Supporting Information€¦ · feeding with dsRNAs. (B–I) Localization of TYLCV and Vg in ovaries...
7
Supporting Information Wei et al. 10.1073/pnas.1701720114 SI Text Insects, Viruses, and Plants. Two cryptic species of the Bemisia tabaci whitefly complex, Middle East Asia Minor 1 (MEAM1) (mitochon- drial cytochrome oxidase I; GenBank accession no. GQ332577.1) and Mediterranean (MED) (mitochondrial cytochrome oxidase I; GenBank accession no. GQ371165), were reared on cotton plants (Gossypium hirsutum L. cv. Zhemian 1793) in insect-proof cages at 26 °C (±1 °C) under a photoperiod of 14:10 h (light/dark) and relative humidity of 50% (±10%). The purity of the cultures was monitored every three generations using the random amplified polymorphic DNA-PCR technique and the sequence of mitochondrial cyto- chrome oxidase I gene, which has been used widely to differentiate B. tabaci genetic groups (17). Clones of TYLCV isolate SH2 (GenBank accession no. AM282874.1) and PaLCuCNV isolate HeNZM1 (GenBank accession no. FN256260.1) were agroinoculated into plants of tomato ( Solanum lycopersicum L. cv. Hezuo903). Un- infected tomato plants were grown in insect-proof greenhouses under controlled temperature at 25 ± 3 °C and natural lighting supplemented with artificial lights for 14 h a day from 0600 to 2000 hours. q(RT)-PCR Analysis. For viral DNA quantification, total DNA was extracted using previously described methods (54). Whitefly adults or tissue samples were ground in 40 μL of ice-cold lysis buffer (5 mM Tris·HCl, pH 8.4, 0.5 mM EDTA, 0.5% Nonidet P-40, and 1 mg/mL proteinase K) and then were incubated at 65 °C for 2 h, and then 100 °C for 10 min. The supernatants were kept at −20 °C. For Vg expression level measurement, total RNA was first isolated using TRIzol reagent (catalog no. 15596018; Ambion), and then cDNAs were produced with random primers using the PrimeScript RT reagent kit with gDNA Eraser (catalog no. RR047A; TaKaRa). q(RT)-PCR was performed using an ABI Prism 7500 Fast Real-Time PCR system (Applied Biosystems) with SYBR Premix Ex TaqTM II (catalog no. RR820A; TaKaRa) and the primers are shown in Table S4. For each reaction, 0.8 μL of each primer (10 mM), 6.4 μL of nuclease-free water, and 10 μL of SYBR Premix Ex Taq were added, in a total volume of 20 μL. The q(RT)-PCR protocol was 95 °C for 30 s, followed by 40 cycles of at 95 °C for 5 s and 60 °C for 30 s. A negative control (nuclease-free water) was included throughout the experiments to detect contamination and to determine the degree of dimer formation. The results (threshold cycle values) of the q(RT)- PCR assays were normalized to the expression level of B. taba- ci β-actin gene. The relative abundance of viral DNA or relative expression level of Vg was calculated using the 2 −ΔCt method. dsRNA Preparation. dsRNA specific to Vg of B. tabaci (GenBank accession no. GU332720) or GFP was synthesized using the AmpliScribe T7-Flash Transcription Kit (catalog no. ASF3507; Epicentre), following the manufacturer’s instructions. Briefly, the DNA template for dsRNA synthesis was amplified with primers containing the T7 RNA polymerase promoter at both ends (Table S4), and the purified DNA template (200 ng) was then used to generate dsRNAs. Subsequently, the synthesized dsRNA was purified via phenol-chloroform precipitation and resuspended in nuclease-free water, and the concentration of dsRNA was quantified with a NanoDrop 2000 (Thermo Fisher Scientific). Finally, the quality and size of the dsRNAs were further verified via electrophoresis in a 1% agarose gel. Determination of Ovary Development. Two days after eclosion (DAE), adult whiteflies were treated with dsRNAs for 48 h. After treatments, the insects were transferred to cotton plants to feed for another 48 h. Then ovaries (n = 30) were dissected from female whiteflies and observed under a Zeiss Stemi 2000-C stereomicroscope for counting the number of oocytes at different development phases. Observation of Whitefly Fecundity. Whiteflies at 2 DAE were treated with dsRNAs for 48 h. After treatments, the insects were collected in groups of 10 per replicate (female/male = 1:1). For each replicate of a treatment, the 10 insects was placed on the lower surface of a leaf of a cotton plant, a nonhost plant of TYLCV, enclosed in a leaf clip cage. The adults were left on the leaf to feed, mate, and oviposit for 72 h at 26–31 °C, 40–60% relative humidity, and a photoperiod of 14:10 h (light/dark). Then, all adults were removed and the number of eggs was counted under a Zeiss Stemi 2000-C stereomicroscope. Oral Ingestion of Vg Antibodies. Adult whiteflies at 5–8 DAE were collected and fed with anti-Vg antibodies (1:200) or mouse preimmune serum (1:200, control) in 15% (wt/vol) sucrose so- lution using membrane feeding device. Approximately 100 adult whiteflies were released into each feeding chamber, and the feeding device was incubated in an insect-rearing room for 48 h. Subsequently, whiteflies were transferred to TYLCV-infected tomato plants for a 48-h AAP, and then collected in group of 10 for each replicate (female/male = 1:1) and used to examine transovarial transmission of TYLCV. Engineering Infectious Clones of CP Mutant Viruses. Procedures for construction of infectious clones of mutated TYLCV (mTYLCV) and mutated PaLCuCNV (mPaL) were performed as previously described (55, 56). Briefly, a 423-bp fragment (positions 241–663) of the TYLCV CP gene was replaced with a 420-bp fragment (positions 241–660) of the PaLCuCNV CP gene by overlap ex- tension PCR (see Fig. S4A for details of the replaced region). The fidelity of mTYLCV and mPaL was examined by Sanger sequencing. Image Acquisition and Processing. Fluorescence images were ac- quired using a Zeiss LSM 710 confocal microscope. Nuclear DNA was visualized using a 405-nm laser for excitation; the Dylight 488- labeled antibody and Dylight 549-labeled antibody were visual- ized using a 488-nm laser and a 561-nm laser for excitation, re- spectively. Maximum intensity projection images were generated using the ZEN 2010 digital imaging system. Transovarial Transmission of TYLCV on Tomato Plants in Field Cages. From April to June 2016, we conducted a viral transmission trial under field cage condition using adults that developed from eggs laid by viruliferous whiteflies on cotton, a nonhost plant of TYLCV. For either MEAM1 or MED, we first set up three cages with 120 mesh gauze (proven to be inaccessible to whitefly adults) in the field, with the size 1.3 m × 1.3 m × 1.3 m. In each of the field cages, we planted 30 tomato seedlings. Meanwhile, we set up three cohorts of either MEAM1 and MED in the laboratory, each cohort with one cotton plant. We released 50 viruliferous female adults and 50 viruliferous male adults into each cage and allowed them to mate, feed, and oviposit on the cotton plant for 3 d. We then removed all of the adults and reared the eggs to adults on the cotton plant. Twenty-five days later, we collected ∼500 adults (females and males mixed) from each cage and re- leased them into a field cage for virus inoculation. The tomato plants at the time of whitefly release were at 3–4 true-leaf stage. Wei et al. www.pnas.org/cgi/content/short/1701720114 1 of 7
Transcript of Supporting Information€¦ · feeding with dsRNAs. (B–I) Localization of TYLCV and Vg in ovaries...
Supporting InformationWei et al. 10.1073/pnas.1701720114SI TextInsects, Viruses, and Plants. Two cryptic species of the Bemisia tabaciwhitefly complex, Middle East Asia Minor 1 (MEAM1) (mitochon-drial cytochrome oxidase I; GenBank accession no. GQ332577.1)and Mediterranean (MED) (mitochondrial cytochrome oxidase I;GenBank accession no. GQ371165), were reared on cotton plants(Gossypium hirsutum L. cv. Zhemian 1793) in insect-proof cages at26 °C (±1 °C) under a photoperiod of 14:10 h (light/dark) and relativehumidity of 50% (±10%). The purity of the cultures was monitoredevery three generations using the random amplified polymorphicDNA-PCR technique and the sequence of mitochondrial cyto-chrome oxidase I gene, which has been used widely to differentiateB. tabaci genetic groups (17). Clones of TYLCV isolate SH2(GenBank accession no. AM282874.1) and PaLCuCNV isolateHeNZM1 (GenBank accession no. FN256260.1) were agroinoculatedinto plants of tomato (Solanum lycopersicum L. cv. Hezuo903). Un-infected tomato plants were grown in insect-proof greenhouses undercontrolled temperature at 25 ± 3 °C and natural lighting supplementedwith artificial lights for 14 h a day from 0600 to 2000 hours.
q(RT)-PCR Analysis. For viral DNA quantification, total DNA wasextracted using previously described methods (54). Whiteflyadults or tissue samples were ground in 40 μL of ice-cold lysisbuffer (5 mM Tris·HCl, pH 8.4, 0.5 mM EDTA, 0.5% NonidetP-40, and 1 mg/mL proteinase K) and then were incubated at65 °C for 2 h, and then 100 °C for 10 min. The supernatants werekept at −20 °C.For Vg expression level measurement, total RNA was first
isolated using TRIzol reagent (catalog no. 15596018; Ambion),and then cDNAs were produced with random primers using thePrimeScript RT reagent kit with gDNA Eraser (catalog no.RR047A; TaKaRa). q(RT)-PCR was performed using an ABIPrism 7500 Fast Real-Time PCR system (Applied Biosystems)with SYBR Premix Ex TaqTM II (catalog no. RR820A; TaKaRa)and the primers are shown in Table S4. For each reaction, 0.8 μLof each primer (10 mM), 6.4 μL of nuclease-free water, and10 μL of SYBR Premix Ex Taq were added, in a total volume of20 μL. The q(RT)-PCR protocol was 95 °C for 30 s, followed by40 cycles of at 95 °C for 5 s and 60 °C for 30 s. A negative control(nuclease-free water) was included throughout the experimentsto detect contamination and to determine the degree of dimerformation. The results (threshold cycle values) of the q(RT)-PCR assays were normalized to the expression level of B. taba-ci β-actin gene. The relative abundance of viral DNA or relativeexpression level of Vg was calculated using the 2−ΔCt method.
dsRNA Preparation. dsRNA specific to Vg of B. tabaci (GenBankaccession no. GU332720) or GFP was synthesized using theAmpliScribe T7-Flash Transcription Kit (catalog no. ASF3507;Epicentre), following the manufacturer’s instructions. Briefly,the DNA template for dsRNA synthesis was amplified withprimers containing the T7 RNA polymerase promoter at bothends (Table S4), and the purified DNA template (200 ng) wasthen used to generate dsRNAs. Subsequently, the synthesizeddsRNA was purified via phenol-chloroform precipitation andresuspended in nuclease-free water, and the concentration ofdsRNA was quantified with a NanoDrop 2000 (Thermo FisherScientific). Finally, the quality and size of the dsRNAs werefurther verified via electrophoresis in a 1% agarose gel.
Determination of Ovary Development. Two days after eclosion(DAE), adult whiteflies were treated with dsRNAs for 48 h. After
treatments, the insects were transferred to cotton plants to feedfor another 48 h. Then ovaries (n = 30) were dissected fromfemale whiteflies and observed under a Zeiss Stemi 2000-Cstereomicroscope for counting the number of oocytes at differentdevelopment phases.
Observation of Whitefly Fecundity. Whiteflies at 2 DAE weretreated with dsRNAs for 48 h. After treatments, the insects werecollected in groups of 10 per replicate (female/male = 1:1). Foreach replicate of a treatment, the 10 insects was placed on thelower surface of a leaf of a cotton plant, a nonhost plant ofTYLCV, enclosed in a leaf clip cage. The adults were left on theleaf to feed, mate, and oviposit for 72 h at 26–31 °C, 40–60%relative humidity, and a photoperiod of 14:10 h (light/dark).Then, all adults were removed and the number of eggs wascounted under a Zeiss Stemi 2000-C stereomicroscope.
Oral Ingestion of Vg Antibodies. Adult whiteflies at 5–8 DAE werecollected and fed with anti-Vg antibodies (1:200) or mousepreimmune serum (1:200, control) in 15% (wt/vol) sucrose so-lution using membrane feeding device. Approximately 100 adultwhiteflies were released into each feeding chamber, and thefeeding device was incubated in an insect-rearing room for 48 h.Subsequently, whiteflies were transferred to TYLCV-infectedtomato plants for a 48-h AAP, and then collected in group of10 for each replicate (female/male = 1:1) and used to examinetransovarial transmission of TYLCV.
Engineering Infectious Clones of CP Mutant Viruses. Procedures forconstruction of infectious clones of mutated TYLCV (mTYLCV)and mutated PaLCuCNV (mPaL) were performed as previouslydescribed (55, 56). Briefly, a 423-bp fragment (positions 241–663)of the TYLCV CP gene was replaced with a 420-bp fragment(positions 241–660) of the PaLCuCNV CP gene by overlap ex-tension PCR (see Fig. S4A for details of the replaced region).The fidelity of mTYLCV and mPaL was examined by Sangersequencing.
Image Acquisition and Processing. Fluorescence images were ac-quired using a Zeiss LSM 710 confocal microscope. Nuclear DNAwas visualized using a 405-nm laser for excitation; the Dylight 488-labeled antibody and Dylight 549-labeled antibody were visual-ized using a 488-nm laser and a 561-nm laser for excitation, re-spectively. Maximum intensity projection images were generatedusing the ZEN 2010 digital imaging system.
Transovarial Transmission of TYLCV on Tomato Plants in Field Cages.From April to June 2016, we conducted a viral transmission trialunder field cage condition using adults that developed from eggslaid by viruliferous whiteflies on cotton, a nonhost plant ofTYLCV. For either MEAM1 or MED, we first set up three cageswith 120 mesh gauze (proven to be inaccessible to whitefly adults)in the field, with the size 1.3 m × 1.3 m × 1.3 m. In each of thefield cages, we planted 30 tomato seedlings. Meanwhile, we setup three cohorts of either MEAM1 and MED in the laboratory,each cohort with one cotton plant. We released 50 viruliferousfemale adults and 50 viruliferous male adults into each cage andallowed them to mate, feed, and oviposit on the cotton plant for3 d. We then removed all of the adults and reared the eggs toadults on the cotton plant. Twenty-five days later, we collected∼500 adults (females and males mixed) from each cage and re-leased them into a field cage for virus inoculation. The tomatoplants at the time of whitefly release were at 3–4 true-leaf stage.
Wei et al. www.pnas.org/cgi/content/short/1701720114 1 of 7
One month later, we collected one young leaf from each of thetomato plants in the cages and diagnosed for TYLCV infection.In the three cages inoculated with adult progeny of viruliferousMEAM1 whiteflies, on average 26% of the plants were infectedby TYLCV, whereas in the three cages inoculated with adultprogeny of viruliferous MED whiteflies, on average 22% of theplants were infected by TYLCV (Fig. S7).
Field Sampling of TYLCV Infection of Whitefly Progeny on Cotton. InMay 2016, on a farm in a Hangzhou suburb, we found a plot ofcotton grown next to a plot of tomato that was infected by TYLCV.We also found that the cotton plants were infested by whiteflies.We assumed that if whitefly eggs/nymphs on cotton were infectedby a begomovirus, they were likely progeny of viruliferous whitefliesfrom the diseased tomato plants nearby, because cotton is a
nonhost of all of the begomoviruses we had recorded in this region.We randomly collected 48 whitefly eggs and 48 whitefly nymphsfrom cotton plants along the edge of the cotton plot (within 5 mfrom the edge of the virus-infected tomato) and brought them backto the laboratory. Using the molecular methods presented in themain text, we found that all of the eggs and nymphs were ofMEAM1, and 16 of the 48 eggs (33%) and 11 of the 48 nymphs(23%) were viruliferous with TYLCV (Table S3).
Statistics. Data were presented as mean ± SEM of three in-dependent biological replicates, unless otherwise noted. Statisticalanalysis was performed using SPSS (version 13). Means werecompared using one-way ANOVA followed by least significantdifference (LSD) test at the P < 0.05 significance level. No sta-tistical methods were used to predetermine the sample size.
Fig. S1. Ovary morphology of the whitefly B. tabaci and localization of virus in different tissues of MEAM1 whitefly. (A) Ovary (upper lane) of whiteflies atdifferent developmental stages and oocyte (lower lane) at different developmental phases. Stage I, freshly emerged whitefly; stage II, 1–2 DAE; stage III, 3–10DAE; and stage IV, 11–14 DAE. There was no yolk protein in phase I oocyte. The yolk content of oocyte gradually increased at phases II, III, and IV. (Scale bar,0.10 mm.) (B) Localization of PaLCuCNV in ovaries of MEAM1 whiteflies at different developmental stages. Green, anti-PaLCuCNV CP. Blue (DAPI), cell nucleus.(C–E) The proportion of TYLCV or PaLCuCNV (PaL)-positive midguts (MGs) (C), primary salivary glands (PSGs) (D), and ovaries (E). MGs (n = 24), PSGs (n = 24),and ovary (n = 24). Mean ± SEM from three experiments. P < 0.05 (one-way ANOVA, LSD test). White arrows indicate mature oocytes in ovaries. Red arrowsindicate dissected ovariole.
Wei et al. www.pnas.org/cgi/content/short/1701720114 2 of 7
Fig. S2. Localization of Vg in ovarioles of whitefly. (A) Ovariole structure of whitefly. (B) Localization of Vg in ovarioles at different developmental phases.Phase I, Vg was not detected in the ovariole. Phase II, Vg began to accumulate in the space between follicular cells and just started to be absorbed into oocyte.Phase III, massive Vg accumulated in the space between follicular cells and was absorbed into the oocyte. F-actin was stained with phalloidin (red). Vg wasdetected by use of a mouse anti-Vg monoclonal antibody and goat anti-mouse IgG labeled with Dylight 549 (red) secondary antibody. Cell nucleus was stainedwith DAPI (blue). FC, follicular cells; O, oocyte; So, segregating oocyte; T, tropharium; Tn, trophocytes nucleus; V, vitellarium.
Fig. S3. Knocking down the expression of Vg reduced yolk accumulation into oocytes and impeded entry of TYLCV into the ovary. (A) Vg protein levels afterfeeding with dsRNAs. (B–I) Localization of TYLCV and Vg in ovaries of dsGFP (B–E)- or dsVg (F–I)-treated whiteflies after a 48-h AAP on TYLCV-infected plants.C–E are the magnification of the boxed area in B, and G–I are the magnification of boxed area in F. TYLCV virions were detected by use of a rabbit anti-CPpolyclonal antibody and goat anti-rabbit IgG labeled with Dylight 488 (green) secondary antibody. Vg was detected by use of a mouse anti-Vg monoclonalantibody and goat anti-mouse IgG labeled with Dylight 549 (red) secondary antibody. Cell nucleus was stained with DAPI (blue). Yellow color indicates theoverlay of red and green.
Wei et al. www.pnas.org/cgi/content/short/1701720114 3 of 7
Fig. S4. Comparison of amino acid sequence of TYLCV and PaLCuCNV coat protein (CP) and typical disease symptoms of viruses used in this study.(A) Comparison of amino acid sequence of TYLCV and PaLCuCNV (PaL) CP. Alignments were done by GeneDoc. The different regions are indicated in red. Theexchanged region is indicated by a blue underline. (B) Typical disease symptoms of TYLCV, mutant TYLCV (mTYLCV), PaLCuCNV (PaL), and mutant PaLCuCNV(mPaL).
Fig. S5. Localization of mTYLCV or mPaLCuCNV in different tissues of MEAM1 whitefly. (A) Localization of mutant TYLCV (mTYLCV) or mutant PaLCuCNV(mPaL) in midguts (MGs), primary salivary glands (PSGs), and ovaries of viruliferous whiteflies at 11 DAE. Mutant TYLCV (mTYLCV) and mutant PaLCuCNV(mPaL) virions were detected by use of a mouse anti-CP monoclonal antibody and goat anti-mouse IgG labeled with Dylight 488 (green) secondary antibody.Cell nucleus was stained with DAPI (blue). (B–D) The proportion of mutant TYLCV (mTYLCV) or mutant PaLCuCNV (mPaL)-positive MGs (n = 24) (B), PSGs (n =24) (C), and ovaries (n = 24) (D). Mean ± SEM from three experiments. P < 0.05 (one-way ANOVA, LSD test). White arrows indicate mature oocytes.
Wei et al. www.pnas.org/cgi/content/short/1701720114 4 of 7
Fig. S6. Localization of viruses and Vg in different tissues of MED whiteflies. (A–D) Localization of TYLCV or PaLCuCNV (PaL) in midguts (MGs) (n = 24),primary salivary glands (PSGs) (n = 24), and ovaries (n = 24) of viruliferous MED whiteflies at 11 DAE. For A, TYLCV and PaL virions were detected by use of amouse anti-CP monoclonal antibody and goat anti-mouse IgG labeled with Dylight 488 (green) secondary antibody. White arrows indicate mature oocytes. ForB–D, mean ± SEM from three experiments. P < 0.05 (one-way ANOVA, LSD test). (E) TYLCV and Vg colocalized with each other in ovariole of MED whitefly.TYLCV virions were detected by use of a rabbit anti-CP polyclonal antibody and goat anti-rabbit IgG labeled with Dylight 488 (green) secondary antibody. Vgwas detected by use of a mouse anti-Vg monoclonal antibody and goat anti-mouse IgG labeled with Dylight 549 (red) secondary antibody. Cell nucleus wasstained with DAPI (blue). Yellow color indicates the overlay of red and green.
Wei et al. www.pnas.org/cgi/content/short/1701720114 5 of 7
Fig. S7. Infection of tomato plants in field cages by first-generation adults that developed from eggs deposited on cotton by viruliferous MEAM1 and MEDadult whiteflies. Data are mean (±SEM) percentages of TYLCV-infected plant of three replicates.
Table S1. A comprehensive comparison of the results of different studies on transovarial transmission of begomoviruses by whiteflyBemisia tabaci
Viral DNA Infectivity
Virus Whitefly species Whitefly age, DAE* Source Egg† Nymph† Adult† Plant‡
TYLCV —§
— (35) — — — 0%MYMV — — (22) — — — 0% (0/15)MYMV — — (22) — — — 0% (0/70)TLCV — — (22) — — — 0% (0/195)ACMV — — (22) — — — 0% (0/45)TYLCV MEAM1 5–8 (42) 81% (46/57) 37% (25/68) 57% (46/81) 10% (5/50)TYLCV MEAM1 — (38) 0% (0/100) 0% (0/100) 0% (0/125) 0% (0/106)TYLCSV MEAM1 — (38) 9% (10/110) 29% (32/110) 2% (5/250) 0% (0/118)TYLCV MEAM1 1 (40) 28% (11/40) 8% (6/80) 0% (0/40) —
TYLCV MED 1 (40) 17% (13/75) 15% (22/150) 3% (2/75) 0% (0/20)TYLCCNV MEAM1 1 (40) 19% (14/75) 11% (17/150) 0% (0/75) 0% (0/20)TYLCCNV MED 1 (40) 1% (1/75) 1% (2/150) 0% (0/75) —
TYLCV MEAM1 2 (41) 30% (30/100) 11% (22/200) 0% (0/100) —
TYLCV MED 2 (41) 50% (50/100) 11% (22/200) 0% (0/100) —
TYLCV MEAM1 — (39) — — 0% (0/340) 0% (0/340)TYLCV MEAM1 1 This study 13% (8/60) 8% (5/60) 0% (0/60) 0% (0/24)TYLCV MEAM1 11 This study 92% (55/60) 68% (41/60) 77% (46/60) 21% (5/24)TYLCV MED 1 This study 18% (11/60) 5% (3/60) 0% (0/24) 0% (0/24)TYLCV MED 11 This study 85% (51/60) 77% (46/60) 67% (40/60) 33% (8/24)PaLCuCNV MEAM1 1 This study 0% (0/80) 0% (0/80) 0% (0/80) —
PaLCuCNV MEAM1 11 This study 0% (0/80) 0% (0/80) 0% (0/80) —
PaLCuCNV MED 1 This study 0% (0/80) 0% (0/80) 0% (0/80) —
PaLCuCNV MED 11 This study 0% (0/80) 0% (0/80) 0% (0/80) —
*Days after eclosion.†Positive/tested.‡Infected/tested.§Not mentioned or not tested.
Wei et al. www.pnas.org/cgi/content/short/1701720114 6 of 7
Table S2. Transovarial transmission of PaLCuCNV via ovum ofMEAM1 or MED whitefly at 1 and 11 DAE
Whitefly species DAE Eggs* Nymphs* Adults*
MEAM1 1 0/80 0/80 0/8011 0/80 0/80 0/80
MED 1 0/80 0/80 0/8011 0/80 0/80 0/80
*Positive/tested.
Table S3. Field investigation of transovarial transmission ofTYLCV by whiteflies
Whitefly species Eggs* Nymphs*
MEAM1 16/48 11/48
*Positive/tested.
Table S4. Primers used in this study
Primer name* Sequence, 5′–3′† Length, bp Purpose
TYLCV-F CAGAGCAGTTGATCATG 682 TYLCV DNA detectionTYLCV-R ATCGAAGCCCTGATATCCCCCGTGGPaLCuCNV-F TAGTCATTTCCACTCCCGC 645 PaLCuCNV DNA detectionPaLCuCNV-R TGATTGTCATACTTCGCAGCmTYLCV-F CAGAGCAGTTGATCATG 679 Mutant TYLCV DNA detectionmTYLCV-R ATCGAAGCCCTGATATCCCCCGTGGmPaLCuCNV-F CCTGATGTTCCTCGTGGTT 408 Mutant PaLCuCNV DNA detectionmPaLCuCNV-R CCTGTTCCTTCATTCCAGAGQTYLCV(mTYLCV)-F GAAGCGACCAGGCGATATAA 189 qPCR for TYLCV (mutant TYLCV)QTYLCV(mTYLCV)-R GGAACATCAGGGCTTCGATAQPaL(mPaL)-F GACCCGCCGATATAGTCATT 109 qPCR for PaLCuCNV (mutant PaLCuCNV)QPaL(mPaL)-R GTTTGTGACGAGGACAGTGGQVg-F ACAAGTCTCCGACGCCGAAG 185 qRT-PCR for VgQVg-R TTGACATCGGCTTTACGGCAQβ-Actin-F TCTTCCAGCCATCCTTCTTG 173 q(RT)-PCR for β-ActinQβ-Actin-R CGGTGATTTCCTTCTGCATTVg-RNAi-F T7-ACATCGTCAAGGCCACCAA 451 Vg dsRNA synthesisVg-RNAi-R T7-TAGAGCTGGAACTAGATGAGgfp-RNAi-F T7-CTCGTGACCACCCTGACCTAC 314 dsgfp synthesisgfp-RNAi-R T7-GTTCACCTTGATGCCGTTCTTPaL CP-GST-F CGGGATCCATGTCGAAGCGACCCGCCG 790 Expression of PaL CP in E. coliPaL CP-GST-R CGGAATTCTTAATTCTGAACAGAATCA (BamHI and EcoRI sites are underlined)TYLCV CP-GST-F CGGGATCCATGTCGAAGCGACCAGGCGA 793 Expression of TYLCV CP in E. coliTYLCV CP-GST-R CGGAATTCTTAATTTGATATTGAATCAT (BamHI and EcoRI sites are underlined)
*Additional primer sequences are available upon request.†T7, 5′-TAATACGACTCACTATAGG-3′.
Wei et al. www.pnas.org/cgi/content/short/1701720114 7 of 7
![(Ty-2) fT86] @ (Cf-9) 5.6 (M) (R) T8611 (TYLCV) r T86] 10—6B rT86] CTYLCVD TEL.03-5521-5159 NDMA 1 407S2000 TEL.0587-97-2525 TEL.0272-53-9321 TEL.0229-32-2221 ...](https://static.fdocuments.in/doc/165x107/60c7106e0040ab4531103a55/ty-2-ft86-cf-9-56-m-r-t86-11-tylcv-r-t86-10a6b-rt86-ctylcvd-tel03-5521-5159.jpg)
