Supporting InformationGarrett et al. 10.1073/pnas.1016140108SI Materials and MethodsCells, Plasmids, and Reagents. BT474 cells were grown in ImprovedMEM Zn2+ Option (Invitrogen) supplemented with 10% FBS ina humidified 5% CO2 incubator at 37 °C. SKBR3 cells weregrown in McCoy’s 5A (Invitrogen) supplemented with 10% FBSin a humidified 5% CO2 incubator at 37 °C. MDA453 cells weregrown in DMEM/F12 (Invitrogen) supplemented with 20% FBSin a humidified 5% CO2 incubator at 37 °C. Plasmids encodingFoxO1, FoxO3a, FoxO4 (1), and the empty vector pECE werekindly provided by Anne Brunet (Stanford University). TheFoxO1 and FoxO4 plasmids are Myc-tagged. The plasmid en-coding myristoylated Akt was provided by Phil Tsichlis (HarvardMedical School). In experiments involving ectopic FoxO ex-pression, cells in 60-mm dishes were transfected with 10 μg ofplasmid for 16 h with the use of FUGENE 6 (Roche MolecularBiochemicals). The following concentrations of reagents wereused unless otherwise indicated: 1 μM lapatinib (GW-572016,LC Laboratories), 0.25 μM BEZ235 (provided by Carlos García-Echeverría, Novartis), 1 μM of the allosteric AKT1/2 inhibitor5J8 (provided by Craig Lindsley, Vanderbilt) (2), 2.5 μM of theMet inhibitor SU11274 (3) (Sigma), 1 μM dasatinib (4) (pro-vided by Bristol Myers Squibb), 20 μg/mL trastuzumab (Van-derbilt University Pharmacy), 20 μg/mL pertuzumab (providedby Genentech), 1 μM BIBW2992 (5) (synthesized by the OrganicSynthesis Core Facility (MSKCC) as described in ref. 6), 1 μMgefitinib (7) (provided by AstraZeneca), 1 μM of the FGFR in-hibitor SU5402 (8) (Tocris), and 10 μg/mL AMG-888 (providedby Dan Freeman, Amgen and Thore Hettman, U3).

Immunoprecipitation, Immunoblotting, and Immunofluorescence.Cellswere washed with ice-cold PBS and lysed on ice in NonidetP-40 lysis buffer (20 mM Tris, pH 7.4/150 mM NaCl/1% NonidetP-40/0.1 mM EDTA, plus protease and phosphatase inhibitors).After sonication for 10 s and centrifugation (14,000 rpm), proteinconcentration in supernatants was measured using the BCA pro-tein assay reagent (Pierce). Immunoprecipitation was performedby incubating 500 μg of protein extract with 1 μg of HER3 anti-body (Neomarkers) conjugated to 60 μL of protein A (1:1) Se-pharose beads (50% slurry in Nonidet P-40 lysis buffer) overnightat 4 °C. The mixture was washed five times in Nonidet P-40 lysisbuffer and boiled for 5 min in 30 μL of 2× loading buffer beforebeing subjected to SDS/PAGE. In some cases, total cell proteinwas separated by 7% SDS/PAGE. For immunoblotting, pro-teins were transferred onto nitrocellulose membranes (Bio-Rad).Primary antibodies included: P-EGFR-Y1068, EGFR, P-HER3-Y1197, -Y1222, -Y1289, P-Akt-S473, P-Akt-T308, Akt, P-Erk-T202/Y204, Erk, P-S6-S240/244, S6, FoxO3a (Cell Signaling),HER2/ErbB2 (Neomarkers), HER3 (Santa Cruz Biotechnology),P-HER2-Y1248 (Millipore), and β-actin (Sigma). Immunoreativebands were detected by enhanced chemiluminescence after in-cubation with horseradish peroxidase-conjugated secondary an-tibodies (Promega).For immunofluorescence cells were seeded on coverslips in six-

well plates. Following treatment, cells were washed with PBS,fixed in 4% paraformaldehyde-PBS for 20 min at room tem-perature and permeabilized in ice-cold PBS with 0.2% Triton X-100 for 10 min at room temperature. After blocking with PBScontaining 1%BSA and 5%FCS for 40 min at room temperature,the slides were incubated with primary antibody (1:500, FOXO3a;Millipore) overnight at 4 °C and thereafter with the anti-rabbitAlexa 488 antibody (1:300). Coverslips were mounted on glassslides with ProLong Gold antifade mounting medium (In-

vitrogen) and visualized by confocal microscopy. For negativecontrols the primary antibody was omitted.

Human Tumor Biopsies and Immunohistochemistry. All tissue speci-mens were fixed in 10% buffered neutral formalin for 24 h atroom temperature, then dehydrated and paraffin embedded. Corebiopsies of 2 mm in diameter were taken from each donor blockand arrayed into a recipient paraffin block (35 mm × 22 mm × 5mm) using a tissue microarrayer. Immunostaining was done on 4-μm tissue sections placed on charged plus glass slides. Afterdeparaffinization in xylene and graded alcohols, heat inducedepitope retrieval was performed using a decloaking chamber incitrate buffer (pH 6.0), 3% hydrogen peroxide for 20 min, pro-tein block (Dako) 10 min, and incubation with a HER3 antibody(1:100 dilution) overnight at 4 °C. The Envision VisualizationSystem (Dako) was used followed by DAB as chromagen andcounterstained with hematoxylin. Tumor sections were studiedon a light microscope with an ocular magnification of 400×. Thepercentage of stained tumor cells was scored in a whole sectionand the average percentage and intensity of tumor cell stainingwas calculated as a histoscore as described (9). Grading ofscoring ranged from a score of 0–300. Scoring was blinded totime point data. Statistical analysis for the Mann–Whitney U testcompared matched sets of pretherapy and posttherapy histo-scores for HER3.

Transfection of siRNA, ChIP, and RT-PCR. To knock down HER3expression, siRNA against a HER3 target sequence ACCACG-GTATCTGGTCATAAA (Qiagen) was used. Knock down ofFoxO3a expression was achieved using siRNA against a FoxO3atarget sequence CAGACATGGTATCTCATTTAT (Qiagen).siRNAs were transfected into cells by using LipofectamineRNAiMAX (Invitrogen) according to the manufacturer’s pro-tocol. In six-well plate format, 10 nM of siRNA and 1.5 μl ofLipofectamine RNAiMAX reagent were used for each trans-fection. Mismatched siRNAwith a target sequence of GGAAGC-AGACTCACTCTTATA was used as a negative control.Chromatin immunoprecipitation (ChIP) assays were per-

formed according to the manufacturer’s instructions (Magna-ChIP assay kit; Upstate Biotechnology). Approximately 1 × 107

cells were used for each immunoprecipitation, which was per-formed using antibodies against FoxO1, FoxO3a, and FoxO4.DNA was amplified by PCR using primer pairs against putativeFoxO binding sites upstream of the 5′HER3 transcriptional startsite (−4915, −3297, −2409) with the SYBR Green reaction mix.The PCR product was quantified using a real-time quantitativePCR (qPCR) system. Data were normalized to input chromatinand reported as relative fold enrichment compared with immu-noprecipitation with an IgG control antibody.RNA was isolated using an RNeasy Mini kit (Qiagen)

according to the manufacturer’s procedures and treated withRNase-free DNase (Qiagen). RNA samples were subjected tofirst-strand cDNA synthesis using SuperScript II reverse tran-scriptase (Invitrogen) following the manufacturer’s protocol.Gene expression was quantified by qPCR using iQ Sybr greenSupermix (Bio-Rad Laboratories) and 250 ng of cDNA per re-action. The sequences of the primer sets used for this analysis areas follows: HER3, 5′-GGG GAG TCT TGC CAG GAG-3′(forward, F) and 5′-CAT TGG GTG TAG AGA GAC TGGAC-3′ (reverse, R); Actin was used as a housekeeping gene fornormalization of HER3 gene expression. Primer sets for Actinare as follows: F, 5′-GGG GTG TTG AAG GTC TCA AA-3′; R,

Garrett et al. www.pnas.org/cgi/content/short/1016140108 1 of 10

5′-AGA AAA TCT GGC ACC CC-3′. An annealing tempera-ture of 57 °C was used for all of the primers. PCRs were per-formed in a standard 96-well plate format with a Bio-Rad iQ5multicolor real-time PCR detection system. For data analysis,the raw threshold cycle (CT) value was first normalized to thehousekeeping gene for each sample to get ΔCT. The normalizedΔCT was then calibrated to control cell samples to get ΔΔCT.

3D Growth and TUNEL Assays. For growth in 3D, cells were seededon growth factor-reducedMatrigel (BD Biosciences) in eight-wellchamber slides following published protocols (10). Inhibitorswere added to the medium at the time of cell seeding. Colonieswere photographed using an Olympus DP10 camera mounted inan inverted microscope after 10 d. The mean acini size was de-termined for images using the imaging software ImageJ (NIH).To measure apoptosis, adherent cells, transfected 24 h earlierwith siRNA were treated with inhibitors in serum-free medium;after 48 h, both floating and adherent cells were pooled andsubjected to TUNEL analysis using the APO-bromodeoxyur-idine kit (Phoenix Flow Systems) following the manufacturer’sprotocol.

Cytoplasmic and Nuclear Fractionation. The preparation of cyto-plasmic and nuclear extracts was performed using the NuclearExtract Kit (Active Motif). Cells plated in 60-mm dishes werewashed with 1 mL ice-cold PBS/phosphatase inhibitors, lysed in

500 μL of hypotonic buffer, and then centrifuged at 14,000 × gfor 30 s at 4 °C. After saving the supernatant (cytoplasmicfraction), pellets were resuspended in 50 μL of complete lysisbuffer and centrifuged at 14,000 × g for 10 min at 4 °C; super-natants (nuclear fraction) were collected for further analysis.

Studies with Xenografts. A 17β-estradiol pellet (Innovative Re-search of America) was inserted s.c. into each 6-wk-old femaleathymic nude mouse (Harlan Sprague–Dawley) 1 d before cellinjection. Approximately 5 × 106 BT474 cells were injected s.c.into the right flank of mice. Tumor xenografts were measuredwith calipers three times a week and tumor volume was de-termined using the formula: length/2 × width2. Treatment beganwhen tumors reached a volume ≥200 mm3. AMG-888 (20 mg/kgin PBS), trastuzumab (20 mg/kg in PBS), or normal IgG1 (con-trol) was given intraperitoneally twice weekly. Lapatinib (100mg/kg) was administered daily by oral gavage in 0.5% hydrox-ypropyl methylcellulose, 0.1% Tween 80. After 4 wk of treat-ment, the animals were anesthetized with 1.5% isoflurane–airmixture and killed by cervical dislocation. Results are presentedas mean ± SEM. Mice were housed in the accredited AnimalCare Facility of the Preston Research Building of the VanderbiltUniversity Medical Center and were cared for by Vanderbiltanimal care expert personnel and university veterinarians.

1. Brunet A, et al. (1999) Akt promotes cell survival by phosphorylating and inhibitinga Forkhead transcription factor. Cell 96:857–868.

2. Lindsley CW, et al. (2005) Allosteric Akt (PKB) inhibitors: discovery and SAR of isozymeselective inhibitors. Bioorg Med Chem Lett 15:761–764.

3. Sattler M, et al. (2003) A novel small molecule met inhibitor induces apoptosis in cellstransformed by the oncogenic TPR-MET tyrosine kinase. Cancer Res 63:5462–5469.

4. Lombardo LJ, et al. (2004) Discovery of N-(2-chloro-6-methyl- phenyl)-2-(6-(4-(2-hydroxyethyl)- piperazin-1-yl)-2-methylpyrimidin-4- ylamino)thiazole-5-carboxamide(BMS-354825), a dual Src/Abl kinase inhibitor with potent antitumor activity inpreclinical assays. J Med Chem 47:6658–6661.

5. Bean J, et al. (2008) Acquired resistance to epidermal growth factor receptor kinaseinhibitors associated with a novel T854A mutation in a patient with EGFR-mutantlung adenocarcinoma. Clin Cancer Res 14:7519–7525.

6. Regales L, et al. (2009) Dual targeting of EGFR can overcome a major drug resistancemutation in mouse models of EGFR mutant lung cancer. J Clin Invest 119:3000–3010.

7. Wakeling AE, et al. (2002) ZD1839 (Iressa): an orally active inhibitor of epidermalgrowth factor signaling with potential for cancer therapy. Cancer Res 62:5749–5754.

8. Sun L, et al. (1999) Design, synthesis, and evaluations of substituted 3-[(3- or 4-carboxyethylpyrrol-2-yl)methylidenyl]indolin-2-ones as inhibitors of VEGF, FGF, andPDGF receptor tyrosine kinases. J Med Chem 42:5120–5130.

9. Goulding H, et al. (1995) A new immunohistochemical antibody for the assessment ofestrogen receptor status on routine formalin-fixed tissue samples. Hum Pathol 26:291–294.

10. Debnath J, Muthuswamy SK, Brugge JS (2003) Morphogenesis and oncogenesis ofMCF-10A mammary epithelial acini grown in three-dimensional basement membranecultures. Methods 30:256–268.

Garrett et al. www.pnas.org/cgi/content/short/1016140108 2 of 10

3

n (d

dCt)

qRT-PCR for HER3

1

2

mal

ized

exp

ress

ion

0ctrl siRNA HER2 siRNA

norm

BT474 SKBR3

Fig. S2. Knockdown of HER2 increases HER3 RNA levels. BT474 and SKBR3 cells were seeded in 60-mm plates in 10% FCS and transfected by siRNA oligo-nucleotides targeting HER2 or a control sequence (ctrl siRNA). (Left) Immunoblot of lysates from BT474 and SKBR3 cells 2 d after transfection with eithercontrol or HER2 siRNA. Antibodies used are to the right of the panel. (Right) Total RNA was extracted and subjected to reverse transcription followed by qPCRfor HER3. Data were normalized to untreated cells.

1 2 3 4 5 6 7 8 9 10 11 12 ctrl 6h lap 13h lap 24h lapA

HER3

P-Akt (S473)

Akt

P-Akt (T308)

β-actin

2.5

3dC

t)

qRT-PCR for HER3B*

0.5

1

1.5

2

dex

pres

sion

(d

0

ctrl

(n=5

)

6hla

p(n

=3)

13h

lap

(n=3

)

24h

lap

(n=3

)

norm

aliz

e d

Fig. S1. Inhibition of HER2 results in up-regulation of HER3 in vivo. Female athymic mice were injected with BT474 cells. Once tumors reached a volume ≥150mm3, mice were treated with vehicle or a single dose of lapatinib p.o. (100 mg/kg). Mice were killed 6, 13, or 24 h after treatment and their tumors harvestedand flash frozen in liquid nitrogen. (A) Tumor cell lysates were prepared and separated in a 7% SDS gel followed by immunoblot analysis with the indicatedantibodies. (B) Total RNA was extracted and subjected to reverse transcription followed by qPCR for HER3. Data were normalized to mice treated with vehicle.*P < 0.05 vs. control.

Garrett et al. www.pnas.org/cgi/content/short/1016140108 3 of 10

HER3

P-HER3 (Y1289)

β-ac�n

0 1 4 13 24 48 0 1 4 13 24 48 hr5J8:

BT474 SKBR3

A

B

0

2

4

6

0 4 13 24

norm

aliz

ed e

xpre

ssio

n (d

dCt)

qRT-PCR for HER3 BT474SKBR3

C

D

Fig. S3. Inhibition and knockdown of Akt results in up-regulation of HER3. (A and B). BT474 and SKBR3 cells were treated with the Akt1/2 allosteric inhibitor1 μM 5J8 for the indicated times. (A) Total RNA was extracted and subjected to reverse transcription followed by qPCR for HER3. Data were normalized tountreated cells. (B) Whole cell lysates were prepared and separated by 7% SDS/PAGE followed by immunoblot analysis with Y1289 P-HER3, HER3 and β-actinantibodies. (C and D). BT474 cells were seeded in 60-mm plates in 10% FCS and transfected by siRNA oligonucleotides targeting Akt1, Akt2, Akt3, or a controlsequence (ctrl siRNA). The following day, cells were again transfected by siRNA oligonucleotides targeting Akt1, Akt2, Akt3, or a control sequence. (C) Im-munoblot of lysates from BT474 cells two days after transfection. Primary antibodies used are indicated to the side of the panel. Due to the unavailability of anadequate reagent, an Akt3 immunoblot is not shown. (D) Total RNA was extracted and subjected to reverse transcription followed by quantitative PCR forHER3. Data were normalized to cells transfected with control siRNA.

Garrett et al. www.pnas.org/cgi/content/short/1016140108 4 of 10

Fig. S4. Expression of constitutively active Akt decreases HER3 levels. BT474 and SKBR3 cells were transiently transfected with a vector encoding HA-taggedmyristoylated Akt (Myr-Akt) or an empty vector (ctrl) overnight followed by the addition of DMSO or lapatinib. Cells were harvested after 24 h. (A) Immunoblotof lysates from BT474 and SKBR3 cells with the antibodies indicated to the right of the panels. (B) Twenty-four h after transfection with Myr-Akt or ctrl, 2 × 105

cells per well were plated into 12-well plates. The following day, cells were treated with or without lapatinib. Adherent cells were counted after 3 d. Data arepresented as percentage of control.

Garrett et al. www.pnas.org/cgi/content/short/1016140108 5 of 10

Fig. S5. Increased nuclear FoxO3a upon inhibition of HER2 modulates HER3 levels. (A). Immunofluorescence showing nuclear relocalization of endogenousFOXO3a in SKBR3 cells treated with lapatinib for 1 and 4 h. (B) BT474 and SKBR3 cells were treated with 1 μM lapatinib for the times indicated. Cytoplasmic (C)and nuclear (N) extracts were prepared and separated in a 7% SDS gel followed by immunoblot analysis with FoxO3a, HDAC3 (predominately found in thenucleus), and MEK1/2 (predominately found in the cytoplasm). (C) BT474 and SKBR3 cells were treated with DMSO or 1 μM lapatinib for 1 or 24 h, as indicated,followed by formalin fixation. Chromatin immunoprecipitation (ChIP) assays were performed according to the manufacturer’s instructions (MagnaChIP assaykit; Upstate Biotechnology). Approximately 1 × 107 cells were used for each immunoprecipitation. Immunoprecipitation was performed using antibodiesagainst FoxO1, FOxO3, and FoxO4. DNA was amplified by PCR using primer pairs against putative FoxO binding sites upstream of the 5′ HER3 transcriptionalstart site (−4915, −3297, −2409); SYBR Green reaction mix and product was quantified using a real time quantitative PCR system. Data were normalized toinput chromatin and reported as relative fold enrichment compared with immunoprecipitation with an IgG antibody. (D) BT474 and SKBR3 cells were tran-siently transfected with vectors encoding FoxO3a, FoxO1, FoxO4, or empty vector (pECE). Cell lysates were probed with antibodies as indicated on the right.The expression of the FoxO vectors after transfection into BT474 and SKBR3 cells were examined using FoxO3a, FoxO1, and Myc antibodies. A FoxO4 antibodythat works reliably in immunoblots is not available. Therefore, we used immunoblot analysis with a Myc antibody to detect the Myc-tagged FoxO4 vector. TheFoxO1 vector was also Myc-tagged.

Garrett et al. www.pnas.org/cgi/content/short/1016140108 6 of 10

Fig. S6. Inhibition of HER3 sensitizes HER2+ tumor cells to lapatinib. (A) BT474 cells were transfected by siRNA oligonucleotides targeting HER3 (siHER3) ora control sequence (siCTRL). One day after transfection, cells were seeded in Matrigel and allowed to grow in the absence or presence of lapatinib (0.33 or 1.0μM). Media were changed every 3 d. (Left) Images shown were recorded 10 d after cell seeding. (Right) The mean acini size was determined for each treatmentgroup as indicated inMaterials and Methods. Each bar graph represents the mean ± SEM of three fields from two wells each. (B) BT474 cells were seeded in 12-well plates in 10% FCS and transfected by siRNA oligonucleotides targeting HER3 (siHER3) or a control sequence (siCTRL). The following day, medium with orwithout lapatinib (0.33 or 1.0 μM) was added. Medium was subsequently changed every 3 d. Ten days after plating, cells were fixed and stained with crystalviolet. (C) BT474, SKBR3, and MDA453 cells were treated with lapatinib with and without AMG-888 for the times indicated. Whole cell lysates were preparedand separated in a 7% SDS gel followed by immunoblot analysis with the indicated antibodies. (D) BT474, SKBR3, and MDA453 cells were seeded in six-wellplates in 10% FCS. The following day, cells were changed to serum-free media and treated with lapatinib, AMG-888, or the combination. Forty-eight h later,adherent and floating cells were collected and subjected to TUNEL assay using the APO-BrdU kit. Each bar represents the mean ± SEM of cells with apoptoticnuclei for each treatment group (n = 3). y axis indicates the percent of apoptotic nuclei where control IgG-treated cells have been normalized to zero. Forcomparison of lapatinib (ctrl IgG + lap) to the combination of AMG-888 and lapatinib (AMG + lap), P = 0.025, 0.064, and 0.015 for BT474, SKBR3, and MDA453cells, respectively. (E) BT474 and MDA453 cells were seeded in Matrigel as indicated in Methods and allowed to grow in the absence or presence of lapatinib(1 μM) or the HER3 antibdy AMG-888 (10 μg/mL) or both. Medium was subsequently changed every 3 d. (Left) BT474 cells. (Upper) Images shown were recorded10 d after cell seeding. (Lower) The mean acini size was determined for each treatment group. Each bar graph represents the mean ± SEM of 3 fields from 2wells each. (Right) MDA453 cells. (Upper) Images shown were recorded 9 d after cell seeding. (Lower) Because of the irregular shape of the 3D structures, thenumber of cells per well was measured with a hemocytometer; dispase and trypsin were used to release cells from the Matrigel and obtain a single-cellsuspension. Each bar graph represents the mean cell number ± SEM from two wells each. *P < 0.05 and **P < 0.01.

Garrett et al. www.pnas.org/cgi/content/short/1016140108 7 of 10

Fig. S7. Inhibition of HER3 sensitizes cells to lapatinib in vivo. Female athymic mice were injected with BT474 cells. Once tumors reached a volume ≥200 mm3,mice were randomized to (i) 20 mg/kg normal human IgG i.p. twice a week and vehicle daily via orogastric gavage (control), (ii) lapatinib (100 mg/kg daily viaorogastric gavage), or (iii) a combination of lapatinib and AMG-888 (20 mg/kg i.p. twice a week). Treatment was administered for 24 d. (A) Tumors weremeasured two to three times a week with calipers and volume in mm3 calculated as described in Materials and Methods. Each data point represents the meantumor volume ± SEM (n = 8). *P < 0.05, **P < 0.01 vs. control, #P < 0.05, ##P < 0.01 vs. lapatinib. (B) IHC analysis of Y1221/2 P-HER2 and BrdU in tumor sections.BrdU (150 mg/kg) was administered 2 h before mouse sacrifice. (Left) Representative images from control tumors, lapatinib-treated tumors, and lapatinib-and-AMG-888-treated. (Right) Quantitative comparison of membrane histoscore (P-HER2) or percent BrdU+ cells. Student t test was used for statistical comparisons.*P ≤ 0.05 compared with control. For P-HER2, control vs. lapatinib, P = 0.18; control vs. lapatinib + AMG-888, P = 0.11 (n = 7).

Garrett et al. www.pnas.org/cgi/content/short/1016140108 8 of 10

Fig. S8. Recovery of P-HER3 is independent of Met, Src, EGFR, and FGFR kinases but depends on HER2. (A) BT474 and SKBR3 cells were treated with lapatinibin the absence or presence of SU11274, dasatinib, gefitinib, or SU5402. Drugs and fresh medium were replenished every 24 h. Whole cell lysates were preparedand separated in a 7% SDS gel followed by immunoblot analysis with Y1197 P-HER3, HER3, and β-actin antibodies. (B) Indicated cells were treated withlapatinib ± pertuzumab, trastuzumab, or BIBW2992. In the bottom panel, 1 and 5 μM lapatinib were compared side by side over 1-48 h. Drugs and freshmedium were replenished every 24 h. Whole cell lysates were subjected to immunoblot analysis with 1197 P-HER3, HER3, and β-actin antibodies.

Garrett et al. www.pnas.org/cgi/content/short/1016140108 9 of 10

0

2

4

6

8

10

12

DMSO trastuzumab lapatinib

norm

aliz

ed e

xpre

ssio

n (d

dCt)

qRT-PCR for HER3 BT474

SKBR3

SUM225

A

B

Fig. S9. Trastuzumab does not affect downstream signaling or increase HER3 levels. (A) BT474 and SKBR3 cells were treated with either 1 μM lapatinib or 20μg/mL trastuzumab for 1 or 24 h. Whole cell lysates were prepared and separated in a 7% SDS gel followed by immunoblot analysis with antibodies indicatedon the right. (B) BT474, SKBR3, and SUM225 cells were treated with DMSO (control), trastuzumab, or lapatinib for 24 h. Total RNA was extracted and subjectedto reverse transcription followed by qPCR for HER3. Data were normalized to untreated cells.

Garrett et al. www.pnas.org/cgi/content/short/1016140108 10 of 10