Supported by a grant from the Alfred P. Sloan Foundation

What is the Urban Barcode Project (UBP)?

• UBP is a way for NYC high school students to take part in a global effort to identify living things

• A chance to explore the living environment in NYC

• An opportunity to compete for $20,000 in prizes

What is DNA barcoding and why is it important?

ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTAGCTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACGATG

Organism is sampled DNA is extracted “Barcode” amplified

DNA barcodes identify species

Sequenced DNA creates a unique “barcode” for each species

How many species can you name?

How many animals did you name?How many mammals?

How many plants?How many insects?

“Cat”Felis catus

“Dog”Canis lupus familiaris

“Oak Tree”Quercus alba

“Shark”Ginglymostoma cirratum

“Beetle”Popillia japonica

Issue #1: No one knows how many species there are.

• Currently between 1.5 and 2 million species are described/known

• This number may represent as little as half of the true number of species

• Perhaps more than 1/3 of all species are threatened(IUCN Red list version 2010.1)

Vertebrates Species

Mammals 5,490

Birds 9,998

Reptiles 9,084

Amphibians 6,433

Fishes 31,300

Total 62,305

Invertebrates Species

Insects 1,000,000

Mollusks 85,00

Crustaceans 47,000

Corals 2,175

Arachnids 102,248

Total (+others) 1,305,250

Plants Species

Angiosperms 281,821

Gymnosperms 1,021

Ferns and Allies 12,000

Mosses 16,236

Algae 10,134

Total 321,212

Issue #2: There is a lack of agreement of what “species” means.

Canis lupus Canis lupus (familiaris)

Anas platyrhynchos

Defining “species” is complex and

depends on many factors:

• Interbreeding capabilities

• Morphological variation

• Ecological context

• Genetic similarities

?

Issue #3: Traditional taxonomic identification methods may be inadequate/too slow to capture vanishing biodiversity.

Classical taxonomy is difficult for non-experts to understand

The body form ranges from hemispherical (e.g., Cleidostethus) to elongate oval (e.g., Clypastraea) to latridiid-like (e.g., Foadia).  Corylophids are typically dull brown, but some species have contrasting yellowish-brown patches on the pronotum or elytra.  The integument is often densely punctured and may be glabrous or bear short, fine recumbent setae.  Most corylophid adults can be diagnosed using the following morphological features: Maxilla with single apical lobe; Mesotrochanter short and strongly oblique; Head usually covered by pronotum; Frontoclypeal suture absent; Antennae elongate with 3-segmented club; Procoxal cavities closed externally; Tarsal formula 4-4-4; Pygidium exposed

Adding to the complexity: immature, damaged, or incomplete specimen may make identification impossible.

ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTAGCTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACGATG

Organism is sampled DNA is extracted “Barcode” amplified

Sequenced DNA is compared with a barcode database

How barcoding works

Why DNA barcoding works: genes with the right number of differences.

matKrbcL

CHLOROPLAST MITOCHONDRION

CO1

Fail: Sequence is completely conserved, good for PCR, but uninformative as barcode

Fail: Sequence shows no conservation, impossible for PCR, but good as barcode

Win: Sequence shows ~70% conservation, good for PCR, good as barcode

Why DNA barcoding works: differences allow identification

Issue #4: Education lacks opportunities to engage students in their own learning.

DNA barcoding is engaging in the classroom, and directs curiosity to opportunities for practical inquiry…

Kate Stoeckle

August 23, 2008

Contributing to big science

How will UBP work?

1. Students will convene in teams and design projects that use DNA barcoding to answer a

question

Who can enter the competition?

• Competition is open to NYC high school students enrolled in grades 9–12.

• Student teams consist of either 9th-10th or 11th -12th graders.

• Team members do not have to be from the same school.

• Teams of 2–4 students must be sponsored by a qualifying science teacher or mentor.

• Sponsors do not have to be from the same school as any of the students.

How can a teacher sponsor qualify?

• Prospective sponsors must participate in a six-hour training conducted by the DNA Learning Center (DNALC) in its Harlem DNA Lab. (A $150 stipend is available for teachers participating in the training.)

• A teacher oversees his/her students’ project.

• Sponsors can work with up to five student teams.

• Student project proposals are only accepted if sponsor has completed the official DNALC training.

• Training can be taken at the Harlem DNA Lab or other locations. See UBP website for dates.

• Participants must register through the UBP website.

What will teacher training entail?

1. Background information on DNA barcoding.

2. Detailed hands on instruction on how to extract DNA, perform PCR, conduct agarose gel analysis, get DNA samples sequenced and analyze sequences.

3. Instruction in bioinformatics and the use of the sequence analysis platform DNA Subway.

4. Assistance with proposal ideas and outlines

Who can be a science mentor?

• Science mentors can be postdoctoral fellows, graduate students, undergraduate students under supervision (e.g. university professors), or research fellows working in a university or a research institution/organization.

• Each team will be provided with a mentor who acts as an advisor in monitoring the project’s progress.

• Mentors have the option of participating in a six-hour training conducted by the DNA Learning Center (DNALC) in its Harlem DNA Lab or at other locations. See UBP website for dates. (A $150 stipend is available for mentors participating in the training.)

• All participants must register through the UBP website.

2. Student teams will enter UBP by submitting a research/project proposal

Research questions can be about any living thing or about non-living things (foods or other products) that

have DNA.

• Are there invasive (non-native) plants in my local park?

• What are the most popular types of flowers in my city?

• Do the teas I buy at my supermarket really contain the ingredients on the package?

• How many different living organisms can I find in an office building?

What research questions could students ask?

Examples:

Proposals are accepted during one of two submission windows

June 1-15, 2011 (Round I)

October 1-15, 2011 (Round II)

1. An introduction to the question, describing why your question is original, creative, and relevant. You should also have references to previous research, e.g. examples of DNA barcoding used to answer a similar question.

2. An explanation of the the goals of your project, and what you plan to achieve.

3. Methods, including how samples will be collected and processed.

4. Brief biographies and personal information for each team member.

Proposals should include:

3. If a proposal is accepted the research can begin

Collect Samples(Leaves, Insects,

Foods, etc. )

Collect Samples(Leaves, Insects,

Foods, etc. )

Do DNA Barcoding

Experiment

Do DNA Barcoding

Experiment

Get Results and Make

Conclusions

Get Results and Make

Conclusions

Project Workflow

You will have access to all the materials you need for theDNA barcoding component of your experiment

• DNA extraction kit

• PCR machine and reagents

• DNA sequencing

• Bioinformatic tools (analysis of DNA sequence)

The DNA barcoding equipment is safe and easy to use, and the experiments can be done in a few

hours depending on the number of samples

Materials and equipment are provided to participating teams:

• Either: by attending “Open Lab” days held in NYC at sites including:

- Harlem DNA Lab- New York Academy of Sciences

- American Museum of Natural History- The Rockefeller University

- Others (TBA)

• Or: by borrowing it from the UBP.

You will have access to online tools to

help you analyze your results

DNA Subway Blue Line

4. Finish your research, and present it at theUBP Symposium in Spring 2012

Summary1. Form a team of 2-4 NYC high school students and a qualifying

science teacher or mentor (sponsor).

2. Develop a project proposal.

3. Go to www.urbanbarcodeproject.org and submit your proposal online by the next deadline.

4. Proposals will be judged for originality, creativity, relevance, plausibility, and scientific merit. The top teams from each round of submissions will be invited to compete in the Urban Barcode Project.

5. Invited competitors must complete their projects by Spring 2012 and present their work at a project symposium.

Follow us Online

www.facebook.com/urbanbarcodeproject

twitter.com/urbanbarcode

www.urbanbarcodeproject.org

Latest news and announcements posted first to: