S-1

Supporting Information

Redox Engineering of Cytochrome c using DNA Nanostructure-

based Charged Encapsulation and Spatial Control

Zhilei Ge,†,‡ Zhaoming Su,§ Chad R. Simmons,† Jiang Li,‡ Shuoxing Jiang,† Wei Li,† Yang Yang,†

Yan Liu,*,† Wah Chiu,§, ǁ Chunhai Fan*,†,‡ and Hao Yan*,†

†Center for Molecular Design and Biomimetics, The Biodesign Institute, Department of

Chemistry and Biochemistry, Arizona State University, Tempe, Arizona 85287, United States

‡Division of Physical Biology & Bioimaging Center, Shanghai Synchrotron Radiation Facility,

Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800, China

§National Center of Macromolecular Imaging, Department of Bioengineering and Department of

Microbiology and Immunology, James H. Clark Center, Stanford University, Stanford, CA

94305, USA

*Corresponding Authors: hao.yan@asu.edu; fchh@sinap.ac.cn; yan_liu@asu.edu

S-2

Contents

Page

Chemicals and Oligonucleotide sequences S-3

Methods S-4

Figure S1. Schematic figure of the formation of DNA tetrahedron. S-9

Figure S2. Cryo-EM characterization of DNA tetrahedron. S-10

Figure S3. DLS Statistical analysis and AFM images of DNA tetrahedron. S-11

Figure S4. Cryo-EM raw micrographs of T1 and T2. S-12

Figure S5. Subtomogram averaging of T1. S-13

Figure S6. Conjugation of DNA to cytochrome c. S-14

Figure S7. Conjugation of Alexa Fluor 555 and cytochrome c. S-14

Figure S8. Separation of the DNA-cytochrome c conjugate. S-15

Figure S9. Polyacrylamide gel of DNA-cytochrome c conjugate. S-16

Figure S10. UV-vis spectrum of the DNA-cytochrome c conjugate. S-17

Figure S11. Size exclusion chromatography (SEC) purification of T0. S-18

Figure S12. SEC purification of cyt c caged in the DNA tetrahedron. S-19

Figure S13. UV-Vis spectra of cyt c encapsulated DNA tetrahedron. S-20

Figure S14. Cyclic voltammetry scans from the negative controls. S-22

Figure S15. Different DNA-cyt c conjugates assembly strategies. S-22

Figure S16. Current at peak position (0.39 V vs. Ag/AgCl) of T1. S-23

Figure S17. Probe density of DNA tetrahedron on gold electrodes. S-24

Table S1. Tilt-pair validation of DNA tetrahedron T0. S-25

References S-26

S-3

Chemicals

Alexa Fluor® 555 NHS Ester (Succinimidyl Ester), sulfo-SMCC (sulfosuccinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate) and tris (2-carboxyethyl) phosphine (TCEP) were ordered from ThermoFisher Scientific Company. Hexaammineruthenium(III) chloride ([Ru(NH3)6]

3+, RuHex) and cytochrome c were ordered from Sigma-Aldrich Company. NAP-5 column was purchased from GE (General Electric) Company.

Oligonucleotide sequences

All oligonucleotides were custom ordered from Integrated DNA Technologies (www.idtdna.com). The sequences were as follows:

Strand A: 5’- A TTC AGA CTT AGG AAT GTT CG A CAT GCG AGG GTC CAA TAC CG A CGA TTA CAG CTT GCT ACA CG-3’

Strand A1: 5’-NH2-TTA GGA ATG TTC GAC ATG CGA GGG TCC AAT ACC GAC GAT TAC AGC TTG CTA CAC GAT TCA GAC-3’

Strand A2: 5’-NH2-AAT GTT CGA CAT GCG AGG GTC CAA TAC CGA CGA TTA CAG CTT GCT ACA CGA TTC AGA CTT AGG-3’

Strand B: 5’-SH-ACG TAT CAC CAG GCA GTT GAG ACG AAC ATT CCT AAG TCT GAA ATT TAT CAC CCG CCA TAG TAG-3’

Strand C: 5’-SH-ACT CAA CTG CCT GGT GAT ACG AGG ATG GGC ATG CTC TTC CCG ACG GTA TTG GAC CCT CGC ATG-3’

Strand D: 5’-SH-ACG GGA AGA GCA TGC CCA TCC ACT ACT ATG GCG GGT GAT AAA ACG TGT AGC AAG CTG TAA TCG-3’

Capture Strand: 5’-SH-TTT TT GTGT GTGT GTGT GTGT GTGT-3’

Signal Probe Strand: 5’-NH2-ACAC ACAC ACAC ACAC ACAC-3’

Strand E: 5’-ATT CAG ACT TAG GAA TGT TCG ACA TGC GAG GGTCCAATAC CG ACGATTACAGCTTGCTACACGTTTTT GTGTGTGTGT GTGTGT GT GT-3’

The oligonucleotides were purified by denaturing polyacrylamide gel electrophoresis (PAGE) and quantified using UV absorbance at 260 nm.

Strands A, B, C, D forms the Tetrahedron T0. Strands A1 and A2 are amine-modified at 5’-end. They are linked to cyt c and assembled with strands B, C and D to form the tetrahedrons containing proteins at two different positions, T1 and T2. Strands B, C and D are thiol modified at the 5’-end, which provide the orientational control of the tetrahedrons when they are deposited on the gold electrode due to the strong Au-S interaction. Strand E is Strand A extended with a sequence capable to hybridize with signal probe strand, which is used to couple with cyt c.

S-4

Strand B, C, D and E forms the tetrahedron used in figure S12b. The capture strand and signal probe strand are complementary and are thiol- and amino-modified, respectively, they will bring cyt c to the gold electrode surface via a double stranded DNA.

Methods

Conjugation of cytochrome c to oligonucleotides

The two-step reaction scheme for conjugating the protein with the amino-modified oligonucleotide (A1, A2) is shown in Figure S4.1 First, the amino-modified oligos were ethanol precipitated and re-suspended in phosphate buffer (10 mM, pH 7.2) to a concentration of 1 mM. The solution was mixed with a saturated sulfo-SMCC solution (2.9 mg/mL in 10 mM phosphate buffer, pH 7.2) in 1:30 molar ratio of DNA: SMCC and incubated overnight. At the same time, cyt c (300 µM) was dissolved in 100 mM Tris-HCl buffer (pH 7.2) and reduced with a 100 fold excess of Tris (2-carboxyethyl) phosphine (TCEP) in order to reduce any potential dimers of cyt c linked through inter-chain disulfide bond allowing for all the surface thiol sites at Cys108 to be available for conjugation. Cyt c from yeast also has an intra-molecular disulfide bond (between Cys20 and Cys23) within the core of the protein. The disulfide bond at this location is also potentially to be reduced by TCEP. However, the probability of the bond reduction is much lower, compared to the surface disulfide bond between cyt c dimers. UV-vis absorbance data confirmed that the overall integrity of the cyt c structure after reduction remained intact. Due to the fact that the inner cysteines are buried beneath the surface of the protein, even if they are reduced, they are not expected to be accessible for cross-linking to the SMCC-conjugated DNA.

Next, the TCEP reduced cyt c and the sulfo-SMCC conjugated DNA were purified separately, using a NAP-5 column (GE), to remove the excess, small molecular weight TCEP and sulfo-SMCC, respectively. In the second step, the purified cyt c and the SMCC-conjugated DNA were mixed in a 1:2 molar ratio and incubated overnight at 37°C. The thiol group of Cys108 on cyt c was then reacted with the maleimidyl group of the SMCC-conjugated DNA to covalently cross-link the protein and the DNA. The final product containing one protein conjugated with one oligonucleotide was separated from any side products using fast protein liquid chromatography (FPLC). The protein-DNA conjugates were further characterized by denaturing SDS polyacrylamide gel electrophoresis, UV-vis spectroscopy and circular dichroism spectroscopy.

Signal Probe strand (amino modified) was also conjugated with cyt c following the same method, to attach cyt c directly onto a gold electrode through dsDNA hybridization with the thiolated Capture Strand.

Self-assembly of DNA tetrahedron

The DNA tetrahedra (T0, T1, and T2) were made by mixing strand A (or A1-cyt c or A2-cyt c conjugate) and strands B, C, D in equi-molar ratios to a final concentration of 500 nM of each

S-5

oligonucleotide in Tris-Magnesium buffer (10 mM Tris-HCl, 10 mM MgCl2, pH 8.0). Annealing was performed by incubating the mixture at 54°C for 3 minutes after which it was immediately placed on ice.2-5 The one-pot fast annealing step starting at a lower maximum temperature was used to avoid denaturation of the protein. The tetrahedron monomer was then purified by size exclusion chromatography (SEC) to remove any aggregated or partially formed structures.

The DNA tetrahedron used in Figure S13b was prepared by mixing strands E and B, C, D together in Tris-Magnesium buffer followed by incubation at 54°C for 3 minutes.

Alexa Fluor® 555 was conjugated with cyt c via the surface lysines (primary amine groups, and the reaction scheme shown in Figure S5). The dye conjugated protein was then used to conjugate with the DNA strands A1 and A2 to prepare the dye labeled T1 and T2. After purification, the dye labeled T1 and T2 were subject to native gel electrophoresis and imaged under fluoresence gel imager (shown in Figure 1e).

AFM imaging

2 µL sample was deposited onto a freshly cleaved mica surface (Ted Pella, Inc.) and left to adsorb for 1 min. 400 µL of 1 x TAE/Mg2+ buffer was added to the liquid cell and the sample was scanned using Scan-Assyst Fluid+ tips (Bruker, Inc.) on a Veeco 8 AFM in peak-force mode.

Cryo-EM SPA specimen preparation, data acquisition and data analysis.

In the cryo-EM experiment, 2 µL of the aforementioned purified DNA tetrahedron T0 (~5 µM) was applied onto the 200 mesh R1.2/1.3 carbon Quantifoil grid (Quantifoil Micro Tools GmbH) that had been cleaned with acetone (Sigma-Aldrich) for 12 hours and glow discharged for 40 seconds before use. The grid was blotted for 4 seconds and immediately frozen in liquid ethane using a Vitrobot Mark IV (FEI) with a constant temperature of 10 °C and 100% humidity during the process. The grid was stored in liquid nitrogen until imaging. All grids were examined on a JEM2010F (field emission gun) and a cryo-electron microscope (JEOL) operated at 200 kV, spot size 2, condenser aperture 70 µm, objective aperture 60 µm. Images were recorded under low-dose conditions on a direct detection device (DDD) (DE-12 3k×4k camera, Direct Electron, LP) while operating in movie mode at a recording rate of 25 raw frames per second at 25,000×microscope magnification (corresponding to a calibrated sampling of 2.01 Å/pixel) and a dose of 75 electrons/Å with defocus ranging from 1.5–3 µm.

A total of 93 images were recorded on a DE-12 detector. Motion correction was performed by running averages of 3 consecutive frames with the DE_process_frames.py script (Direct Electron, LP). A total of 16,856 particle images were manually boxed, contrast transfer function corrected and extracted using the EMAN2 (Tang et al., 2007) program with a box size of 96 × 96 pixels. Three rounds of reference free 2D class, averaging yielded 9,264 particles, were used as the input for the final 3D reconstruction with tetrahedron symmetry applied. Resolution for the final map was estimated by using the 0.143 criterion of the Fourier shell correlation (FSC) curve

S-6

without any mask. A Gaussian low-pass filter was applied to the final 3D maps displayed in the Chimera UCSF software package.

Tilt-pair validation for the cryo-EM map was performed by collecting data at two goniometer angles, 0° and 14°, for each region of the grid. The test was performed using the e2tiltvalidate.py program in EMAN2.6-7 Additional details on the tilt-pair validation is provided in Table S1.

Cryo-ET specimen preparation, data acquisition and data analysis.

2 µl of the aforementioned cyt c encapsulated DNA tetrahedron T1 (~3 µM) solution was mixed with gold particles of 60 Å in diameter prior to application onto glow-discharged (40 seconds) 200-mesh R1.2/1.3 Quantifoil grids. The grids were blotted for 3 seconds and rapidly frozen in liquid ethane using a Vitrobot Mark IV (FEI). The samples were loaded in a JEM3200FSC equipped with K2 summit detector as mentioned above. Tilt series were collected at 20,000× magnification from −60° to +60° with 4° increment. K2 summit was operated in counting mode with a recording rate of 5 raw frames per second and a total exposure time of 3 seconds, yielding 15 frames for each tilt. The total dose was ~100 e-/Å2 with the intended defocus set to 5 µm in SerialEM for each tilt series. 3D reconstruction for each tilt series was performed in IMOD tracked with gold fiducial markers.

27 subtomograms were manually selected and aligned to the cryo-EM SPA reconstruction applied with a Gaussian filter low passed to 50 Å using e2spt_align.py in EMAN2. Subtomogram averaging was applied to the aligned subtomograms using e2spt_average.py in EMAN2. Final 3D maps were analyzed and displayed in the Chimera UCSF software package.

Polyacrylamide gel electrophoresis

SDS denaturing polyacrylamide gel electrophoresis (SDS PAGE) was performed on a 4-12% Bis-Tris pre-cast polyacrylamide gel in Morpholine Ethane Sulfonic Acid (MES) NuPAGE buffer (Life technologies) at 180 V for 45 mins. The gel was stained first with coomassie blue and then with ethidium bromide to sequentially reveal the protein and DNA.1

Native PAGE was run in TAE/Mg2+ buffer at 250 V for 3 hours (Tris-acetic acid 40 mM, pH 8.0, magnesium acetate 12.5 mM, EDTA 1 mM) on a 6% polyacrylamide gel (19:1 acrylamide: bisacrylamide). Fluorescent imaging of DNA tetrahedron with Alexa Fluro 555 labeled on surface of cyt c was conducted with a Typhoon 9410 variable mode imager.8-9

UV-vis and circular dichroism spectroscopy

The UV-vis absorption spectra of the wild type cyt c and its DNA conjugate were recorded at 25°C using a Nanodrop Photometer (Implen Ltd.). Circular dichroism (CD) spectra were collected with Chirascan (Applied Photophysics Ltd.) using a 0.1 cm cuvette at 25°C. The CD spectra were averaged with four scans in the far-UV (250-180 nm) and the Soret (450-350 nm) regions, with the concentrations of protein at 7 and 35 µM in 2 mM HEPES buffer, respectively.

S-7

Preparation of the gold electrodes

Gold electrodes (2 mm in diameter, CH Instruments Inc.) were first polished with a microcloth (CH Instruments Inc.) saturated with a Gamma alumina suspension (0.05 µm, CH Instruments Inc.) for 3 min. The polished electrodes were sonicated in ethanol and then in Milli-Q water for 4 min each, respectively. Finally, the electrodes were electrochemically cleaned following the procedure outlined previously.10 Briefly, residual impurities were first removed from the gold electrodes through electrochemical oxidation and reduction of the metal by applying a positive 2 V potential for 5 s, followed by a negative potential of -0.35 V for 10 s. Then 5-10 cycles of cyclic voltammetry (CV) were run in 3 mL of 0.5 M H2SO4 solution using a potential range of -0.3 to 1.55 V vs. Ag/AgCl and a scan rate at 4 Vs-1. The cleanliness of the gold electrodes was subsequently checked by running a CV cycle in a fresh 0.5 M H2SO4 solution using a potential range of -0.3 to 1.55 V vs. Ag/AgCl at a scan rate of 0.1 Vs-1. These steps were repeated until a typical cyclic voltammogram of clean gold electrodes was confirmed. All electrochemical measurements (cyclic voltammetry and alternating current voltammetry measurements) were carried out with a CHI 630b electrochemical workstation (CH Instruments Inc., Austin, TX). A conventional three-electrode configuration was employed, involving a gold working electrode, a platinum wire auxiliary electrode, and an Ag/AgCl (3M KCl) reference electrode.

The solution containing the pre-formed, SEC purified DNA tetrahedron with cyt c sample (3 µL 0.5 µM) in Tris-Mg buffer (10 mM Tris-HCl, 10 mM MgCl2, pH 8.0) was pipetted onto the freshly cleaned gold electrode surface and incubated for 3 hours at room temperature to allow thiol-gold binding. An electrode cap was used to prevent the sample from drying on the electrode. All solutions were freshly prepared using analytical reagent grade chemicals and high purity water (18.2 MΩ cm resistivity, Millipore).

Electrochemical Measurements

Electrochemical measurements were performed with a Model CHI 630 electrochemical workstation (CH Instruments, Inc., Austin, TX) and a conventional three-electrode configuration was employed throughout the experiment, which involved a gold working electrode, a platinum wire auxiliary electrode, and an Ag/AgCl (3 M KCl) reference electrode.

Cyclic voltammetry (CV) was carried out at a scan rate of 50 mV/s in 10 mM phosphate buffer (pH 7.0).

Chronocoulometry (CC) measurements of redox charges of hexaamineruthenium (III) chloride ([Ru(NH3)6]

3+, RuHex) were conducted at a pulse period of 250 ms and pulse width of 700 mV. The electrolyte buffer (10 mM Tris-HCl solutions, pH 7.4) was thoroughly purged with nitrogen before experiments. RuHex molecules stoichiometrically bind to the anionic phosphodiester backbone of DNA, thus quantitatively reflecting the amount of DNA strands at the electrode surface.11

S-8

When an electrode modified with DNA is placed in a low ionic strength electrolyte containing a mulitivalent redox cation, the redox cation exchanges with the native charge compensation cation and becomes electrostatically trapped at that interface. The redox charge (Q) of RuHex can be calculated from the chronocoulometric intercept at t = 0. Chronocoulometry can conveniently separate the diffusion-based RuHex redox process from the surface-confined RuHex redox process, thus providing an accurate approach to measure redox charges of RuHex confined at the electrode surface.12

An attractive aspect of chronocoulometry is that the double-layer charge and the charge due to reaction of species adsorbed on the electrode surface can be differentiated from the charge due to reaction of redox molecules that diffuse to the electrode surface. Consequently, measurements of surface-confined redox species can be made in the presence of solution redox marker so that the system is observed under equilibrium conditions. The integrated current, or charge Q, as a function of time t in a chronocoulometric experiment is given by the integrated Cottrell expression,

= [(201/2

∗)/ (π1/2)] 1/2++Γ0 (1)

where n is the number of electrons per molecule for reduction, F the Faraday constant (C/equiv), A the electrode area (cm2), D0 the diffusion coefficient (cm2/s), C0

* the bulk concentration (mol/cm2), Qdl the capacitive charge (C), and nFAΓ0 the charge from the reduction of Γ0 (mol/cm2) of adsorbed redox marker. The term Γ0 designates the surface excess and represents the amount of redox marker confined near the electrode surface. The chronocoulometric intercept at t = 0 is then the sum of the double-layer charging and the surface excess terms. The surface excess is determined from the difference in chronocoulometric intercepts for the identical potential step experiment in the presence and absence of redox marker.

The saturated surface excess of redox marker is converted to DNA probe surface density with the relationship,

ΓDNA = Γ0 (z/m)(NA) (2)

where ΓDNA is the probe surface density in molecules/cm2, m is the number of bases in the probe DNA, z is the charge of the redox molecule, and NA is Avogadro’s number.

Alternating current voltammetry (ACV) scans were performed using a potential window -0.3 to 0.5 V (versus Ag/AgCl), a potential step of 0.001 V, an amplitude of 0.05 V and a frequency of 60 Hz. The electrolyte and reaction buffer used in this study was 10 mM phosphate buffer (pH 7.0) with 1 M NaCl. The ACV shown is baseline subtracted.

S-9

Figure S1. Schematic figure of the formation of DNA tetrahedron. Four different 63nt DNA strands are mixed in stoichiometric equivalents in buffer, heated, and then rapidly cooled to 4 . Each of the six edges of the tetrahedron is made from one of six 21-base “edge subsequences” hybridized to its complement, Edge subsequences were designed to minimize the strength of undesirable interactions between them. Each of the four strands contains three of these subsequences, or their complements, runs round one of the four faces of the tetrahedron and is hybridized to the three oligonucleotides running round the adjacent faces at the shared edges.

S-10

Figure S2. Cryo-EM characterization of DNA tetrahedron T0. A) Raw cryo-EM micrograph with visible T0 particles. B) 2D reference free class averages of DNA tetrahedron T0. C) Gold-standard FSC plot for the 3D reconstruction. D) Tilt-pair validation result. The red circle shows particle pairs that cluster around the experimental tilt geometry.

S-11

Figure S3. Dynamic Light Scattering (DLS) analysis and AFM images for T0 (a), T1 (b) and T2 (c). Scale bar in AFM images:100 nm. Both the DLS statistical analysis and the AFM images showed that the tetrahedron structures with cyt c were well-formed and monodisperse. DLS analysis showed that mean diameter of T0, T1 and T2 was 10.6 ± 0.7 nm, 12.2 ± 1.2 nm, 14.5 ± 5.0 nm respectively, while the statistical analysis of the AFM measurements for T0, T1 and T2 was 16.0 ± 1.0 nm (24 particles), 16.2 ± 1.4 nm (22 particles), 15.5 ± 1.9 nm (51particles) respectively.

S-12

Figure S4. Cryo-EM raw micrographs of T1 and T2. (A) T1 is relatively well dispersed under cryo-EM condition. (B) T2 is slightly crowded and not well dispersed under cryo-EM condition.

S-13

Figure S5. Subtomogram averaging of T1. (A) Projection of the raw tomogram along Z axis. (B) Representative T1 subtomograms extracted from the raw tomogram. (C) Subtomogram averaging of T1. (D) FSC curve of T1 subtomogram averaging.

S-14

Figure S6. Two-step reaction scheme for the conjugation of amino-modified DNA to cytochrome c via the maleimidyl group of sulfo-SMCC.

Figure S7. Reaction scheme for the conjugation of the NHS ester (or succinimidyl ester) of Alexa Fluor® 555 and with cytochrome c via the surface lysines (primary amine groups).

S-15

Figure S8. Separation and purification of the DNA-cytochrome c conjugate by Fast Protein Liquid Chromatography (FPLC). The three peaks in the blue trace represent free cytochrome c, DNA-cytochrome c conjugate and free DNA, respectively. Light green trace is the salt gradient and the red vertical bars represent the separated chromatography fractions.

S-16

Figure S9. a) SDS denaturing polyacrylamide gel showing the product of DNA-cytochrome c after coomassie blue staining. Lane 1 is the protein ladder, Lane 2 is the reduced cyt c, Lane 3 is free DNA and lane 4 is the DNA-cyt c conjugate. Molecular weight of cyt c is ~12.6 KDa, and the molecular weight of A1 strand is ~19.6 KDa. b) The same SDS gel shown in panel (a) after ethidium bromide staining. The band in lane 4 was observed in both gels, confirming the presence of both protein and DNA in the conjugate.

S-17

Figure S10. UV-vis spectrum of the DNA-cyt c conjugate. Given the extinction coefficients of DNA at 260 nm and cyt c at 410 nm, the label ratio of DNA and cytochrome c was calculated to be ~1:1 in both cases.

200 400 600

0.0

0.3

0.6

Absorbance

λλλλ/nm

A1 DNA-cyt c

A2 DNA-cyt c

S-18

Figure S11. SEC purification of T0 (left) which shows three peaks and native gel electrophoresis (5% polyacrylamide) of the fractions collected from the SEC (right). Lane 1, DNA tetrahedon (unpurified); Lane 2, 100 bp ladder; Lane 3-5, fractions from the first peak, representing aggrregation and multimers; Lane 6-7, fractions from the second peak, tetrahedron dimers; Lane 8-10, fractions from the last peak, tetrahedron monomers. The fractions in the last three lanes were observed at the position consistent with the unpurified sample shown in lane 1 demonstrating the purity of the monomeric structure.

S-19

Figure S12. Size exclusion chromatography purification of cyt c caged in the DNA tetrahedron. a) Strands B, C, D and the cyt c linked strand A were mixed together in 1xTAE-Mg2+ buffer and quickly annealed from 54°C to 0°C to form the tetrahedron structure. After size exclusion separation, the tetrahedron monomer (marked by the red arrow) was collected and concentrated before electrochemical studies. The upper trace absorbance is at 260 nm, and the lower trace absorbance is at 280 nm. b) 5% Native PAGE gel image. Lane 1: 100bp DNA ladder; Lane 2: Unpurified DNA tetrahedron; Lane 3: DNA tetrahedron purified by size exclusion chromatography; Lane 4: cyt-c linked DNA tetrahedron structure (T1) purified by size exclusion chromatography.

S-20

Figure S13. UV-Vis spectra of cyt c encapsulated DNA tetrahedron. DNA tetrahedrons with cyt c inside or outside were annealed and purified by native PAGE gels. The DNA tetrahedron samples have an apparent absorbance peak around 410 nm which is the indicative signal for cyt c. From the absorbance value of 260 nm and 410 nm, it is easy to calculate that each DNA tetrahedron structure has one cyt c protein molecule.

The DNA-protein conjugation was carried out following a two-step reaction scheme (Figure S4). After FPLC purification (Figure S6), the DNA-cyt c conjugate with 1:1 ratio was separated from the free DNA and the free cyt c due to their different charge to mass ratios. The FPLC fractions containing the desired conjugate were then pooled and concentrated, and then subjected to characterization using SDS denaturing gel electrophoresis (Figure S7). The gel images showed that the DNA-cyt c conjugate had a slower mobility, compared with that of the free cyt c and free DNA. The DNA-cyt c conjugate was also quantified using UV-vis absorption spectrum (Figure S8), which revealed the co-existence of DNA and cyt c. Based upon the extinction coefficient of DNA (ε260nm = 615700 L mole-1 cm-1) and cyt c (ε410nm = 106100 L mole-1 cm-1), the label ratio of DNA and cyt c was calculated to be 1:1.06. This result confirmed that the DNA-cyt c conjugate was indeed at 1:1 molar ratio, and was consistent with the previous determination that only the surface cysteine of cyt c reacted to form the conjugate as described above. The yield of the conjugation reaction was estimated to be over 70% based upon the FPLC chromatograph.

The purified DNA-protein conjugate, A1-cyt c or A2-cyt c, was mixed with the other three oligonucleotides B, C, D in equimolar ratios and annealed to form the DNA tetrahedron with cyt c attached at two different positions. The assembled structures were then subjected to size exclusion chromatograph separation (SEC) to remove any larger sized aggregates (oligomers) and partially formed structures (due to imperfect stoichiometry of the strand mixture) (shown in Figure S9). The arrow in the chromatograph (Figure S10a) marks the peak containing the monomer of DNA tetraheda with cyt c attached. Native polyacrylamide gel electrophoresis (5% PAGE) was used to confirm the formation of the tetrahedron structure and demonstrated the purity of the SEC purified tetrahedron (Figure S10b). The DNA tetrahedron with cyt c had slightly slower electrophoretic mobility as compared with the purified DNA tetrahedron alone. The FPLC purified DNA tetrahedron samples were then gel purified, by electrophoresis for 2

S-21

hours at 250 V and 15, after which the corresponding bands were then extracted for further analysis. Figure S11 shows UV spectra of a purified DNA tetrahedron sample with cyt c. The extinction coefficient of DNA tetrahedron and cyt c suggested that each DNA tetrahedron sample contained one cyt c molecule.

S-22

Figure S14. Cyclic voltammetry scans from the negative controls. From left to right: bare gold electrode, DNA tetrahedra alone (T0) and DNA tetrahedra with linker molecular SMCC (T0 with SMCC) deposited on gold electrode, respectively.

Figure S15. Different DNA-cyt c conjugates assembly strategies on gold electrodes and cyclic voltammetry scans. a) direct attachement of DNA-cyt c conjugates with 20 base pairs; b) attachement of DNA-cyt c conjugate with 20 base pairs on the top vertext of a DNA tetrahedron. All CV scans were taken at a scan rate of 50 mV/s and under the reference electrode Ag/AgCl (3 M).

S-23

Figure S16. Current at peak position (0.39 V vs. Ag/AgCl) of T1 using different scan rates during CV scans. The peak current is linear to the scan rate, meaning that the redox reaction occurring on the gold electrode is surface-controlled.

We collected the peak current for T1 at different voltage scan rates. The current showed a linear dependence on the scan rate, which meant that the electron transfer of cyt c on the gold electrode was surface-controlled, due to the electron transfer reaction occurring on the surface, rather than a diffusion-controlled process occurring in bulk solution and subsequently diffusing to the electrode. This result also clearly indicated that cyt c was indeed located on the gold surface.

S-24

Figure S17. Probe density of DNA tetrahedron on gold electrodes. Chronocoulometry curves for DNA tetrahedra assembled on gold electrodes before and after addition of RuHex. From the charge change, the surface coverage of DNA tetrahedra on the surface is calculated to be (3.25±0.13) ×1012 per tetrahedron/cm2. The experiments were taken from three different electrodes.

Chronocoulometric interrogation of the redox reaction of hexaamineruthenium (III) chloride ([Ru(NH3)6]

3+, RuHex) had been developed to quantitatively characterize the amount of DNA strands localized on the electrode surface.11-13 This is based on the fact that the RuHex cations electrostatically bind to the negatively charged DNA strands in a stoichiometric fashion. As shown in Figure S15, the charge carried by RuHex that binds to the DNA origami on an electrode is measured to be (1.37 ± 0.05) µC, from which the number of assembled DNA tetrahedra was calculated to be (3.25 ± 0.13) ×1012 per cm2. Based upon the size of the structure (∼ 7 nm length triangle shape), the surface coverage on the gold electrode (D = 2 mm) is estimated to be ~ 46%.

0.0 0.3 0.6

0

2

4

∆∆∆∆Q

Before addition of Ru3+

After additon of Ru3+

Time1/2/s

1/2

Charge/ µµ µµC

S-25

Table S1. Tilt-pair validation of DNA tetrahedron T0

# Total particle pairs 73

# Particle pairs in cluster 31

Fraction in cluster (%) 42.4

Mean tilt angle (o) 12.5

RMSD tilt angle (o) 4.79

Mean tilt axis (o) 147

RMSD tilt axis (o) 45.3

Experimental tilt angle (o) 14.2

S-26

References

(1) Erben, C. M.; Goodman, R. P.; Turberfield, A. J., Single-molecule protein encapsulation in a rigid DNA cage. Angew. Chem. Int. Ed. 2006, 45 (44), 7414-7417. (2) Goodman, R. P.; Berry, R. M.; Turberfield, A. J., The single-step synthesis of a DNA tetrahedron. Chem. Commun. 2004, (12), 1372-1373. (3) Goodman, R. P.; Schaap, I. A. T.; Tardin, C. F.; Erben, C. M.; Berry, R. M.; Schmidt, C. F.; Turberfield, A. J., Rapid chiral assembly of rigid DNA building blocks for molecular nanofabrication. Science 2005, 310 (5754), 1661-1665. (4) Lin, M.; Wang, J.; Zhou, G.; Wang, J.; Wu, N.; Lu, J.; Gao, J.; Chen, X.; Shi, J.; Zuo, X.; Fan, C., Programmable Engineering of a Biosensing Interface with Tetrahedral DNA Nanostructures for Ultrasensitive DNA Detection. Angew. Chem. Int. Ed. 2015, 54 (7), 2151-2155. (5) Pei, H.; Lu, N.; Wen, Y.; Song, S.; Liu, Y.; Yan, H.; Fan, C., A DNA Nanostructure-based Biomolecular Probe Carrier Platform for Electrochemical Biosensing. Adv. Mater. 2010, 22 (42), 4754-4758. (6) Galaz-Montoya, J. G.; Flanagan, J.; Schmid, M. F.; Ludtke, S. J., Single particle tomography in EMAN2. J. Struct. Biol. 2015, 190 (3), 279-290. (7) Tang, G.; Peng, L.; Baldwin, P. R.; Mann, D. S.; Jiang, W.; Rees, I.; Ludtke, S. J., EMAN2: an extensible image processing suite for electron microscopy. J. Struct. Biol. 2007, 157 (1), 38-46. (8) Fu, J.; Yang, Y. R.; Johnson-Buck, A.; Liu, M.; Liu, Y.; Walter, N. G.; Woodbury, N. W.; Yan, H., Multi-enzyme complexes on DNA scaffolds capable of substrate channelling with an artificial swinging arm. Nat. Nanotech. 2014, 9 (7), 531-536. (9) Ke, G.; Liu, M.; Jiang, S.; Qi, X.; Yang, Y. R.; Wootten, S.; Zhang, F.; Zhu, Z.; Liu, Y.; Yang, C. J.; Yan, H., Directional Regulation of Enzyme Pathways through the Control of Substrate Channeling on a DNA Origami Scaffold. Angew. Chem. Int. Ed. 2016, 55 (26), 7483-7486. (10) Zhang, J.; Song, S. P.; Wang, L. H.; Pan, D.; Fan, C. H., A gold nanoparticle-based chronocoulometric DNA sensor for amplified detection of DNA. Nat. Protoc. 2007, 2 (11), 2888-2895. (11) Steel, A. B.; Herne, T. M.; Tarlov, M. J., Electrochemical quantitation of DNA immobilized on gold. Anal. Chem. 1998, 70 (22), 4670-4677. (12) Zhang, J.; Song, S.; Zhang, L.; Wang, L.; Wu, H.; Pan, D.; Fan, C., Sequence-specific detection of femtomolar DNA via a chronocoulometric DNA sensor (CDS): effects of nanoparticle-mediated amplification and nanoscale control of DNA assembly at electrodes. J. Am.

Chem. Soc. 2006, 128 (26), 8575-8580. (13) Ho, P. S.; Frederick, C. A.; Saal, D.; Wang, A. H.; Rich, A., The interactions of ruthenium hexaammine with Z-DNA: crystal structure of a Ru(NH3)6

+3 salt of d(CGCGCG) at 1.2 Å resolution. J. Biomol. Struct. Dyn. 1987, 4 (4), 521-534.