lower basal rate of growth inYPD (a roughly 10-fold decrease) and a small-colony morphol-ogy compared to that of H99; at 37°C, these phenotypes wereexaggerated. The other mutant strains exhibited normalgrowth rates at 37°C compared to H99.

The effect on survival in CSF is not mediated by osmotic ormonovalent-cation stress. To assess what factors in the CSFcause the CSF-specific survival defects, we investigatedwhether these mutants showed any cell wall integrity defectsduring growth under osmotic stress. The mutant strains weregrown at 37°C for 5 days on YPD agar plates containing 1 Msorbitol. All mutant strains showed no survival differences fromthe WT strain on this medium (Fig. 4A).

Since ENA1 encodes a cation ATPase transporter and theSaccharomyces cerevisiae ena1� mutant is susceptible to cationstress, we examined whether cation stress could cause the CSFsurvival defect for the ena1� mutant. Using a cation-sensitiveS. cerevisiae strain, BW31 (ena1-4� nh1� [6]), as a positive

FIG. 1. CSF-defective ATCC mutants in a CSF survival assay. Thestrains were grown to saturation in YPD at 30°C and then diluted 1:10in CSF or YPD and incubated at 37°C for 4 days. “Neat” represents theCFU concentration in CSF, and strains were diluted serially in 10-foldincrements prior to being spotted onto YPD plates. CM018 is thebackground strain of the targeted mutant library, H99 is the clinicalcorrelate, and the tps2� mutant (trehalose-6-phosphotase mutant),which does not survive in CSF at 37°C, serves as a positive control.(YPD spots are diluted from the saturated stock cultures.) Names ofgenes described in this study are listed in Table 2.



.org/D

ownloaded from

http://iai.asm.org/

TA

BL

E2.

AT

CC

mutants

with

survivaldefectsin

CSF

Functionalgroup

ofprotein

Knockout

Gene

Transcript

name

Broad

databaseannotation

aD

escriptionM

elaninC

apsuleM

utantphenotype(s) b

Transporter

1A10

EN

A1

EN

AP-type

AT

Pase1

CN

AG

_00531C

ationA

TPase

transporter

K

nown

tobe

1F11

cP

XA

2A

drenoleukodystrophyprotein

CN

AG

_02764A

BC

transporter

hypovirulent

Transcription

5C2

SRE

1C

onservedhypothetical

proteinC

NA

G_04804

Helix-loop-helix

DN

A-binding

domain;

ergosterolbiosynthesis

K

nown

tobe

hypovirulentProtein

sorting/proteindegradation

10D3

VP

S25C


proteinC

NA

G_04863

ESC

RT

-IIcom

plexsubunit;endosom

alproteinsorting

/

7F4

RU

B1

Ribosom

alchaperoneC

NA

G_02827

Ribosom

alchaperoneactivity

Abnorm

almorphology;

5D3

CSN

1201C


proteinC

NA

G_01697

Transcription-associated

recombination

protein

/

slower

growth

8F3

HR

D1

SynoviolinC

NA

G_05469

Transm

embrane

ubiquitinligase

requiredfor

endoplasmic

reticulum-associated

degradation;Zinc

fingerdom

ain

12F1

VA

M6

RabG

EF

CN

AG

_05395R

abguanyl-nucleotide

exchangefactor

activity

Signaling

4B10

cN

SR1

RN

Asplicing

factorPad-1

CN

AG

_02130B

indsnuclear

localizationsequences

forpre-

rRN

Aprocessing/biogenesis

13C5

cC

KB

1C

aseinkinase

IIbeta

chainC

NA

G_03590

Regulation

ofcellcycle;cellular

ionhom

eostasis;flocculationvia

cellwall

protein-carbohydrateinteraction;response

toD

NA

damage

stimulus

14A4

cP

IK1

1-Phosphatidylinositol4-kinaseC

NA

G_07744

Inositolphosphatem

etabolismand

phosphatidylinositolsignalingsystem

14B2

cSW

E1

MY

T1

kinaseC

NA

G_03171

Proteinkinase

inregulation

ofcellcycle

C

ellwallprotein

12G8

CP

S1C

ellubiuronicacid

synthaseC

NA

G_04320

Glycotransferase

Know

nto

behypovirulent

aT

hebroad

databaseuses

theH

99background;A

TC

Cm

utantsare

inthe

CM

018background.

bM

utantphenotype

initiallycharacterized

byL

iuet

al.(35).cN

ovelhostsurvivalgene

(notreported

ininitialscreen)

(35).



.org/D

ownloaded from

http://iai.asm.org/

control, we found that the ena1� mutant does not appear to besensitive to 1.5 M K or Na stress (Fig. 4B).

Characterization of the survival factor(s) in CSF. We nextattempted to isolate the CSF survival factor on the basis ofmolecular weight as described previously (8). CSF was sizefractionated via centrifugation at 2,300 rpm for 20 min usingCentricon filters with 30-, 10-, and 3-kDa cutoff values. Reten-tates and filtrates were reconstituted to an original volume withsterile water. Fractions with masses less than 3 kDa were foundto retain the CSF-specific survival effect as seen in whole CSF(Fig. 4C). Thus, the survival effector in CSF is a molecule thatis less than 3 kDa in size, such as a small peptide or metabolite.If the survival-altering factor of CSF is a peptide, proteasedigestion or heat denaturing should abolish the growth-inhib-iting effect (8). Whole CSF was subjected to proteinase Ktreatment for 16 h at 37°C to digest any peptides. To controlfor potential effects of proteinase K on basal rates of growth,YPD was also treated with proteinase K. Proteinase K treat-ment did not have any effect on the viability of the mutantstrains; furthermore, it did not abolish the effect of CSF onmutant survival compared to that of the WT (Fig. 4D). Giventhe broad cleavage specificity of proteinase K to peptide bondsadjacent to the carboxylic groups of aliphatic and aromaticamino acids, the survival effector(s) is likely not to be a smallpeptide. However, after boiling whole CSF in a double waterbath for 30 min, we were able to restore CSF survival in themutant strains, suggesting that the survival compound(s) isheat labile (Fig. 4D).

To determine if the survival effect is sensitive to oxidation, wetreated CSF with 50 mM H2O2 and quenched the reaction withcatalase. The enzyme was removed by filtering CSF through a30-kDa-cutoff Centricon filter, and the filtrate was tested for ac-tivity against wild-type and mutant fungi by the CSF survivalassay. There was no difference between mutants in H2O2-treatedCSF and control CSF, indicating that the inhibition factor(s) isnot sensitive to oxidation (data not shown).

To identify candidate compounds responsible for the de-

creased survival effect in CSF, an MS-based quantitative com-parison between the �3-kDa fraction of heated and nonheatedCSF was employed. A total of 4,318 signals were quantitatedacross triplicate preparations of heated CSF and nonheatedCSF. To focus database searching on candidate compoundsmost likely responsible for decreased survival, signals wererequired to be at least 5-fold increased in the nonheated CSFsamples compared to in heated samples, with P values less than0.001, and to have a minimum signal intensity of 1,000. A totalof 13 signals meeting these criteria were submitted to twoindependent databases, the Human Metabolite Database andScripp’s Metlin metabolite database, and were matched basedon the accurate mass of the precursor ion to within 50 ppm ofthe theoretical mass (Table 4; see also Fig. S1 in the supple-mental material).

Metlin database searches revealed a putative identificationfor a compound at m/z 724.719 ([M 2H]2), which matchedvancomycin at 5.0 ppm. Due to vancomycin’s atypical isotopedistribution from two Cl atoms within its structure(C66H75Cl2N9O24), the identification was validated by compar-ing the experimental isotope distribution of the precursor ionwith the theoretical isotope distribution of a compound withthe same molecular formula (Fig. 5A). The identification wasfurther validated by manually verifying the presence of productions in the available high-energy MS/MS spectrum by compar-ison with the experimentally acquired MS/MS spectrum (Fig.5B). To quantitate relative levels of vancomycin betweenheated and nonheated CSF samples, peak intensities for the[M 2H]2 precursor ion were calculated across all samples(Fig. 6). An average 5.6-fold increase in vancomycin in non-heated samples was measured (P value � 0.03).

To test if vancomycin acts synergistically with our mutants tocause the CSF survival defect, we tested for its activity againstthe CSF survival-defective C. neoformans mutants on YNBagar plates. The MIC was assessed via the Etest by using avancomycin Etest strip. The antibiotic did not affect the growthor survival of these mutants, suggesting that vancomycin is notthe compound that reduces mutant survival in CSF.

Effect of the ENA1, RUB1, and PIK1 deletions on survival inmacrophages. During the course of an infection, C. neofor-mans encounters many microenvironments within the host,including intracellular phagosomes within macrophages. Thus,we assessed the CSF survival-defective mutants for their abilityto survive a potential cellular biological compartment in theCSF by coculture with activated macrophages. After 48 h ofcoincubation with activated J774A.1 macrophages, the mutantstrains exhibited the following reductions in intracellular sur-

TABLE 3. Summary of strains used in this study

H99 genotypea CorrespondingATCC mutantb

Broad gene identifierfor serotype A

ena1� 1A10 CNAG_00531rub1� 7F4 CNAG_02827pik1� 14A4 CNAG_03535ena1�::ENA1

a The ATCC mutants were recreated in the clinically relevant H99 back-ground.

b The mutants used in the screen were of the CM018 background and camefrom the ATCC.

FIG. 2. CSF-defective mutant strains show a wide range of virulencein a C. elegans killing assay. Fifty 1-day-old adult hermaphroditic nema-todes were placed on BHI with 50 �g/ml gentamicin containing a lawn ofwild-type or mutant C. neoformans. Worms were monitored for mortalitytwice daily. Dead nematodes were defined as nematodes that failed torespond to touch. The tps1� mutant is a trehalose-6-phosphate synthasemutant that exhibits virulence attenuation in C. elegans (41).



.org/D

ownloaded from

http://iai.asm.org/

vival compared to that of WT H99: for the ena1� mutant,81.8%; for the rub1� mutant, 94.4%; and for the pik1�mutant, 88.5% (P � 0.01) (Fig. 7). Since extracellular yeastswere removed after the first hour of coincubation, these resultsmeasured the intracellular survival of the C. neoformans mu-tants. In addition to the strains’ demonstration of no survival

defects after the first hour of coincubation and our detection ofno differences in phagocytosis among all the strains, thesemutants showed significant defects in intracellular survivalwithin macrophages after 48 h.

Effect of CSF-specific-survival-defective mutants on viru-lence in vivo. We next sought to ascertain if the CSF-specific

FIG. 3. Growth defects are specific to mutants in CSF. Selected H99 mutants were grown until saturation and then diluted 1:10 in YPD, CSF,or PBS, in which they were then grown at 37°C for 4 days. Then mutants were serially diluted in 10-fold increments and spotted onto YPD plates.(A) The survival-defective phenotype is seen specifically in CSF and is not the result of nutrient starvation. (B) The ena1� mutant exhibits completecell death after 36 h of incubation in CSF. (C) The rub1� and pik1� mutants show approximately 10- to 20-fold cell loss compared to WT survivalat day 4; the ena1� mutant shows complete cell death (P � 0.01). (D) All mutants have a significant decrease in CSF survival when a decreasein H99 levels (P � 0.01) is controlled for. d4/d0, day 4/day 0 ratio; 99% CI, 99% confidence interval. (E) At day 4, survival defects were greatestin CSF compared to in BAL fluid and FBS for all mutants (**, P � 0.01). Error bars represent standard errors.



.org/D

ownloaded from

http://iai.asm.org/

survival defects in vitro would predict a reduced survival in thedynamic CSF of the host and translate into an attenuatedvirulence of the mutant strains. Using the rabbit model ofmeningitis, we inoculated equal numbers of the WT, ena1�,rub1�, and pik1� strains directly into the CSF of the subarach-noid space of New Zealand White rabbits. On specified days,CSF was withdrawn from each rabbit and colonies of C. neo-

formans were counted to assess the level of yeast survival. Allstrains that showed CSF-specific survival defects in vitroshowed significantly attenuated virulence by day 7. On day 10,WT-infected rabbits had a fungal burden of log10 5.89, com-pared to log10 2.13 for the pik1� mutant and log10 1.00 (sterileCSF) for both the rub1� and the ena1� mutant (Fig. 8). Re-constitution of the ena1� mutant strain restored virulence,

FIG. 4. The survival factor in CSF is a small molecule. To determine the survival-inhibiting factor in CSF, we performed a series of assays toassess fungal viability. (A) Incubation in 1 M sorbitol (sorb) shows that osmotic stress is not the survival-inhibiting factor. (B) The ena1� mutantsare not cation sensitive to 1.5 M KCl or NaCl. The BW31 strain (ena1�-ena4� nh1�) is an S. cerevisiae control strain. (C) Serial fractions of theCSF reveal that the survival-inhibiting factor is smaller than 3 kDa, suggesting a small peptide or unique ion composition. (D) Mutants were grownin proteinase K-treated or heat-inactivated CSF (to denature proteins in CSF). Proteinase K appeared to have no effect on the survival of the ena1�and rub1� mutants in CSF; however, heated CSF ablated the growth inhibition effect for all mutant strains.

TABLE 4. Metlin and Human Metabolomics Database search results

M Hvalue Charge P value Fold

changeaRetention time

(min) Database search resultb Molecular formula Mass error(ppm)c

492.196 1 6.38E05 51.0 60 Pipotiazine sulfoxide C24H33S2N3O4 4.11,448.431 2 3.80E06 5.6 27 Vancomycin C66H75Cl2N9O24 5.0144.103 1 4.90E06 5.6 27 Vancomycin fragment NAd NA1,305.349 1 1.96E04 6.0 27 Vancomycin fragment NA NA270.126 1 5.46E04 6.7 81 No matches NA NA314.233 1 8.64E09 30.4 84 No matches NA NA474.263 1 1.89E04 6.6 43 No matches NA NA522.216 1 6.69E04 8.2 81 No matches NA NA725.154 1 7.07E10 34.2 80 No matches NA NA795.225 2 2.44E04 4.8 81 No matches NA NA856.201 1 9.61E05 7.1 81 No matches NA NA1,047.325 2 7.46E04 5.2 80 No matches NA NA1,299.400 2 8.81E05 5.1 80 No matches NA NA

a Fold changes are averages of the three individual measurements and indicate fold increases in nonheated samples.b Search results from both the Metlin and Human Metabolomics databases are included.c Mass difference between the experimentally measured mass and the theoretical mass.d NA, not applicable.



.org/D

ownloaded from

http://iai.asm.org/

with ena1�::ENA1 strain-infected rabbits unable to survivepast day 7 of infection (Fig. 9). On day 7, the number of CFUfor the mutant-infected rabbit was log10 2.72 � 0.95 (mean �standard error of the mean [SEM]), compared to log10 6.25 �0.4 for the reconstituted strain and log10 6.33 � 0.29 for theWT-infected rabbit. These results demonstrate that a func-

tional Ena1 protein is essential for the survival of C. neofor-mans in the CSF within the subarachnoid space.

DISCUSSION

C. neoformans has a unique propensity for invading andsurviving in the central nervous system, which is a highly dy-namic microenvironment of neural tissue and surroundingfluid. CSF is continuously being produced and eliminated at arate of 500 ml per day in healthy human adults, with a totalvolume of 135 ml at any one time. An array of transporters andchannels line the basolateral and apical membranes of thechoroid plexus epithelium at the lateral ventricles, facilitatingthe net transfer of ions, including Na, Cl, K, and HCO3

,into CSF (4, 9, 24, 29). Furthermore, the CSF not only carriespolypeptides that pass through the blood-brain barrier but alsoharbors neuro-peptides and proteins manufactured locally as arecipient of cell-shedding products from the brain and the

FIG. 5. Qualitative identification of vancomycin. (A) The measuredisotopic distribution of the m/z 724.7190 ([M 2H]2) signal was overlaidwith the theoretical isotope distribution of C66H75Cl2N9O24 (vancomy-cin). (B) High-energy MS/MS spectrum of the m/z 724.7190 (M 2H]2)signal correlated with the reported MS/MS spectrum at a collision energyof 40 (reported directly from the Metlin database).

FIG. 6. Vancomycin in heat-treated and nontreated samples. Van-comycin intensity ratios of nonboiled CSF to boiled CSF indicates anaverage 5.6-fold increase in nonboiled CSF, with a two-tailed t testsignificance value of 0.03. Intensity ratios are plotted relative to van-comycin levels in heated CSF.

FIG. 7. Ena1, Rub1, and Pik1 mediate survival in macrophages.Activated J774A.1 macrophages were coincubated with the ena1�,rub1�, and pik1� mutants of C. neoformans for 60 min at 37°C in 5%CO2. Extracellular yeasts were then removed, and cocultures wereincubated overnight under the same conditions as described above.Following coincubation, macrophages were lysed and viable C. neofor-mans colonies were incubated on YPD plates overnight at 30°C for 2days for CFU quantification. Strains were assayed in triplicate (P �0.01).



.org/D

ownloaded from

http://iai.asm.org/

surrounding epithelium (58, 60). Because of the CSF beingcompartmentalized from its surrounding microenvironments,we hypothesized that the CSF presents a unique stress envi-ronment for C. neoformans survival. For instance, it has beenshown in human disease that over a million yeasts per ml ofCSF can be grown in an HIV-infected patient. This ability tosurvive and proliferate to large numbers in human CSF is notshared by other pathogenic fungi.

Survival of C. neoformans mutants in human CSF. Using aforward genetics approach, we identified 13 mutants from alibrary of 1,200 mutants that covers approximately one-fifth ofthe genome with survival defects specific to CSF (Table 2; Fig.3). In the original, independent screen of this library, Liu et al.identified a number of novel mutants exhibiting virulence de-ficiencies in a murine inhalation model of cryptococcosis (35).Eight of our CSF survival-defective mutants also had infectivitydeficiencies in that previous report: the ENA1, RUB1, SRE1,VPS25, CSN1201, HRD1, VAM6, and CPS1 mutants (Table 2).In our CSF survival assay, we identified 5 additional genespreviously unassociated with yeast survival in vitro or in vivo:PXA2, NSR1, SWE1, CKB1, and PIK1 (Table 2; Fig. 1).

These newly identified genes encode a wide array of func-tions. PXA2 encodes Pxa2p, a heterodimeric subunit of anABC transporter required for the transport of long fatty acidsinto the peroxisome for �-oxidation (52, 54); NSR1 encodes anuclear localization-binding protein with two RNA bindingdomains, mediating the initial step of small nucleolar pre-rRNA processing and ribosome biogenesis (19, 33, 34, 53);Swe1p is a protein kinase that inhibits Cdc28p, delaying theG2/M transition until appropriate conditions are met (20, 22);and CKB1 encodes the �-regulatory subunit of casein kinase II,which plays wide roles in mediating stress responses, includingDNA damage and cellular ion homeostasis, by directly upregu-lating ENA1 when the organism is under Na stress (1, 2, 50).Taken together, these genes describe an organism seeking to

actively maintain basic growth and electrolyte homeostasis as itencounters the distinct microenvironment of CSF. As this yeastadjusts to CSF, our findings suggest that there is also tightregulation for proper protein sorting and degradation, trans-porter levels, and signaling (Table 2). In fact, using transcrip-tion profiling, we have found that C. neoformans induces theexpression of a set of genes in CSF that is distinct from thoseinduced in serum in these functional groups (25). Therefore, C.neoformans strains causing meningitis are put under uniquestresses as they survive and multiply in the CSF of the host. Inaddition, we could not have predicted these genes’ importanceto CSF survival through classical in vitro phenotypes, such ascapsule or melanin production. Clearly, C. neoformans usesseveral functional pathways and multigenic controls to survivein CSF.

CSF as a unique, hostile microenvironment. Our analysis ofthe CSF showed that one feature impacting yeast survival inCSF is a small, heat-labile molecule less than 3 kDa. Recentproteomic studies have shown that CSF is a reservoir for up to563 peptides from 91 precursor proteins, with an expandedproteome of 798 proteins (60). In a comparison with the Hu-man Proteome Organization (HUPO) high-confidence plasmaproteome data set of 889 proteins, Zougman et al. found that586 proteins were unique to their CSF data set (76% of theCSF proteome). These proteomic studies of CSF have foundendogenous antimicrobial peptides such as chitinase-3-likeprotein-1 precursors ranging from 7 to 23 amino acids (58, 60).However, our treatment with a broad-spectrum protease, pro-teinase K, did not alleviate the survival defect, suggesting thatthe factor(s) implicated with our mutants’ survival defect islikely not a standard biological peptide (Fig. 4). In addition,the factor(s) presumably does not contain disulfide bonds fre-quently observed in antimicrobial peptides, because oxidationtreatment of CSF did not mitigate the survival activity.

We further characterized the composition of our CSF bymass spectrometry analysis of heated and unheated CSF frac-

FIG. 9. In vitro, the CSF-defective ena1� mutant shows severe vir-ulence attenuation in a rabbit model of meningitis, and its reconsti-tuted strain recovers full virulence. The ena1� mutant was reconsti-tuted via a 2-step biolistic transformation with the original gene and aneoR cassette. Strains were then grown to saturation and inoculatedinto CSF for 4 days at 37°C prior to being plated on YPD medium forCFU quantification. The ena1� mutant shows significant attenuationof infection in a rabbit model of meningitis. The ena1�::ENA1 mutantrecovers the virulence phenotype. All rabbits infected with the recon-stituted strain died on day 7 (n � 3).

FIG. 8. In vitro CSF-specific-survival-defective mutants exhibit anattenuation of virulence in a rabbit model of meningitis. CSF-sensitivemutants were each inoculated into the subarachnoid space of rabbits(n � 3) with 3.3 � 108 cells/ml. CSF was removed from each rabbit viaspinal taps at the indicated times, and serial dilutions were plated ontoYPD medium and incubated at 30°C for 2 days for CFU quantification.CFU was used as a measure of the burden of infection. Strains thatexhibited growth defects in CSF in vitro also showed attenuated viru-lence in vivo. Note that no animals injected with H99 survived past 10days of infection.



.org/D

ownloaded from

http://iai.asm.org/

tions less than 3 kDa. Because the survival factor(s) was heatlabile and less than 3 kDa, we reasoned that retention peaksthat were present in the unheated samples, but not in theheated samples, could represent possible candidates for a com-pound(s) responsible for the mutants’ CSF survival pheno-types. This analysis revealed 13 compounds whose expressionwas at least 5-fold higher in the heated than in the nonheatedsamples (Table 4). One candidate compound was vancomycin(3). We tested vancomycin for activity against our CSF surviv-al-defective mutants on YNB and were not able to reproducethe survival defects, suggesting that vancomycin is not thesurvival factor. Although our CSF was pooled from many pa-tients whose medical histories were unknown to us, mass spec-troscopy and proteomic analyses did not detect exogenouscompounds other than pipotiazine sulfoxide and vancomycin,and this thus decreased the likelihood that our human CSFsamples were contaminated with other administered drugs. Infact, several random human CSF pools produced similar re-sults. Further investigations will be necessary to uncover whichcompound(s) is responsible for this survival defect, but we havecompiled a list containing additional potential CSF survivaleffectors (Table 4).

Although the survival in CSF of our mutants was signifi-cantly decreased compared to that in BAL fluid and FBS,survival in FBS was also significantly different from that inBAL fluid for the ENA1� mutant (P � 0.01) (Fig. 3E). Thisfinding may suggest that the survival-limiting effector(s) for theena1� mutant may originate in the CSF and may escape intothe serum through the blood-CSF barrier. Outside the CSF,the survival effector is “diluted out” by the increased serumvolume and the high serum/CSF protein ratio of 250 (58). Infact, it has also previously been shown that blood has anticryp-tococcal components (47), although the yeast can survive inblood.

Ena1, Rub1, and Pik1 are required for C. neoformans patho-genesis. The ena1�, rub1�, and pik1� mutants display severeattenuation of virulence in a rabbit model of cryptococcalmeningitis and confirm the importance of those proteins to theCSF survival phenotype. Ena1 is a P-type ATPase cation trans-porter. In S. cerevisiae, it controls the efflux of multiple mono-valent ions, including Na, Li, and possibly K ions (21).Furthermore, the Ena1 homolog in Schizosaccharomycespombe, Cta3, is thought to transport Ca2 as well as K (6). Anintriguing explanation is that these ATPases developed addi-tional ion specificities due to gene duplication and specializa-tion as the fungi evolved to cope with different environments(6). For example, Sceloporus occidentalis has two Ena1-likeATPases, one for Na and the other for K, at high pHs (5).In S. cerevisiae, the regulation of Ena1 has been extensivelystudied (44). Cna1, Rim101, Hog1, and Snf1 are all known topositively affect Ena1 transcription. Recently, Idnurm et al.observed that C. neoformans Ena1 was essential for virulencein a murine inhalation model and that it is sensitive to alkalinepHs (28). Since the pH of the CSF in vivo is tightly regulatedat pH 7.4, the virulence attenuation and CSF survival defect ofour ena1� mutant was likely not due to alkaline conditions.Our preliminary transcription profiling of yeast cells takendirectly from the CSF of rabbits showed that ENA1 is highlyupregulated in C. neoformans at days 1 and 7 postinfection ina rabbit model of meningitis, further demonstrating the impor-

tance of Ena1 for CSF persistence (unpublished data). Finally,Liu et al. also showed that an ena1� mutant was less fit thanthe WT in a competition assay in the lung (35).

Nedd8/Rub1 is a ubiquitin-like protein that posttranslation-ally modifies, or neddylates, cullin proteins, subunits of E3ubiquitin protein ligases. Rub1 is currently known only to bindto cullins, notably CDC53 in budding yeast. Besides the impor-tance of the Rub1/Cdc53 complex for E3 function, the precisefunction of Rub1 conjugation is unclear (39). Defects in theneddylation pathway display severe defects in cell growth anddevelopment, ranging from cell cycle arrest in S. pombe toarrest in embryonic development for C. elegans (30). A currenthypothesis for the reason for neddylation is for facilitating theattachment of ubiquitin E2 to the E3 ligase to allow for effi-cient proteosome targeting of proteins (31). We showed thatrub1� mutants exhibit severe survival defects when grown inCSF (Fig. 2B). Perhaps this is due to the mutant’s inability toachieve optimal protein degradation as it is upregulating genesand turning over proteins in response to the potentially hostileCSF environment. Also, the rub1� mutant showed a partialtemperature sensitive (ts) growth defect at 37°C. Generally, tsmutants survive poorly in the rabbit, yet the rub1� mutant alsoshowed attenuated virulence in C. elegans at a permissive tem-perature of 25°C. Thus, RUB1 may play several subtle roles incryptococcal disease.

PIK1 is a 1-phosphatidylinositol-4-kinase (PI4K) and func-tions in the inositol metabolism and phosphatidylinositol sig-naling pathways. The kinase catalyzes the first step in thesynthesis of phosphatidylinositol phosphates (PIPs), the con-version from phosphatidylinositol (PI) to phosphatidylinositol-4-phospate (PI4P). Besides being structural components ofplasma membranes, PIPs regulate a wide variety of cellularfunctions, including cell wall integrity, actin cytoskeleton orga-nization, and vesicle-mediated membrane trafficking. Throughcleavage by phospholipase C, PIPs are precursors to inositolphosphates (IPs), which are intracellular signaling moleculeswith multiple functions, such as Ca2 release (7, 49). Becauseof their multifaceted nature, it is unclear which aspect is re-sponsible for the CSF survival defect of this mutant. Recently,1-phosphatidylinositol-3-kinase (PI3K) was found to be re-quired for the formation of autophagic vesicles under nutrientstarvation and linked to the virulence of C. neoformans (23).Nutrient starvation, however, is not likely responsible for thesevere CSF phenotype because the pik1� mutant survived likethe WT in minimal media such as PBS and CSF itself containsreadily available carbon sources (55). Additionally, pik1�strains survived like the WT when placed under osmotic stress(Fig. 4A); thus, cell integrity appears to not play a crucial rolein this CSF survival phenotype. Improper vesicle trafficking,however, appears to be a more likely cause of the CSF phe-notype of this mutant. As C. neoformans acclimates to thehostile environment of the CSF, it is probable that rapid re-modeling of the cell surface proteins and uptake of extracel-lular molecules through rapid endosomal transport will benecessary, and the inability of the pik1� mutant to efficientlyadapt may result in reduced CSF survival.

In summary, we have confirmed that CSF is a hostile micro-environment, requiring unique transcriptional and biochemicalresponses for C. neoformans to survive. We focused on 3 genesamong the 13 CSF survival-defective mutants, ENA1, RUB1,



.org/D

ownloaded from

http://iai.asm.org/

and PIK1, whose functions were found to be necessary forsurvival in CSF and intracellular compartments and for fullvirulence. Single mutations in multiple, disparate pathways canresult in CSF survival defects. Perhaps disruptions of severalcritical cellular processes will act synergistically with CSF toimpede fungal survival. Taking our data together, we posit thatin vitro CSF survival is a virulence marker for cryptococcalmeningitis. The ease of in vitro screening for CSF survival willlikely reveal additional genetic mechanisms responsible foradapting to this microenvironment. The compartments of thebody (fluids and tissues) put unique demands on fungal patho-gens, and how they are able to respond to these host environ-ments determines how effectively they produce disease. Iden-tification of mutants with reduced CSF survival may allow us topick a novel target(s) for future antifungal drug development.

ACKNOWLEDGMENTS

We thank Aimee Zaas for helpful discussions regarding the manu-script and Hana Sychrova for the BW31 strain.

J.R.P. was supported by PHS grants AI73896 and AI28388. A.L. wassupported by an A. B. Duke Memorial Scholarship and a TrinityCollege Deans’ Summer Research Fellowship.

REFERENCES

1. Ackermann, K., A. Waxmann, C. V. Glover, and W. Pyerin. 2001. Genestargeted by protein kinase CK2: a genome-wide expression array analysis inyeast. Mol. Cell. Biochem. 227:59–66.

2. Ahmed, K., D. A. Gerber, and C. Cochet. 2002. Joining the cell survivalsquad: an emerging role for protein kinase CK2. Trends Cell Biol. 12:226–230.

3. Appelbaum, P. C. 2006. The emergence of vancomycin-intermediate andvancomycin-resistant Staphylococcus aureus. Clin. Microbiol. Infect.12(Suppl. 1):16–23.

4. Bairamian, D., C. E. Johanson, J. T. Parmelee, and M. H. Epstein. 1991.Potassium co-transport with sodium and chloride in the choroid plexus.J. Neurochem. 56:1623–1629.

5. Banuelos, M. A., and A. Rodríguez-Navarro. 1998. P-type ATPases mediatesodium and potassium effluxes in Schwanniomyces occidentalis. J. Biol.Chem. 273:1640–1646.

6. Benito, B., B. Garciadeblas, and A. Rodríguez-Navarro. 2002. Potassium- orsodium-efflux ATPase, a key enzyme in the evolution of fungi. Microbiology(Reading, Engl.) 148:933–941.

7. Bennett, M., S. M. N. Onnebo, C. Azevedo, and A. Saiardi. 2006. Inositolpyrophosphates: metabolism and signaling. Cell. Mol. Life Sci. 63:552–564.

8. Blankenship, J. R., and J. Heitman. 2005. Calcineurin is required for Can-dida albicans to survive calcium stress in serum. Infect. Immun. 73:5767–5774.

9. Brown, P. D., S. L. Davies, T. Speake, and I. D. Millar. 2004. Molecularmechanisms of cerebrospinal fluid production. Neuroscience 129:957–970.

10. Chayakulkeeree, M., and J. R. Perfect. 2006. Cryptococcosis. Infect. Dis.Clin. North Am. 20:507–544.

11. Cox, G. M., T. S. Harrison, H. C. McDade, C. P. Taborda, G. Heinrich, A.Casadevall, and J. R. Perfect. 2003. Superoxide dismutase influences thevirulence of Cryptococcus neoformans by affecting growth within macro-phages. Infect. Immun. 71:173–180.

12. Cox, G. M., H. C. McDade, S. C. Chen, S. C. Tucker, M. Gottfredsson, L. C.Wright, T. C. Sorrell, S. D. Leidich, A. Casadevall, M. A. Ghannoum, andJ. R. Perfect. 2001. Extracellular phospholipase activity is a virulence factorfor Cryptococcus neoformans. Mol. Microbiol. 39:166–175.

13. Cox, G. M., J. Mukherjee, G. T. Cole, A. Casadevall, and J. R. Perfect. 2000.Urease as a virulence factor in experimental cryptococcosis. Infect. Immun.68:443–448.

14. Erickson, T., L. Liu, A. Gueyikian, X. Zhu, J. Gibbons, and P. R. Williamson.2001. Multiple virulence factors of Cryptococcus neoformans are dependenton VPH1. Mol. Microbiol. 42:1121–1131.

15. Fan, W., A. Idnurm, J. Breger, E. Mylonakis, and J. Heitman. 2007. EcaI, asarcoplasmic/endoplasmic reticulum Ca2-ATPase, is involved in stress tol-erance and virulence in Cryptococcus neoformans. Infect. Immun. 75:3394–3405.

16. Feldmesser, M., Y. Kress, P. Novikoff, and A. Casadevall. 2000. Cryptococcusneoformans is a facultative intracellular pathogen in murine pulmonary in-fection. Infect. Immun. 68:4225–4237.

17. Fraser, J. A., S. S. Giles, E. C. Wenink, S. G. Geunes-Boyer, J. R. Wright, S.Diezmann, A. Allen, J. E. Stajich, F. S. Dietrich, J. R. Perfect, and J. Heit-

man. 2005. Same-sex mating and the origin of the Vancouver Island Cryp-tococcus gattii outbreak. Nature 437:1360–1364.

18. Fraser, J. A., R. L. Subaran, C. B. Nichols, and J. Heitman. 2003. Recapit-ulation of the sexual cycle of the primary fungal pathogen Cryptococcusneoformans var. gattii: implications for an outbreak on Vancouver Island,Canada. Eukaryot. Cell 2:1036–1045.

19. Ginisty, H., F. Amalric, and P. Bouvet. 1998. Nucleolin functions in the firststep of ribosomal RNA processing. EMBO J. 17:1476–1486.

20. Gladfelter, A. S., L. Kozubowski, T. R. Zyla, and D. J. Lew. 2005. Interplaybetween septin organization, cell cycle and cell shape in yeast. J. Cell Sci.118:1617–1628.

21. Haro, R., B. Garciadeblas, and A. Rodríguez-Navarro. 1991. A novel P-typeATPase from yeast involved in sodium transport. FEBS Lett. 291:189–191.

22. Harvey, S. L., A. Charlet, W. Haas, S. P. Gygi, and D. R. Kellogg. 2005.Cdk1-dependent regulation of the mitotic inhibitor Wee1. Cell 122:407–420.

23. Hu, G. W., M. Hacham, S. R. Waterman, J. Panepinto, S. Shin, X. G. Liu, J.Gibbons, T. Valyi-Nagy, K. Obara, H. A. Jaffe, Y. Ohsumi, and P. R. Wil-liamson. 2008. PI3K signaling of autophagy is required for starvation toler-ance and virulence of Cryptococcus neoformans. J. Clin. Invest. 118:1186–1197.

24. Husted, R. F., and D. J. Reed. 1977. Regulation of cerebrospinal fluidbicarbonate by the cat choroid plexus. J. Physiol. (Lond.) 267:411–428.

25. Icehour, C. R., D. L. Toffaletti, and J. R. Perfect. 2006. Abstr. 106th Gen.Meet. Am. Soc. Microbiol., abstr. F-020.

26. Idnurm, A., Y. S. Bahn, K. Nielsen, X. Lin, J. A. Fraser, and J. Heitman.2005. Deciphering the model pathogenic fungus Cryptococcus neoformans.Nat. Rev. Microbiol. 3:753–764.

27. Idnurm, A., J. L. Reedy, J. C. Nussbaum, and J. Heitman. 2004. Cryptococcusneoformans virulence gene discovery through insertional mutagenesis. Eu-karyot. Cell 3:420–429.

28. Idnurm, A., F. J. Walton, A. Floyd, J. L. Reedy, and J. Heitman. 2009.Identification of ENA1 as a virulence gene of the human pathogenic fungusCryptococcus neoformans through signature-tagged insertional mutagenesis.Eukaryot. Cell 8:315–326.

29. Johanson, C. E., J. A. Duncan, P. M. Klinge, T. Brinker, E. G. Stopa, andG. D. Silverberg. 2008. Multiplicity of cerebrospinal fluid functions: newchallenges in health and disease. Cerebrospinal Fluid Res. 5:10.

30. Jones, D., and E. P. M. Candido. 2000. The NED-8 conjugating system inCaenorhabditis elegans is required for embryogenesis and terminal differen-tiation of the hypodermis. Dev. Biol. 226:152–165.

31. Kawakami, T., T. Chiba, T. Suzuki, K. Iwai, K. Yamanaka, N. Minato, H.Suzuki, N. Shimbara, Y. Hidaka, F. Osaka, M. Omata, and K. Tanaka. 2001.NEDD8 recruits E2-ubiquitin to SCF E3 ligase. EMBO J. 20:4003–4012.

32. Kidd, S. E., F. Hagen, R. L. Tscharke, M. Huynh, K. H. Bartlett, M. Fyfe, L.Macdougall, T. Boekhout, K. J. Kwon-Chung, and W. Meyer. 2004. A raregenotype of Cryptococcus gattii caused the cryptococcosis outbreak on Van-couver Island (British Columbia, Canada). Proc. Natl. Acad. Sci. U. S. A.101:17258–17263.

33. Lee, W., Z. Xue, and T. Melese. 1991. The NSR1 gene encodes a protein thatspecifically binds nuclear localization sequences and has two RNA recogni-tion motifs. J. Cell Biol. 113:1–12.

34. Lin, J.-J., and V. A. Zakian. 1994. Isolation and characterization of twoSaccharomyces cerevisiae genes that encode proteins that bind to (TG1-3)nsingle strand telomeric DNA in vitro. Nucleic Acids Res. 22:4906–4913.

35. Liu, O. W., C. D. Chun, E. D. Chow, C. Chen, H. D. Madhani, and S. M.Noble. 2008. Systematic genetic analysis of virulence in the human fungalpathogen Cryptococcus neoformans. Cell 135:174–188.

36. Mylonakis, E., F. M. Ausubel, J. R. Perfect, J. Heitman, and S. B. Calder-wood. 2002. Killing of Caenorhabditis elegans by Cryptococcus neoformans asa model of yeast pathogenesis. Proc. Natl. Acad. Sci. U. S. A. 99:15675–15680.

37. Mylonakis, E., A. Idnurm, R. Moreno, J. El Khoury, J. B. Rottman, F. M.Ausubel, J. Heitman, and S. B. Calderwood. 2004. Cryptococcus neoformansKin1 protein kinase homologue, identified through a Caenorhabditis elegansscreen, promotes virulence in mammals. Mol. Microbiol. 54:407–419.

38. Park, B. J., K. A. Wannemuehler, B. J. Marston, N. Govender, P. G. Pappas,and T. M. Chiller. 2009. Estimation of the current global burden of crypto-coccal meningitis among persons living with HIV/AIDS. AIDS 23:525–530.

39. Parry, G., and M. Estelle. 2004. Regulation of cullin-based ubiquitin ligasesby the Nedd8/RUB ubiquitin-like proteins. Semin. Cell Dev. Biol. 15:221–229.

40. Perfect, J. R. 2005. Cryptococcus neoformans: a sugar-coated killer withdesigner genes. FEMS Immunol. Med. Microbiol. 45:395–404.

41. Petzold, E. W., U. Himmelreich, E. Mylonakis, T. Rude, D. Toffaletti, G. M.Cox, J. L. Miller, and J. R. Perfect. 2006. Characterization and regulation ofthe trehalose synthesis pathway and its importance in the pathogenicity ofCryptococcus neoformans. Infect. Immun. 74:5877–5887.

42. Price, M. S., C. B. Nichols, and J. A. Alspaugh. 2008. Cryptococcus neofor-mans Rho-GDP dissociation inhibitor mediates intracellular survival andvirulence. Infect. Immun. 76:5729–5737.

43. Rude, T. H., D. L. Toffaletti, G. M. Cox, and J. R. Perfect. 2002. Relationship



.org/D

ownloaded from

http://iai.asm.org/

of the glyoxylate pathway to the pathogenesis of Cryptococcus neoformans.Infect. Immun. 70:5684–5694.

44. Ruiz, A., and J. Arino. 2007. Function and regulation of the Saccharomycescerevisiae ENA sodium ATPase system. Eukaryot. Cell 6:2175–2183.

45. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratorymanual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,NY.

46. Sherman, F. 2002. Getting started with yeast. Methods Enzymol. 350:3–41.47. Sridhar, S., M. Ahluwalia, E. Brummer, and D. A. Stevens. 2000. Charac-

terization of an anticryptococcal protein isolated from human serum. Infect.Immun. 68:3787–3791.

48. Stephen, C., S. Lester, W. Black, M. Fyfe, and S. Raverty. 2002. Multispeciesoutbreak of cryptococcosis on southern Vancouver Island, British Columbia.Can. Vet. J. 43:792–794.

49. Strahl, T., and J. Thorner. 2007. Synthesis and function of membrane phos-phoinositides in budding yeast, Saccharomyces cerevisiae. Biochim. Biophys.Acta 1771:353–404.

50. Tenney, K. A., and C. V. Glover. 1999. Transcriptional regulation of the S.cerevisiae ENA1 gene by casein kinase II. Mol. Cell. Biochem. 191:161–167.

51. Toffaletti, D. L., T. H. Rude, S. A. Johnston, D. T. Durack, and J. R. Perfect.1993. Gene transfer in Cryptococcus neoformans by use of biolistic delivery ofDNA. J. Bacteriol. 175:1405–1411.

52. van Roermund, C. W. T., M. de Jong, L. Ijlst, J. van Marle, T. B. Dansen,R. J. A. Wanders, and H. R. Waterham. 2004. The peroxisomal lumen inSaccharomyces cerevisiae is alkaline. J. Cell Sci. 117:4231–4237.

53. Verheggen, C., J. Mouaikel, M. Thiry, J. M. Blanchard, D. Tollervey, R.

Bordonne, D. L. Lafontaine, and E. Bertrand. 2001. Box C/D small nucleolarRNA trafficking involves small nucleolar RNP proteins, nucleolar factorsand a novel nuclear domain. EMBO J. 20:5480–5490.

54. Verleur, N. E. H. Hettema, C. W. T. van Roermund, H. F. Tabak, and R. J. A.Wanders. 1997. Transport of activated fatty acids by the peroxisomal ATP-binding-cassette transporter Pxa2 in a semi-intact yeast cell system. Eur.J. Biochem. 249:657–661.

55. Wishart, D. S., M. J. Lewis, J. A. Morrissey, M. D. Flegel, K. Jeroncic, Y.Xiong, D. Cheng, R. Eisner, B. Gautam, D. Tzur, S. Sawhney, F. Bamforth,R. Greiner, and L. Li. 2008. The human cerebrospinal fluid metabolome.J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 871:164–173.

56. Wormley, F. L., G. Heinrich, J. L. Miller, J. R. Perfect, and G. M. Cox. 2005.Identification and characterization of an SKN7 homologue in Cryptococcusneoformans. Infect. Immun. 73:5022–5030.

57. Yuan, X., and D. M. Desiderio. 2005. Proteomics analysis of human cere-brospinal fluid. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 815:179–189.

58. Yuan, X., and D. M. Desiderio. 2005. Proteomics analysis of prefractionatedhuman lumbar cerebrospinal fluid. Proteomics 5:541–550.

59. Zhu, X., and P. Williamson. 2003. A CLC-type chloride channel gene isrequired for laccase activity and virulence in Cryptococcus neoformans. Mol.Microbiol. 50:1271–1281.

60. Zougman, A., B. Pilch, A. Podtelejnikov, M. Kiehntopf, C. Schnabel, C.Kumar, and M. Mann. 2008. Integrated analysis of the cerebrospinal fluidpeptidome and proteome. J. Proteome Res. 7:386–399.

Editor: G. S. Deepe, Jr.



.org/D

ownloaded from

http://iai.asm.org/

Survival Defects of Cryptococcus neoformans Mutants ... · human CSF. A series of mutants that...

Documents

Transcript of Survival Defects of Cryptococcus neoformans Mutants ... · human CSF. A series of mutants that...