Supporting Information - PNAS · 2010. 8. 26. · Supporting Information Claesen and Bibb...
10
Supporting Information Claesen and Bibb 10.1073/pnas.1008608107 SI Materials and Methods PCR Targeting. PCR targeting primer couples (orf1 F/orf1 R) to (cypI F/cypI R) were used to amplify an apramycin resistance cassette from pIJ773 that also contains an oriT and is flanked by Flippase recombination enzyme (FLP) recognition sites. The resulting cassettes were used to delete orf1 to cypI in pIJ12404, resulting in cosmids pIJ12422–pIJ12430. These constructs were introduced into Streptomyces sp. OH-4156 by conjugation and selecting for apramycin resistance. Screening the apramycin- resistant exconjugants for loss of kanamycin resistance (encoded by neo of SuperCosI) identified double cross-over mutants M1427–M1435 that each have a single wild-type ORF (orf1 to cypI) replaced by the pIJ773-derived cassette. The mutants were confirmed by PCR analysis using the corresponding primer couples (orf1 T1/orf1 T2) to (cypI T1/cypI T2). To avoid any polar effects of the mutations on the expression of downstream genes, we also constructed in-frame (scar) deletion mutations for all the putative cyp genes (orf1 to cypI). These mutations were made by introducing pIJ12422–pIJ12430 into Escherichia coli BT340 and growth at 42 °C. This procedure resulted in the FLP-mediated excision of the apramycin resistance cassette, leaving an 81-bp in-frame ‘scar’ sequence (1) and yielding pIJ12431–pIJ12439 (Δorf1–ΔcypI). Derivatives capable of integrating into the chro- mosome of a Streptomyces host were made by inserting a 5.2-kb SspI fragment from pIJ10702 that contained oriT, the apramycin re- sistance gene [aac(3)IV], and the ϕC31 attP site and integrase gene by PCR targeting. The resulting cosmids (pIJ12440–pIJ12448) were transferred to S. coelicolor M1146, where stable integration at the ϕC31 attB site occurred; no antibiotic selection was required to maintain the cosmids after integration. Each of the resulting strains (M1413–M1421) contained a cosmid with an individual gene (Δorf1–ΔcypI, respectively) of the putative minimal gene set re- placed by a scar sequence. Similarly, cypA-containing cosmids from the S. sp. OH-4156 genomic library identified by hybridization (pIJ12400–pIJ12408) were targeted with the 5.2-kb pIJ10702 SspI fragment to yield in- tegrative versions (pIJ12409–pIJ12417, respectively). These cos- mids then were introduced into Streptomyces venezuelae ATCC 10712 by conjugation, yielding strains M1400–M1409. Construction of Fusion Proteins. Gateway primer couples (Gat cypA F/Gat cypA R, Gat cypD F/Gat cypD R, and Gat cypM F/Gat cypM R) were used to amplify cypA, cypD, and cypM, respectively. The resulting PCR products were introduced into the pDONR207 entry vector and shuttled into the pHM-GWA destination vector following the protocol of the Gateway cloning kit (Invitrogen). The resulting plasmids pIJ12489 (cypA), pIJ12493 (cypD), and pIJ12494 (cypM) were introduced into E. coli BL21 (DE3) by transformation. Recombinant 6-His–tagged maltose-binding protein (MBP)-CypA, 6-His–tagged MBP-CypD, and 6-His–tag- ged MBP-CypM were purified from 3 L of Lennox medium [L medium; tryptone 10 g/L, yeast extract 5 g/L, NaCl 5 g/L (2)] after induction with 0.5 mM isopropyl-β-D-1-thiogalactopyranoside at 30 °C for 4 h. Cell pellets were resuspended in 40 mL lysis buffer (50 mM Tris HCl, pH 7.9, 10% glycerol, 1 mM phenyl- methanesulfonyl fluoride), lysed with a French press, and the cell lysate was clarified by centrifugation (20 min at 40,000 × g). The cleared lysate was applied to a 1-mL Ni2 + -loaded Hi-Trap Che- lating HD column (GE Healthcare), washed with 25 mM K 2 HPO 4 (pH 7.9), 200 mM NaCl, and 20 mM imidazole, and eluted with an imidazole gradient. The eluted proteins were di- alyzed into storage buffer [50 mM Tris HCl (pH 7.9), 50 mM NaCl, 1 mM Tris(2-carboxyethyl) phosphine (TCEP)], aliquoted, and stored at −80 °C. Protein concentrations were determined by a Bradford assay according to the manufacturer’s instructions (Bio-Rad). BSA was used as the protein standard. We obtained preproCypA by digestion of 6-His–tagged MBP-CypA with to- bacco etch virus protease following the Invitrogen protocol. CypD Assay. We incubated 6-His–tagged MBP-CypD (∼25 μM) with the preproCypA substrate (∼120 μM) at 30 °C in a 20-μL volume at pH 7.9 (50 mM Tris HCl) under reducing conditions (2 mM TCEP). After 6 h incubation, the reaction mixture was analyzed by MALDI-TOF MS. The substrate peak with a mass of 6,087 Da was partially converted into a peak of 6,041 Da (Fig. S7 A and B). The 46-Da difference in mass is in good agreement with the removal of two hydrogen atoms and one molecule of CO 2 . CypM Assay. We incubated 6-His–tagged MBP-CypM (∼7.5 μM) with nonmethylated cypemycin (unknown concentration) at 30 °C in a 20-μL volume at pH 7.9 (50 mM Tris HCl) under reducing conditions (2 mM TCEP) in the presence of added S-adenosyl methionine (2.5 mM) and MgCl 2 (10 mM). After 3 h incubation, the reaction mixture was analyzed by MALDI-TOF MS. The peaks corresponding to the nonmethylated substrate ([M+H] + = 2,068 Da; [M+Na] + = 2,090 Da; [M+K] + = 2,106 Da) were mostly converted into mature cypemycin ([M+Na] + = 2,118 Da; [M+K] + = 2,134 Da) by the addition of CypM (Fig. S7 C and D). 1. Gust B, et al. (2004) Lambda Red-mediated genetic manipulation of antibiotic- producing Streptomyces. Adv Appl Microbiol 54:107–128. 2. Lennox ES (1955) Transduction of linked genetic characters of the host by bacteriophage P1. Virology 1:190–206. Claesen and Bibb www.pnas.org/cgi/content/short/1008608107 1 of 10
Transcript of Supporting Information - PNAS · 2010. 8. 26. · Supporting Information Claesen and Bibb...
Supporting InformationClaesen and Bibb 10.1073/pnas.1008608107SI Materials and MethodsPCR Targeting. PCR targeting primer couples (orf1 F/orf1 R) to(cypI F/cypI R) were used to amplify an apramycin resistancecassette from pIJ773 that also contains an oriT and is flanked byFlippase recombination enzyme (FLP) recognition sites. Theresulting cassettes were used to delete orf1 to cypI in pIJ12404,resulting in cosmids pIJ12422–pIJ12430. These constructs wereintroduced into Streptomyces sp. OH-4156 by conjugation andselecting for apramycin resistance. Screening the apramycin-resistant exconjugants for loss of kanamycin resistance (encodedby neo of SuperCosI) identified double cross-over mutantsM1427–M1435 that each have a single wild-type ORF (orf1 tocypI) replaced by the pIJ773-derived cassette. The mutants wereconfirmed by PCR analysis using the corresponding primercouples (orf1 T1/orf1 T2) to (cypI T1/cypI T2). To avoid any polareffects of themutations on the expression of downstreamgenes, wealso constructed in-frame (scar) deletion mutations for all theputative cyp genes (orf1 to cypI). These mutations were made byintroducing pIJ12422–pIJ12430 into Escherichia coli BT340 andgrowth at 42 °C. This procedure resulted in the FLP-mediatedexcision of the apramycin resistance cassette, leaving an 81-bpin-frame ‘scar’ sequence (1) and yielding pIJ12431–pIJ12439(Δorf1–ΔcypI). Derivatives capable of integrating into the chro-mosomeof aStreptomyceshostweremadeby inserting a 5.2-kbSspIfragment from pIJ10702 that contained oriT, the apramycin re-sistance gene [aac(3)IV], and theϕC31 attP site and integrase geneby PCR targeting. The resulting cosmids (pIJ12440–pIJ12448)were transferred to S. coelicolorM1146, where stable integration attheϕC31 attB site occurred; no antibiotic selection was required tomaintain the cosmids after integration.Each of the resulting strains(M1413–M1421) contained a cosmid with an individual gene(Δorf1–ΔcypI, respectively) of the putative minimal gene set re-placed by a scar sequence.Similarly, cypA-containing cosmids from the S. sp. OH-4156
genomic library identified by hybridization (pIJ12400–pIJ12408)were targeted with the 5.2-kb pIJ10702 SspI fragment to yield in-tegrative versions (pIJ12409–pIJ12417, respectively). These cos-mids then were introduced into Streptomyces venezuelae ATCC10712 by conjugation, yielding strains M1400–M1409.
Construction of Fusion Proteins.Gateway primer couples (Gat cypAF/Gat cypAR, Gat cypD F/Gat cypDR, andGat cypM F/Gat cypMR) were used to amplify cypA, cypD, and cypM, respectively. Theresulting PCR products were introduced into the pDONR207
entry vector and shuttled into the pHM-GWA destination vectorfollowing the protocol of the Gateway cloning kit (Invitrogen).The resulting plasmids pIJ12489 (cypA), pIJ12493 (cypD), andpIJ12494 (cypM) were introduced into E. coli BL21 (DE3) bytransformation. Recombinant 6-His–tagged maltose-bindingprotein (MBP)-CypA, 6-His–tagged MBP-CypD, and 6-His–tag-ged MBP-CypM were purified from 3 L of Lennox medium [Lmedium; tryptone 10 g/L, yeast extract 5 g/L, NaCl 5 g/L (2)] afterinduction with 0.5 mM isopropyl-β-D-1-thiogalactopyranoside at30 °C for 4 h. Cell pellets were resuspended in 40 mL lysis buffer(50 mM Tris HCl, pH 7.9, 10% glycerol, 1 mM phenyl-methanesulfonyl fluoride), lysed with a French press, and the celllysate was clarified by centrifugation (20 min at 40,000 × g). Thecleared lysate was applied to a 1-mL Ni2+-loaded Hi-Trap Che-lating HD column (GE Healthcare), washed with 25 mMK2HPO4 (pH 7.9), 200 mM NaCl, and 20 mM imidazole, andeluted with an imidazole gradient. The eluted proteins were di-alyzed into storage buffer [50 mM Tris HCl (pH 7.9), 50 mMNaCl, 1 mM Tris(2-carboxyethyl) phosphine (TCEP)], aliquoted,and stored at −80 °C. Protein concentrations were determined bya Bradford assay according to the manufacturer’s instructions(Bio-Rad). BSA was used as the protein standard. We obtainedpreproCypA by digestion of 6-His–tagged MBP-CypA with to-bacco etch virus protease following the Invitrogen protocol.
CypD Assay. We incubated 6-His–tagged MBP-CypD (∼25 μM)with the preproCypA substrate (∼120 μM) at 30 °C in a 20-μLvolume at pH 7.9 (50 mM Tris HCl) under reducing conditions(2 mM TCEP). After 6 h incubation, the reaction mixture wasanalyzed by MALDI-TOFMS. The substrate peak with a mass of6,087 Da was partially converted into a peak of 6,041 Da (Fig. S7A and B). The 46-Da difference in mass is in good agreement withthe removal of two hydrogen atoms and one molecule of CO2.
CypM Assay. We incubated 6-His–tagged MBP-CypM (∼7.5 μM)with nonmethylated cypemycin (unknown concentration) at 30 °Cin a 20-μL volume at pH 7.9 (50 mM Tris HCl) under reducingconditions (2 mM TCEP) in the presence of added S-adenosylmethionine (2.5 mM) and MgCl2 (10 mM). After 3 h incubation,the reaction mixture was analyzed by MALDI-TOF MS. Thepeaks corresponding to the nonmethylated substrate ([M+H]+=2,068 Da; [M+Na]+ = 2,090 Da; [M+K]+ = 2,106 Da) weremostly converted into mature cypemycin ([M+Na]+ = 2,118 Da;[M+K]+ = 2,134 Da) by the addition of CypM (Fig. S7 C andD).
1. Gust B, et al. (2004) Lambda Red-mediated genetic manipulation of antibiotic-producing Streptomyces. Adv Appl Microbiol 54:107–128.
2. Lennox ES (1955) Transduction of linked genetic characters of the host bybacteriophage P1. Virology 1:190–206.
Claesen and Bibb www.pnas.org/cgi/content/short/1008608107 1 of 10
2134.1542118.176
0200004000060000
100
200
2134.1272118.149
0
1000
2000
).u.a(ytis netnI
2134.057
2118.062
0100200300
2134.110
2118.133
0
1000
2000
2134.116
2118.143
0
1000
2000
2134.142
2118.164
0
2000
4000
200
400
200
400
2134.1212118.145
0
1000
2000
50
100
2025 2050 2075 2100 2125 2150 2175 2200 2225 2250
m/z
S. sp. OH-4156
M1400 (EV)
M1401
M1402
M1403
M1404
M1405
M1406
M1407
M1408
M1409
Fig. S1. Heterologous expression of the cypemycin biosynthetic gene cluster in Streptomyces venezuelae. MALDI-TOF spectra for Streptomyces sp. OH-4156,S. venezuelae with the empty vector pIJ10702 (M1400), and S. venezuelae derivatives with cosmids containing all the genes required for cypemycin production(M1401, M1402, M1403, M1404, M1405, and M1408) and those with a cosmid that does not (M1406, M1407, and M1409).
S. sp. OH-4156
M1401
M1400 (EV)
M1402 M1403
M1404 M1405 M1406
M1407 M1409M1408
Fig. S2. Micrococcus luteus bioassay of the nine S. venezuelae derivatives with a cypA-containing cosmid. Streptomyces sp. OH-4156 (positive control), M1400(empty vector, EV; negative control), and M1401–M1409 are the S. venezuelae clones containing hybridizing library cosmids. The halos observed for M1401,M1403, M1405, and M1408 are much smaller than that of the natural producer; although clones M1402 and M1404 failed to produce a halo, cypemycinproduction was confirmed by MALDI-TOF analysis.
Claesen and Bibb www.pnas.org/cgi/content/short/1008608107 2 of 10
2 134 .0 95
211 8. 12 1
0
50 00
100 00
150 00
0
20
40
60
80
211 8. 11 7
209 6. 14 6 213 4. 09 9
0
10 00
20 00
211 8. 11 2
209 6.15 6 2 134 .1 24
0
100 00
200 00
2 118 . 114
209 6. 12 4 213 4. 10 4 0
100 00
200 00
0 20 40 60 80
10 0
0
20
40
60
In te
ns it y
(a
.u .)
0
10
20
30
40
21 64. 183
218 0. 16 5
0
100 00
200 00
300 00
20 90 .0 91
206 8. 10 0
0
10 00 20 00 30 00
40 00
211 8. 13 6
2 096 .1 77 21 34. 117
0
100 00
300 00
200 00
2 118 . 138
209 6. 16 8 213 4. 12 6
0
100 00
200 00
211 8. 14 7
209 6. 17 3 213 4. 13 0
0
100 00
200 00
2 025 205 0 2 075 210 0 212 5 215 0 21 75 220 0 22 25 2 250
m/z
200 00 S. sp . OH -4 15 6
M1 41 0 (E V)
M1 41 1 (f u ll co sm id )
M1 41 2 (m in im al )
M1 41 3 ( or f1 )
M1 41 4 ( cy pA )
M1 41 5 ( cy pH )
M1 41 6 ( cy pL )
M1 41 7 ( cy pD )
M1 41 8 ( cy pM )
M1 41 9 ( cy pT )
M1 42 0 ( cy pP )
M1 42 1 ( cy pI )
2 106 .0 77
21 42. 171
Fig. S3. MALDI-TOF spectra for scar mutants in M1146. Spectra for Streptomyces sp. OH-4156 (positive control), M1146 with the inserted empty vectorpIJ10702 (M1410), entire cosmid (M1411), minimal gene set (M1412), and individual mutants in orf1 to cypI (M1413–M1421). Cypemycin is detected as [M+H]+ =2,096 Da, [M+Na]+ = 2,118 Da, and [M+K]+ = 2,134 Da. The nondecarboxylated version of cypemycin (in M1417) appears as [M+H]+ = 2,142 Da, [M+Na]+ = 2,164Da, and [M+K]+ = 2,180 Da, and the nonmethylated intermediate (in M1418) as [M+H]+ = 2,068 Da, [M+Na]+ = 2,090 Da, and [M+K]+ = 2,106 Da.
Claesen and Bibb www.pnas.org/cgi/content/short/1008608107 3 of 10
2118.217
2134.204
2118.106
2134.100
2090.1682106.140
2118.155
2096.159 2134.141
2118.125
2134.1112096.129
2118.101
2134.090
2096.113
2025 2050 2075 2100 2125 2150 2175 2200 2225 2250
m/z
0
20000
40000
60000
0
10000
20000
30000
40000
0
100
200
0
20
40
60
0200400600800
1000
0
50
100
150
Inte
nsity
(a.u
.)
01000020000300004000050000
0
20000
40000
60000
0
20000
40000
60000
0
20000
40000
60000
80000
S. sp. OH-4156 (WT)
M1427 ( orf1)
M1428 ( cypA)
M1429 ( cypH)
M1430 ( cypL)
M1431 ( cypD)
M1432 ( cypM)
M1433 ( cypT)
M1434 ( cypP)
M1435 ( cypI)
2068.148
2096.181
2096.092
Fig. S4. MALDI-TOF spectra of the apramycin-marked mutants in Streptomyces sp. OH-4156. Spectra for M1427 (Δorf1) to M1435 (ΔcypI) show the samephenotypes as the heterologously expressed mutants (Fig. S5). No cypemycin intermediate was detected in the culture of M1431 (ΔcypD), whereas its het-erologous counterpart (M1417) produced nondecarboxylated cypemycin. A possible explanation is that the replacement of cypD in this mutant with thepIJ773-derived cassette causes a polar effect on the downstream cypM gene, making M1431 a ΔcypDM double mutant. The product of this mutant, cypemycinlacking the S-[(Z)-2-aminovinyl]-D-cysteine (AviCys) and N,N-dimethyalanine (Me2-Ala), is thought to be unstable but has been isolated from a heterologouslyexpressing ΔcypDM double mutant. Differences in protease activity between M1146 and Streptomyces sp. OH-4156 could account for this observation.
Claesen and Bibb www.pnas.org/cgi/content/short/1008608107 4 of 10
Fig. S5. Quadrupole TOF (Q-TOF) spectrum of cypemycin. Fragmentation of the modified linear peptide allows determination of the amino acid sequence andthe nature and locations of modified residues. The amino acid sequence between Pro3 and the AviCys residue (which does not fragment easily into in-terpretable masses) can be readily discerned and is shown above the spectrum.
a 2215.1 62
219 9. 16 0 21 80 .1 01
216 4. 09 9
0 1000 0
2000 0 3000 0 4000 0
Inte
nsity
(a.u
.)
2025 205 0 207 5 21 00 212 5 215 0 21 75 2200 222 5 22 50 m/z
2142.1 18
+57 Da
b Non-d ec ar bo xy late d c Non-me th yl at ed
# R esidue Cal cu late d O bserve d C alc ulate d O bs erve d # Res idue Cal cu late d O bserved Cal cu late d O bs erve d 17 Dhb 162 6. 86 4 1 62 6. 84 4 599 .3 23 599. 31 7 1 Al a 7 2. 04 5 - 206 9. 11 3 - 18 a -I le 173 9. 94 8 1 73 9. 97 2 516 .2 86 516. 28 0 2 Dhb 155. 08 2 1 55 .0 88 199 7. 06 8 - 19 Dha 180 8. 97 0 - 403 .2 02 403. 19 7 3 Pr o 2 52. 13 5 2 52 .1 38 191 4. 03 1 - 20 Leu 192 2. 05 4 - 334 .1 80 334. 18 8 4 Al a 3 23. 17 2 3 23 .1 79 181 6. 97 8 - 21 Va l 202 1. 12 2 - 221 .0 96 221. 08 9 5 Dhb 406. 20 9 4 06 .2 17 174 5. 94 1 1 745. 86 0 22 Cys 214 1. 13 4 - 122 .0 27 - 6 Pr o 5 03. 26 2 5 03 .2 75 166 2. 90 4 1 662. 83 2
b-ions y- ions b-i on s y -i ons
Fig. S6. Structural verification of the truncated cypemycin derivatives. (A) After alkylation of the free thiol groups in the product of the ΔcypDmutant, a singlemass shift of +57 Da was observed indicating the presence of only one free thiol group. Nondecarboxylated cypemycin appears as [M+H]+ = 2,142 Da, [M+Na]+ =2,164 Da, and [M+K]+ = 2,180 Da. The alkylated version is observed as [M+H]+ = 2,199 Da and [M+O]+ = 2,215 Da. (B)Q-TOF analysis of the compound produced bytheΔcypDmutant shows that Cys19 has been dehydrated to dehydroalanine. (C) Q-TOF analysis confirming that the mass difference of the compound producedby the ΔcypM mutant is localized to the first two amino acids and thus is very likely to reflect the lack of the two N-terminal methyl groups.
Claesen and Bibb www.pnas.org/cgi/content/short/1008608107 5 of 10
Fig. S7. Biochemical assays for CypD decarboxylase and CypM methyltransferase activity. (A) Decarboxylation assay control without added CypD. (B) Uponincubation with the CypD enzyme, the mass peak corresponding to the 6,087-Da preproCypA substrate is partially converted to the 6,041-Da decarboxylatedproduct. (C) Methyl transfer assay control without added CypM. (D) Nonmethylated cypemycin ([M+H]+ = 2,068 Da, [M+Na]+ = 2,090 Da, and [M+K]+ = 2,106Da) was converted to mature cypemycin ([M+Na]+ = 2,118 Da and [M+K]+ = 2,134 Da) upon incubation with CypM.
2164.085 2118.075
2180.081
2134.068 0
2000
4000
6000
8000
) . u . a ( y t i s n e t n I 2025 2050 2075 2100 2125 2150 2175 2200 2225 2250
m/z
M1424
Fig. S8. Analysis of the complementation of the ΔcypL mutant M1424 confirms production of both cypemycin and the nondecarboxylated form.
Claesen and Bibb www.pnas.org/cgi/content/short/1008608107 6 of 10
Table S1. Plasmids, strains, and primers used in this study
Plasmid* Description Ref. or source
General plasmidspIJ10257 oriT, ϕBT1 int-attB, hyg, ermEp* (1)pIJ10702 bla, aac(3)IV, oriT, ϕC31 int-attP (also known as pMJCos1) (2)pIJ773 pBS SK+ containing cassette P1-FRT-oriT-aac(3)IV-FRT-P2 (3)pIJ790 λ-RED (gam, bet, exo), cat, araC, rep101ts (3)pSET152 lacZα, pUC19ori, RP4oriT, ϕC31 int-attP, aac(3)IV (4)pUZ8002 tra, neo, RP4 (5)SuperCosI neo, bla StratagenepDONR 207 donor vector for Gateway InvitrogenpHM-GWA Gateway destination vector for MBP fusions (6)
Library cosmids for heterologous expression in S. venezuelaepIJ12400 genomic library cosmid 1N16 in SupercosI This workpIJ12401 genomic library cosmid 3O03 in SupercosI This workpIJ12402 genomic library cosmid 4J11 in SupercosI This workpIJ12403 genomic library cosmid 6C03 in SupercosI This workpIJ12404 genomic library cosmid 6I23 in SupercosI This workpIJ12405 genomic library cosmid 7P24 in SupercosI This workpIJ12406 genomic library cosmid 8B19 in SupercosI This workpIJ12407 genomic library cosmid 8G13 in SupercosI This workpIJ12408 genomic library cosmid 8J18 in SupercosI This workpIJ12409 pIJ12400 with pIJ10702 backbone This workpIJ12410 pIJ12401 with pIJ10702 backbone This workpIJ12411 pIJ12402 with pIJ10702 backbone This workpIJ12412 pIJ12403 with pIJ10702 backbone This workpIJ12413 pIJ12404 with pIJ10702 backbone This workpIJ12414 pIJ12405 with pIJ10702 backbone This workpIJ12415 pIJ12406 with pIJ10702 backbone This workpIJ12416 pIJ12407 with pIJ10702 backbone This workpIJ12417 pIJ12408 with pIJ10702 backbone This work
Minimal gene set constructspIJ12418 pIJ12404 targeted with 773 cassette upstream of orf1 This workpIJ12419 pIJ12418 with in-frame deletion upstream of orf1 This workpIJ12420 pIJ12419 targeted with 773 cassette downstream of cypI This workpIJ12421 pSET152 with minimal gene set excised from pIJ12420 This work
Gene-deletion constructspIJ12422 pIJ12404 Δorf1::(oriT-aac(3)IV) This workpIJ12423 pIJ12404 ΔcypA::(oriT-aac(3)IV) This workpIJ12424 pIJ12404 ΔcypH::(oriT-aac(3)IV) This workpIJ12425 pIJ12404 ΔcypL::(oriT-aac(3)IV) This workpIJ12426 pIJ12404 ΔcypD::(oriT-aac(3)IV) This workpIJ12427 pIJ12404 ΔcypM::(oriT-aac(3)IV) This workpIJ12428 pIJ12404 ΔcypT::(oriT-aac(3)IV) This workpIJ12429 pIJ12404 ΔcypP::(oriT-aac(3)IV) This workpIJ12430 pIJ12404 ΔcypI::(oriT-aac(3)IV) This workpIJ12431 pIJ12422 in-frame deletion of orf1 This workpIJ12432 pIJ12423 in-frame deletion of cypA This workpIJ12433 pIJ12424 in-frame deletion of cypH This workpIJ12434 pIJ12425 in-frame deletion of cypL This workpIJ12435 pIJ12426 in-frame deletion of cypD This workpIJ12436 pIJ12427 in-frame deletion of cypM This workpIJ12437 pIJ12428 in-frame deletion of cypT This workpIJ12438 pIJ12429 in-frame deletion of cypP This workpIJ12439 pIJ12430 in-frame deletion of cypI This workpIJ12440 pIJ12431 with pIJ10702 backbone This workpIJ12441 pIJ12432 with pIJ10702 backbone This workpIJ12442 pIJ12433 with pIJ10702 backbone This workpIJ12443 pIJ12434 with pIJ10702 backbone This workpIJ12444 pIJ12435 with pIJ10702 backbone This workpIJ12445 pIJ12436 with pIJ10702 backbone This workpIJ12446 pIJ12437 with pIJ10702 backbone This workpIJ12447 pIJ12438 with pIJ10702 backbone This workpIJ12448 pIJ12439 with pIJ10702 backbone This work
Complementation constructspIJ12449 pIJ10257 containing cloned cypA This work
Claesen and Bibb www.pnas.org/cgi/content/short/1008608107 7 of 10
Table S1. Cont.
Plasmid* Description Ref. or source
pIJ12450 pIJ10257 containing cloned cypH This workpIJ12451 pIJ10257 containing cloned cypL This workpIJ12452 pIJ10257 containing cloned cypD This workpIJ12453 pIJ10257 containing cloned cypM This work
Fusion protein constructspIJ12489 pHM-GWA containing cloned cypA This workpIJ12493 pHM-GWA containing cloned cypD This workpIJ12494 pHM-GWA containing cloned cypM this work
Strain Description Ref.
Micrococcus luteusATCC4698 Indicator strain in bio-assay (2)
Escherichia coliBT340 DH5α/pCP20 (7)BW25113 K-12 derivative: ΔaraBAD, ΔrhaBAD (8)DH5α strain used for general cloning and plasmid maintenance StratageneET12567 dam, dcm, hsdM, hsdS, hsdR, cat, tet (9)XL1-Blue strain used for SupercosI library StratageneBL21 (DE3) strain used for fusion protein production (10)
Streptomyces venezuelaeATCC 10712 Wild type strain; used to construct the S. venezuelae derivatives (11)M1400 pIJ10702 in ϕC31 attB (empty vector) This workM1401 pIJ12409 in ϕC31 attB This workM1402 pIJ12410 in ϕC31 attB This workM1403 pIJ12411 in ϕC31 attB This workM1404 pIJ12412 in ϕC31 attB This workM1405 pIJ12413 in ϕC31 attB This workM1406 pIJ12414 in ϕC31 attB This workM1407 pIJ12415 in ϕC31 attB This workM1408 pIJ12416 in ϕC31 attB This workM1409 pIJ12417 in ϕC31 attB This work
Streptomyces coelicolorM1146 M145 Δact Δred Δcpk Δcda; parental strain used to construct the S. coelicolor derivatives J. P. Gomez-EscribanoM1410 pIJ10702 in ϕC31 attB (empty vector) This workM1411 pIJ12413 in ϕC31 attB (full cosmid insert) This workM1412 pIJ12421 in ϕC31 attB (minimal gene set) This workM1413 pIJ12440 in ϕC31 attB (Δorf1) This workM1414 pIJ12441 in ϕC31 attB (ΔcypA) This workM1415 pIJ12442 in ϕC31 attB (ΔcypH) This workM1416 pIJ12443 in ϕC31 attB (ΔcypL) This workM1417 pIJ12444 in ϕC31 attB (ΔcypD) This workM1418 pIJ12445 in ϕC31 attB (ΔcypM) This workM1419 pIJ12446 in ϕC31 attB (ΔcypT) This workM1420 pIJ12447 in ϕC31 attB (ΔcypP) This workM1421 pIJ12448 in ϕC31 attB (ΔcypI) This workM1422 pIJ12441 in ϕC31 attB (ΔcypA) and pIJ12449 in ϕBT1 attB This workM1423 pIJ12442 in ϕC31 attB (ΔcypH) and pIJ12450 in ϕBT1 attB This workM1424 pIJ12443 in ϕC31 attB (ΔcypL) and pIJ12451 in ϕBT1 attB This workM1425 pIJ12444 in ϕC31 attB (ΔcypD) and pIJ12452 in ϕBT1 attB This workM1426 pIJ12445 in ϕC31 attB (ΔcypM) and pIJ12453 in ϕBT1 attB This work
Streptomyces sp. OH-4156WT Wild type strain; used to construct the S. sp. OH-4156 mutants (12)M1427 Δorf1::(oriT-aac(3)IV) This workM1428 ΔcypA::(oriT-aac(3)IV) This workM1429 ΔcypH::(oriT-aac(3)IV) This workM1430 ΔcypL::(oriT-aac(3)IV) This workM1431 ΔcypD::(oriT-aac(3)IV) This workM1432 ΔcypM::(oriT-aac(3)IV) This workM1433 ΔcypT::(oriT-aac(3)IV) This workM1434 ΔcypP::(oriT-aac(3)IV) This workM1435 ΔcypI::(oriT-aac(3)IV) This work
Claesen and Bibb www.pnas.org/cgi/content/short/1008608107 8 of 10
Table S1. Cont.
Strain Description Ref.
Primer Sequence SiteDegenerate primers and probes for cypACyp deg F gcnacnccngcnacncCyp deg R rcanacnawdagngtnCyp probe 1 gcsacsccsgcsacsccsacsgtsgcscagttcgtsatccagggsCyp probe 2 gcsacsccsgcsacsccsacsgtsgcscagttcgtsatccagggstcsacsatctcsctsgtstgc
cypA-specific probe/test primerscypA T1 gacggtctcttgaaggtctgcypA T2 cctccgccacttccatc
Minimal gene set PCR-targeting primers and test primersUp F agaattcgcggccgcataatacgactcactatagggatcattccggggatccgtcgaccUp R gccccgtaccgctggggcacgggcccgggggcgggtcggtctagatgtaggctggagctgcttc XbaIDown F ggaggggcggcggggccgcgccgtgccgggcgtcgtcgcaatattattccggggatccgtcgacc SspIDown R caagaattcgcggccgcaattaaccctcactaaaggatctgtaggctggagctgcttcUp T1 tggaatgaacaatggaagtcaacUp T2 cggtgaagtacgggcDown T1 gagttcccgctgctgagDown T2 ccgaaaagtgccacctgac
Individual gene-deletion PCR-targeting primers and test primersorf1 F caccgcgtccgggggtgccgtcatggaacggcccggctaactagtattccggggatccgtcgacc SpeIorf1 R gacgggatgggcgggcacgcgcggagggggacgcacatggctagctgtaggctggagctgcttc NheIcypA F gaccaccgacgaagggttagtgaagtgcgatctgagatgactagtattccggggatccgtcgacc SpeIcypA R gtgacgggcctctccggcggcaggctcagtcccgcgtcagctagctgtaggctggagctgcttc NheIcypH F tctacctgctgccgcgcgagcaggcctcgtacgcgctccactagtattccggggatccgtcgacc SpeIcypH R gatcgaccggtgcgccgagccgcgcaccacctcgaacttgctagctgtaggctggagctgcttc NheIcypL F ggggcgctcgccgcgcacctggtcgcgaccgtgctgcagactagtattccggggatccgtcgacc SpeIcypL R cactcggaggtgaggatcggcttcatccgctggtccgcggctagctgtaggctggagctgcttc NheIcypD F ccatgtcacgggctccatcagcgcggcgctcgtgccgtgactagtattccggggatccgtcgacc SpeIcypD R ggcaggttgaaccccacctcggccgtctgccggttgctcgctagctgtaggctggagctgcttc NheIcypM F gccaacaggatgcggaaggaagggcgttccggtgagtgaactagtattccggggatccgtcgacc SpeIcypM R tggcgccctccgcggcgatcgccggcacttcgctcactggctagctgtaggctggagctgcttc NheIcypT F cgctcgcgggagatgctggtcgttctggagcggcagtgaactagtattccggggatccgtcgacc SpeIcypT R ggtcggcctcgaccgcggtgatgctgtccgtggtcatccgctagctgtaggctggagctgcttc NheIcypP F atggtggacgcctgcgacggcctcatggagctgggatgaactagtattccggggatccgtcgacc SpeIcypP R cccaggcggaccgggggccactcccgcggggctccgttagctagctgtaggctggagctgcttc NheIcypI F caggggtcccgcgcgactccgggacggcagggcaggatgactagtattccggggatccgtcgacc SpeIcypI R cggaggggtcgcggggccgtccccgttccggaggcctcagctagctgtaggctggagctgcttc NheIorf1 T1 ggcccgtacttcaccgorf1 T2 gtccggggtctgacagcypH T1 atccgtgaagaattcgaagacgacypH T2 gcagcacggtcgccypL T1 aagttcgaggtggtgcgcypL T2 cccgcagccagtggcypD T1 gatgaagccgatcctcacccypD T2 acacccaggcgacgagcypM T1 cgagttcgcgccgccypM T2 gttgcttccggtgaggccypT T1 ggtctggaggtgacggcypT T2 gtgtacgcccagtcctgcypP T1 cctggtcgccaccccypP T2 catggtgtccatcctgcccypI T1 acgacggtgtcctggagcypI T2 ctcagcagcgggaactc
Primers for complementation constructscypA 10257 F aaaaacatatgactcttacgagcacgaattccgc NdeIcypA 10257 R aaaaaaagctttcagcagaccaggcagatcg HindIIIcypH 10257 F aaaaacatatgctcgcgggagtgacc NdeIcypH 10257 R aaaaaaagctttcagtaagcatccatgaaccttc HindIIIcypL 10257 F aaaaacatatgcttactgaccggatcaaggg NdeIcypL 10257 R aaaaaaagctttcacgcggcggctcccg HindIIIcypD 10257 F aaaaacatatgaacgtggagaagttcgaggg NdeIcypD 10257 R aaaaaaagctttcactcaccggaacgccc HindIII
Claesen and Bibb www.pnas.org/cgi/content/short/1008608107 9 of 10
Table S1. Cont.
Strain Description Ref.
cypM 10257 F aaaaacatatgagtgacccgagcgtgta NdeIcypM 10257 R aaaaaaagctttcactgccgctccagaacga HindIII10257 seq F acgtccatgcgagtgtcc10257 seq R ccaaacggcattgagcgtc
Primers for fusion protein constructsGat cypA F ggggacaagtttgtacaaaaaagcaggcttagaaaacctgtattttcagggcatgactcttacgagcacgaattccgcGat cypA R ggggaccactttgtacaagaaagctgggtttcagcagaccaggcagatcgGat cypD F ggggacaagtttgtacaaaaaagcaggcttagaaaacctgtattttcagggcgtgaacgtggagaagttcgagggGat cypD R ggggaccactttgtacaagaaagctgggtttcactcaccggaacgcccGat cypM F ggggacaagtttgtacaaaaaagcaggcttagaaaacctgtattttcagggcgtgagtgacccgagcgtgtaGat cypM R ggggaccactttgtacaagaaagctgggtttcactgccgctccagaacga
*Unless otherwise stated, all plasmids generated in this work were maintained in DH5α.
1. Hong HJ, Hutchings MI, Hill LM, Buttner MJ (2005) The role of the novel Fem protein VanK in vancomycin resistance in Streptomyces coelicolor. J Biol Chem 280:13055–13061.
2. Boakes S, Cortés J, Appleyard AN, Rudd BA, Dawson MJ (2009) Organization of the genes encoding the biosynthesis of actagardine and engineering of a variant generation system.Mol Microbiol 72:1126–1136.
3. Gust B, et al. (2004) Lambda Red-mediated genetic manipulation of antibiotic-producing Streptomyces. Adv Appl Microbiol 54:107–128.4. Flett F, Mersinias V, Smith CP (1997) High efficiency intergeneric conjugal transfer of plasmid DNA from Escherichia coli to methyl DNA-restricting streptomycetes. FEMS Microbiol Lett
155:223–229.5. Paget MS, Chamberlin L, Atrih A, Foster SJ, Buttner MJ (1999) Evidence that the extracytoplasmic function sigma factor sigmaE is required for normal cell wall structure in Streptomyces
coelicolor A3(2). J Bacteriol 181:204–211.6. Busso D, Delagoutte-Busso B, Moras D (2005) Construction of a set Gateway-based destination vectors for high-throughput cloning and expression screening in Escherichia coli. Anal
Biochem 343:313–321.7. Cherepanov PP, Wackernagel W (1995) Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant.
Gene 158:9–14.8. Datsenko KA, Wanner BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97:6640–6645.9. MacNeil DJ, et al. (1992) Analysis of Streptomyces avermitilis genes required for avermectin biosynthesis utilizing a novel integration vector. Gene 111:61–68.10. Studier FW, Moffatt BA (1986) Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J Mol Biol 189:113–130.11. Stuttard C (1982) Temperate phages of Streptomyces venezuelae: Lysogeny and host specificity shown by phages SV1 and SV2. J Gen Microbiol 128:115–121.12. Komiyama K, et al. (1993) A new antibiotic, cypemycin. Taxonomy, fermentation, isolation and biological characteristics. J Antibiot (Tokyo) 46:1666–1671.
Claesen and Bibb www.pnas.org/cgi/content/short/1008608107 10 of 10
