Corrected 16 April 2013; see below

www.sciencemag.org/cgi/content/full/340/6129/199/DC1

Supplementary Materials for

Latency-Associated Degradation of the MRP1 Drug Transporter During Latent Human Cytomegalovirus Infection

Michael P. Weekes, Shireen Y. L. Tan, Emma Poole, Suzanne Talbot, Robin Antrobus, Duncan L. Smith, Christina Montag, Steven P. Gygi, John H. Sinclair, Paul J. Lehner*

*Corresponding author. E-mail pjl30@cam.ac.uk

Published 12 April 2013, Science 340, 199 (2013)

DOI: 10.1126/science.1235047

This PDF file includes:

Materials and Methods Figs. S1 to S6 Tables S1 References (29–43)

Other supplementary material for this manuscript includes the following: (available at www.sciencemag.org/cgi/content/full/340/6129/199/DC1)

Table S2. Full list of proteins quantified (Fig. 1A and table S1) (Microsoft Excel)

Correction: Table S2 is now included in the supplementary materials.

2

Materials and Methods Cell lines and culture

The cell lines THP-1, HL60 and HL60-ADR were grown in RPMI-1640 (PAA), 10% foetal bovine serum (FBS) (PAA) and penicillin/streptomycin (pen/strep, Sigma). 0.2 μg/ml of doxorubicin was added to maintain HL60-ADRs. HFFs were grown in MEM-10 (PAA), 10% heat inactivated FBS and pen/strep. For SILAC analysis, cells were grown in SILAC RPMI 1640 (Thermo Pierce), 10% dialysed FBS (JRH Biosciences), and pen/strep. SILAC media was supplemented with either light (Arg 0, Lys 0, Sigma) or heavy (Arg 10, Lys 8, Cambridge Isotope Laboratories) amino acids at 50 mg/l and L-proline at 280 mg/l. Incorporation of heavy label was >98% for both arginine and lysine-containing peptides. Stable cell lines were created by lentiviral transduction of parent cells.

Primary cells

Primary CD14 monocytes were isolated and cultured as previously described (23) from the venous blood of healthy donors who had given informed consent under a protocol approved by the Cambridge Local Research Ethics Committee. Primary CD34+ haematopoietic progenitors were isolated as previously described (5) from normal hematopoietic stem cell transplant donors to whom granulocyte colony-stimulating factor had been administered for stem cell mobilization. This protocol was approved by the Cambridge Local Research Ethics Committee.

Antibodies and reagents

Primary antibodies used for flow cytometry and immunofluorescence were: QCRL3 α-MRP1 (BD Pharmingen), α-DLL1 PE (BioLegend), α-TNFR1 APC (R and D systems), α-CD36 APC/Cy7 (BioLegend), α-CCR7 (R and D Systems), α-GFP FITC (Abcam) and anti-IE FITC (Argene). Anti-mouse Alexa Fluor 647 (Invitrogen) was used where required as a secondary antibody. Primary antibodies used for immunoblotting were: MRPr1 α-MRP1 (Enzo Life Sciences), α-HCMV IE antigen (Argene), α-HA (Covance), α-β-actin (Sigma), α-Calnexin (mAb AF8; a gift from M. Brenner, Harvard Medical School, Boston, MA). We generated an anti-UL138 antibody by immunisation of a rabbit with the peptide Ahx-Ahx-VHYHQEYT, where Ahx is amino-hexanoic acid (Cambridge Research Biochemicals). Antibody was purified using the immunising peptide. Secondary antibodies were supplied by Jackson laboratories.

The following reagents were used: the MRP1 inhibitor MK571 (Sigma), doxorubicin (MP Biomedicals), elacridar (Toronto Research Chemicals), vincristine (MP Biomedicals), puromycin (Sigma), trizol (Invitrogen), Concanamycin A (Enzo Life Sciences), MG132 (Enzo Life Sciences), A23187 (Sigma).

Plasmids, lentivirus propagation and transduction

3

UL138 (HCMV Toledo strain) in a pcDNA3 vector was subjected to site-directed mutagenesis to replace an internal BamHI site with a silent mutation. UL138 was tagged at the C-terminus with the influenza haemagglutinin tag (HA) (YPYDVPDYA) and with Strep-tag II (Strep) (SA-WSHPQFEK). The pHRSIN lentivirus expression system was used as previously described (29). Lentiviral expression plasmids were pHRSin UbEm (29) and pHRSIN with a puromycin resistance cassette (pHRSIN SFFVp) (30) (kind gift of Y. Ikeda). Virus preparation and cell transduction have been described elsewhere (29).

Viruses and infections

The recombinant viruses TB40E IE2-eYFP and TB40gfp (which expresses GFP under the control of the SV40 promoter, gift of Eain Murphy, Cleveland Clinic) have been described previously (31,32). These viruses as well as the Merlin HCMV clinical isolate, laboratory strain Toledo, ∆UL133-138 and ∆UL138 mutants in a Toledo background (12) laboratory strain TB40 and TB40∆UL138 (gift of H. Hengel, Dusseldorf, Germany) (11) were purified from infected fibroblasts on a sorbitol gradient as described previously (33).

Productive infection of HFF cells with HCMV was carried out as described previously (34,35). Experimental latent infection of CD34+ and CD14+ cells with HCMV has been described elsewhere (22,33,36). Briefly, cells were infected with HCMV (m.o.i. of 5-10) in X-vivo 15 medium and maintained for 7 days before harvesting for subsequent analysis.

For Fig. 4B-E and Fig. S4-5, vincristine treatment was always with 1µM elacridar to inhibit P-glycoprotein apart from Fig. 4E ‘mock’ – no elacridar.

Plasma membrane profiling

PMP was performed as described previously (13,37). Briefly, 1.5 × 108 of each SILAC-labelled cell type were pooled in a 1:1 ratio. Surface sialic acid residues were oxidized with sodium meta-periodate (Thermo) then biotinylated with aminooxy-biotin (Biotium). The reaction was quenched, and the biotinylated cells incubated in a 1% Triton X-100 lysis buffer. Biotinylated glycoproteins were enriched with high affinity streptavidin agarose beads (Pierce) and washed extensively. Captured protein was denatured with DTT, alkylated with iodoacetamide (IAA, Sigma) and digested with trypsin (Promega) on-bead overnight. Tryptic peptides were collected and fractionated (described below). Glycopeptides were eluted using PNGase (New England Biolabs).

A total of 60 µg of tryptic peptide was subjected to strong anion exchange (SAX) (experiment 1) or high pH reversed phase HPLC (HpRP-HPLC) fractionation (experiments 2-3) into 6 or 127 fractions respectively (13). For experiment 1, all 6 SAX fractions were analysed with the PNGase fraction in duplicate, using a NanoAcquity uPLC (Waters) coupled to an LTQ-OrbiTrap XL (Thermo). For experiment 2, a similar analysis of 110 of the most peptide rich HpRP-HPLC fractions with the PNGase fraction was performed as previously described (13). For experiment 3, 127 fractions were combined into 13 samples prior to analysis with the PNGase fraction using an LTQ Orbitrap Velos (Thermo) equipped with an Accela 600 quaternary pump (Thermo) and a Famos microautosampler (LC Packings). Our combination strategy was: two consecutive

4

fractions were mixed, and combined with four other paired fractions, taken at intervals separated by 22 fractions.

Peptides were separated with a gradient of 6 to 27% CH3CN in 0.125% formic acid over 90 min. MS data was acquired between 300 and 1500 m/z at 60,000 fwhm with lockmass enabled (371.101233 m/z). CID spectra were acquired in the LTQ with MSMS switching operating in a top 10 DDA fashion. Raw MS files were processed as described (38) using SEQUEST v.28 (rev. 13) against a composite H. sapiens database. For peptide quantification, we required a signal-to-noise ratio of >5. Gene Ontology Cellular Compartment terms were added using AmiGo (http://amigo.geneontology.org) and p-values (Significance A (39)) were adjusted using the Benjamini Hochberg method. We assessed the number of PM proteins identified as described previously (13).

Immunoblotting and immunoprecipitation

For immunoblots, cells were lysed in SDS sample buffer in TBS with 1% benzonase. Lysates were heated for 30 min at 37°C, separated by SDS/PAGE (UL138 -12% polyacrylamide gel; MRP1 - 7% polyacrylamide gel) and transferred to PVDF membranes (Millipore). For MRP1, membranes were denatured with 6M guanidinium chloride. Reactive bands were detected by SuperSignal West Pico or Dura substrates (Thermo). For immunoprecipitaions, cells were lysed in 1% digitonin (Calbiochem) in TBS, 5mM IAA, 0.5mM PMSF (Sigma) and 1X complete protease inhibitor (Roche)) for 30 min on ice. Lysates were precleared with IgG Sepharose beads (GE Healthcare) and immunoprecipitated with anti-HA or anti-FLAG beads (Sigma). Protein was eluted in SDS reducing sample buffer, separated by SDS/PAGE, and transferred to PVDF.

Radiolabelling and immunoprecipitation

Radiolabelling was performed as described (40). Cells were lysed on ice in 1% Triton X-100 in Tris-buffered saline (TBS) with inhibitors as described for the immunoblot protocol. Lysates were precleared with IgG sepharose beads then incubated with QCRL3 antibody and Protein A beads (Sigma) overnight. Beads were washed in 0.1% Triton X-100/TBS, and proteins dissociated at 50°C in SDS reducing sample buffer. Samples were separated by SDS/PAGE and processed for autoradiography with a Cyclone storage phosphor system (Packard) or X-ray film. Bands were quantified using Optiquant (Molecular Dynamics). For Fig. 3G, cells were incubated with MG132, CcmA, or DMSO for 16h (upper two panels) or 4h (lower two panels).

Flow cytometry and immunofluorescence

For flow cytometry of live cells, samples were washed in PBS / 0.1% BSA, incubated at room temperature with Fc block (Vivaglobulin, CSL Behring) then at 4°C with the indicated primary antibody. Cells were washed, stained with secondary antibody where indicated and fixed in 1% paraformaldehyde (PFA) prior to analysis. For intracellular staining, cells were fixed in 4% PFA, washed with PBS/0.1% Tween (PBST), permeabilised with 0.5% Triton X-100, washed, blocked in PBST/4% BSA, then stained with primary antibody. Cells were washed and stained with secondary antibody

5

prior to analysis. For flow cytometry, samples were processed on a FACSCalibur or Fortessa (Becton Dickinson) and analysed using FlowJo software (Tree Star Inc). For immunofluorescence, nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI) prior to visualisation with a LSM510 META Confocal Microscope (Zeiss). All FACS sorts were carried out using a MoFlo cell sorter (DakoCytomation). For Fig. 4A, after fixing, cells were stained with mouse anti-human MRP1 (QCRL3), goat anti-mouse AlexaFluor 647 (secondary mAb), goat anti-GFP FITC mAb and DAPI (nuclei) prior to imaging by confocal microscopy.

SNARF-1 and MTT assays

Conjugation of the acetomethoxyester group to SNARF-1 (SNARF-1 AM) enhances membrane permeability, allowing cells to be loaded in 30 minutes. The release of free SNARF-1 by intracellular esterases is detectable by flow cytometry such that the loss of SNARF-1 is a robust measure of MRP1 activity. Cells were washed, incubated with SNARF-1 AM (Invitrogen) for 30 min at 37°C, washed twice with cold media then incubated at 37°C in warmed media. Samples were taken at indicated times, washed with cold PBS and fluorescence assessed in cold PBS. Where indicated, cells were incubated for 10 min with MK-571 prior to loading with SNARF-1 AM. For fig. 3C, we chose fibroblasts rather than a monocytic cell line in order to infect a high proportion of cells (36). Starting the assay at 15h of infection meant that MRP1 was incompletely downregulated (Fig 3C), however increased times of infection led to increasing fibroblast permeability and SNARF-1 leak. There was no difference in cell viability between mock- and HCMV-infected populations, as measured by a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay over the time course of the assay (data not shown). Fluorescence was assessed on a Fluostar fluorescence plate reader (X 485nm, M 615nm). The MTT assay was carried out as described previously (41,42). For Figs. 3E-H, we selected UL138-transduced cells by their functional downregulation of MRP1. We loaded ADR-UL138HA and ADR-UL138Strep cells with SNARF-1 AM, and sorted cells retaining SNARF-1 at 3-5 hours using a MoFlo cell sorter.

Leukotriene C4 (LTC4) analysis

For LTC4 analysis, THP-GFP or THP-UL138V5 cells were washed twice in PBS containing 2mM Ca2+ (PBSc, Sigma) and 0.1% w/v BSA. Three replicates of 8x105 cells were either incubated for 5 min at RT with 200µl PBSc, or 200µl PBSc containing 50µM MK-571. Assays were initiated by addition of 800 µl pre-warmed PBSc containing 1µM A23187 to each replicate, followed by incubation for 5 min at 37oC. Cells were pelleted rapidly by centrifugation for 30s at 2000g, and 800µl of each supernatant harvested into an equal volume of ice-cold methanol. Methanol extracts were purified using Sep-Pak C18 light cartridges (Waters) as follows. Cartridges were conditioned sequentially with 10ml MeOH, 10ml H2O, and extracts were centrifuged for 10min at 13,000g. Supernatants were removed and diluted to 10ml with H2O. The diluted supernatant was applied to the conditioned Sep-Paks at a maximum flow rate of 1ml/min. Cartridges were washed with 10ml H2O, LTC4 was eluted with 1ml MeOH and subsequently dried by vacuum centrifugation. LTC4 was measured using a LTC4 Enzyme Immunoassay

6

(Oxford Biomedical Research) as per the manufacturer’s instructions. Plates were read at 650nm using a fluorescence plate reader.

RNA Extraction and RT-PCR

RNA extraction and RT-PCR for UL138, IE1 and GAPDH was performed as described (36). MRP1 was amplified by PCR with the primers MRP1 forward (GAGGATCACCTTCTGGTGGA) and MRP1 reverse (AAAGCCTCCACCTCCTCATT). GAPDH was amplified using GAPDH forward (ATGGGGAAGGTGAAGGTCG) and reverse (CTCCACGACGTACTCAGCG). For Fig. 3E, data are plotted relative to mRNA levels from HL60 cells (set to 1).

7

Fig. S1.

UL138 downregulates MRP1 in HL60-ADR and HeLa cells.

8

Fig. S2

(A-B) The specificity of MRP1 for SNARF-1 (16) was confirmed in HL60-ADR cells that express high MRP1 and therefore accumulate less SNARF-1 than control HL60 cells. HL60-ADR and HL60 cells were loaded for 30 mins with SNARF-1 AM then washed. Intracellular retention of SNARF-1 was assessed by flow cytometry immediately, then periodically over the next 7h. (C) Degradation of MRP1 by UL138 inhibits export of SNARF-1. THP-1 or THP-UL138 cells were loaded with SNARF-1 ester and intracellular SNARF-1 measured by cytofluorometry.

9

Fig. S3

UL138-V5 downregulates MRP1 in THP-1 cells.

10

Fig. S4

Vincristine at concentrations 0.1 – 10ng/ml does not affect monocyte viability, or ability to differentiate. (A) Identical numbers of primary CD14+ monocytes were treated for 3 days with the indicated concentration of Vincristine, then counted in 6 independent replicates (plotted: Mean +/- SD cells remaining at 0ng/ml). Cells were subsequently matured with IL-4/GM-CSF for 7 days (43), and grown for a further 2 days (B) or differentiated using LPS for 2 days (C). Flow cytometry was performed after staining with anti-CD83 PE-Cy5. (D) Identical numbers of primary CD14+ monocytes were treated for 7 days with the indicated concentration of Vincristine, then subjected to MTT assay in 3 independent replicates (plotted: Mean +/- SD).

11

Fig. S5

Selective vincristine-mediated depletion of HCMV-infected cells from experimental latent infection.

Primary CD14+ monocytes were latently infected in duplicate with TB40E for 3 days. Vincristine was then added for 4 days. After washing, cells were differentiated, treated with LPS to generate mature DCs then co-cultured with fibroblasts for 2 weeks. Cell supernatants were transferred onto fresh fibroblasts and after 2 days examined for viral IE protein, and foci counted. Plotted: mean +/- range IE+ foci. Two-tailed p-values (treatment vs 0ng/ml vincristine): *p<0.05, **p<0.01, ***p<0.005.

12

Fig. S6

Selective vincristine-mediated depletion of HCMV-infected cells from natural latent infection in CD14+ monocytes.

Primary CD14+ monocytes from 6 unrelated HCMV-seropositive donors were treated for 4 days with vincristine (28). Endogenous HCMV was reactivated by differentiation and maturation to mature DC (22), cocultured with fibroblasts for 2 weeks (4 replicates / condition) which were examined for viral IE protein, and foci counted. Plotted are mean +/- SEM %IE+ foci compared to 0ng/ml vincristine and two-tailed p-values (*p<0.05, **p<0.01, ***p<0.005, ****p<0.001, *****p<0.0005). ND - 0.1ng/ml not examined in donor F. The results for donor D are additionally presented in Fig. 4D and are shown here for comparison.

13

Table S1. Protein name Gene

name Fold change Unique Peptides

Expt1 Expt2 Expt3 Expt 1 Expt2 Expt3 Multidrug resistance-associated protein 1 MRP1 -10.3 -7.5 -6.7 24 38 75 Delta-like protein 1 DLL1 -2.6 NI -2.1 1 NI 7 ATP synthase subunit beta, mitochondrial ATP5B 1.4 1.2 2.2 2 4 4 Tumor necrosis factor receptor superfamily 1A TNFR1 2.4 2.8 2.4 3 10 28 HCMV UL138 downregulates MRP1 and DLL1, and upregulates TNFR1. PMP was used to compare THP-1 cells stably transduced with GFP-tagged UL138 or control THP-1 cells expressing GFP alone (experiments 1 and 2). An additional analysis was also carried out using untagged UL138 (experiment 3, also shown in Figure 1A and Table S1). In experiments 1 and 2, samples were analysed using an Orbitrap Pro-XL mass spectrometer, and in experiment 3 an Orbitrap Velos Pro. In experiment 1, samples were split into 6 fractions by strong anion exchange, and in experiments 2 and 3, samples were split into 100 fractions by high pH reversed phase HPLC. NI – not identified.

References and Notes 1. E. S. Mocarski, T. Shenk, R. F. Pass, Eds., Cytomegaloviruses (Lipincott Williams and

Wilkins, Philadelphia, PA, ed. 5, 2007), pp. 2701–2773.

2. W. G. Nichols, L. Corey, T. Gooley, C. Davis, M. Boeckh, High risk of death due to bacterial and fungal infection among cytomegalovirus (CMV)-seronegative recipients of stem cell transplants from seropositive donors: Evidence for indirect effects of primary CMV infection. J. Infect. Dis. 185, 273 (2002). doi:10.1086/338624 Medline

3. J. Taylor-Wiedeman, J. G. Sissons, L. K. Borysiewicz, J. H. Sinclair, Monocytes are a major site of persistence of human cytomegalovirus in peripheral blood mononuclear cells. J. Gen. Virol. 72, 2059 (1991). doi:10.1099/0022-1317-72-9-2059 Medline

4. G. Hahn, R. Jores, E. S. Mocarski, Cytomegalovirus remains latent in a common precursor of dendritic and myeloid cells. Proc. Natl. Acad. Sci. U.S.A. 95, 3937 (1998). doi:10.1073/pnas.95.7.3937 Medline

5. M. B. Reeves, P. A. MacAry, P. J. Lehner, J. G. Sissons, J. H. Sinclair, Latency, chromatin remodeling, and reactivation of human cytomegalovirus in the dendritic cells of healthy carriers. Proc. Natl. Acad. Sci. U.S.A. 102, 4140 (2005). doi:10.1073/pnas.0408994102 Medline

6. B. Slobedman et al., Human cytomegalovirus latent infection and associated viral gene expression. Future Microbiol. 5, 883 (2010). doi:10.2217/fmb.10.58 Medline

7. J. Sinclair, Human cytomegalovirus: Latency and reactivation in the myeloid lineage. J. Clin. Virol. 41, 180 (2008). doi:10.1016/j.jcv.2007.11.014 Medline

8. J. Sinclair, Chromatin structure regulates human cytomegalovirus gene expression during latency, reactivation and lytic infection. Biochim. Biophys. Acta 1799, 286 (2010). doi:10.1016/j.bbagrm.2009.08.001 Medline

9. F. Goodrum, M. Reeves, J. Sinclair, K. High, T. Shenk, Human cytomegalovirus sequences expressed in latently infected individuals promote a latent infection in vitro. Blood 110, 937 (2007). doi:10.1182/blood-2007-01-070078 Medline

10. A. Petrucelli, M. Rak, L. Grainger, F. Goodrum, Characterization of a novel Golgi apparatus-localized latency determinant encoded by human cytomegalovirus. J. Virol. 83, 5615 (2009). doi:10.1128/JVI.01989-08 Medline

11. V. T. Le, M. Trilling, H. Hengel, The cytomegaloviral protein pUL138 acts as potentiator of tumor necrosis factor (TNF) receptor 1 surface density to enhance ULb’-encoded modulation of TNF-α signaling. J. Virol. 85, 13260 (2011). doi:10.1128/JVI.06005-11 Medline

12. C. Montag et al., The latency-associated UL138 gene product of human cytomegalovirus sensitizes cells to tumor necrosis factor alpha (TNF-alpha) signaling by upregulating TNF-alpha receptor 1 cell surface expression. J. Virol. 85, 11409 (2011). doi:10.1128/JVI.05028-11 Medline

13. M. P. Weekes et al., Proteomic plasma membrane profiling reveals an essential role for gp96 in the cell surface expression of LDLR family members, including the LDL receptor and LRP6. J. Proteome Res. 11, 1475 (2012). doi:10.1021/pr201135e Medline

14. D. Marquardt, S. McCrone, M. S. Center, Mechanisms of multidrug resistance in HL60 cells: detection of resistance-associated proteins with antibodies against synthetic peptides that correspond to the deduced sequence of P-glycoprotein. Cancer Res. 50, 1426 (1990). Medline

15. L. Grainger et al., Stress-inducible alternative translation initiation of human cytomegalovirus latency protein pUL138. J. Virol. 84, 9472 (2010). doi:10.1128/JVI.00855-10 Medline

16. J. Jin, A. T. Jones, The pH sensitive probe 5-(and-6)-carboxyl seminaphthorhodafluor is a substrate for the multidrug resistance-related protein MRP1. Int. J. Cancer 124, 233 (2009). doi:10.1002/ijc.23892 Medline

17. A. H. Schinkel, J. W. Jonker, Mammalian drug efflux transporters of the ATP binding cassette (ABC) family: An overview. Adv. Drug Deliv. Rev. 55, 3 (2003). doi:10.1016/S0169-409X(02)00169-2 Medline

18. K. C. Almquist et al., Characterization of the M(r) 190,000 multidrug resistance protein (MRP) in drug-selected and transfected human tumor cell. Cancer Res. 55, 102 (1995). Medline

19. D. Hargett, T. E. Shenk, Experimental human cytomegalovirus latency in CD14+ monocytes. Proc. Natl. Acad. Sci. U.S.A. 107, 20039 (2010). doi:10.1073/pnas.1014509107 Medline

20. K. Kondo, H. Kaneshima, E. S. Mocarski, Human cytomegalovirus latent infection of granulocyte-macrophage progenitors. Proc. Natl. Acad. Sci. U.S.A. 91, 11879 (1994). doi:10.1073/pnas.91.25.11879 Medline

21. F. D. Goodrum, C. T. Jordan, K. High, T. Shenk, Human cytomegalovirus gene expression during infection of primary hematopoietic progenitor cells: A model for latency. Proc. Natl. Acad. Sci. U.S.A. 99, 16255 (2002). doi:10.1073/pnas.252630899 Medline

22. M. B. Reeves, P. J. Lehner, J. G. Sissons, J. H. Sinclair, An in vitro model for the regulation of human cytomegalovirus latency and reactivation in dendritic cells by chromatin remodelling. J. Gen. Virol. 86, 2949 (2005). doi:10.1099/vir.0.81161-0 Medline

23. M. M. Huang, V. G. Kew, K. Jestice, M. R. Wills, M. B. Reeves, Efficient human cytomegalovirus reactivation is maturation dependent in the Langerhans dendritic cell lineage and can be studied using a CD14+ experimental latency model. J. Virol. 86, 8507 (2012). doi:10.1128/JVI.00598-12 Medline

24. A. Rajagopal, A. C. Pant, S. M. Simon, Y. Chen, In vivo analysis of human multidrug resistance protein 1 (MRP1) activity using transient expression of fluorescently tagged MRP1. Cancer Res. 62, 391 (2002). Medline

25. D. F. Robbiani et al., The leukotriene C(4) transporter MRP1 regulates CCL19 (MIP-3beta, ELC)-dependent mobilization of dendritic cells to lymph nodes. Cell 103, 757 (2000). doi:10.1016/S0092-8674(00)00179-3 Medline

26. S. Avdic, J. Z. Cao, A. K. Cheung, A. Abendroth, B. Slobedman, Viral interleukin-10 expressed by human cytomegalovirus during the latent phase of infection modulates

latently infected myeloid cell differentiation. J. Virol. 85, 7465 (2011). doi:10.1128/JVI.00088-11 Medline

27. R. van de Ven et al., Dendritic cells require multidrug resistance protein 1 (ABCC1) transporter activity for differentiation. J. Immunol. 176, 5191 (2006). Medline

28. Information on materials and methods is available as supplementary material on Science Online.

29. M. Thomas et al., Down-regulation of NKG2D and NKp80 ligands by Kaposi’s sarcoma-associated herpesvirus K5 protects against NK cell cytotoxicity. Proc. Natl. Acad. Sci. U.S.A. 105, 1656 (2008). doi:10.1073/pnas.0707883105 Medline

30. M. L. Burr et al., HRD1 and UBE2J1 target misfolded MHC class I heavy chains for endoplasmic reticulum-associated degradation. Proc. Natl. Acad. Sci. U.S.A. 108, 2034 (2011). doi:10.1073/pnas.1016229108 Medline

31. S. Straschewski et al., Human cytomegaloviruses expressing yellow fluorescent fusion proteins—characterization and use in antiviral screening. PLoS ONE 5, e9174 (2010). doi:10.1371/journal.pone.0009174 Medline

32. D. J. Spector, K. Yetming, UL84-independent replication of human cytomegalovirus strain TB40/E. Virology 407, 171 (2010). doi:10.1016/j.virol.2010.08.029 Medline

33. G. M. Mason, E. Poole, J. G. Sissons, M. R. Wills, J. H. Sinclair, Human cytomegalovirus latency alters the cellular secretome, inducing cluster of differentiation (CD)4+ T-cell migration and suppression of effector function. Proc. Natl. Acad. Sci. U.S.A. 109, 14538 (2012). doi:10.1073/pnas.1204836109 Medline

34. J. Baillie, D. A. Sahlender, J. H. Sinclair, Human cytomegalovirus infection inhibits tumor necrosis factor alpha (TNF-alpha) signaling by targeting the 55-kilodalton TNF-alpha receptor. J. Virol. 77, 7007 (2003). doi:10.1128/JVI.77.12.7007-7016.2003 Medline

35. E. Murphy, I. Rigoutsos, T. Shibuya, T. E. Shenk, Reevaluation of human cytomegalovirus coding potential. Proc. Natl. Acad. Sci. U.S.A. 100, 13585 (2003). doi:10.1073/pnas.1735466100 Medline

36. E. Poole, S. R. McGregor Dallas, J. Colston, R. S. Joseph, J. Sinclair, Virally induced changes in cellular microRNAs maintain latency of human cytomegalovirus in CD34⁺ progenitors. J. Gen. Virol. 92, 1539 (2011). doi:10.1099/vir.0.031377-0 Medline

37. M. P. Weekes et al., Comparative analysis of techniques to purify plasma membrane proteins. J. Biomol. Tech. 21, 108 (2010). Medline

38. N. Dephoure, S. P. Gygi, Hyperplexing: A method for higher-order multiplexed quantitative proteomics provides a map of the dynamic response to rapamycin in yeast. Sci. Signal. 5, rs2 (2012). doi:10.1126/scisignal.2002548 Medline

39. J. Cox, M. Mann, MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 26, 1367 (2008). doi:10.1038/nbt.1511 Medline

40. E. W. Hewitt et al., Ubiquitylation of MHC class I by the K3 viral protein signals internalization and TSG101-dependent degradation. EMBO J. 21, 2418 (2002). doi:10.1093/emboj/21.10.2418 Medline

41. F. M. Freimoser, C. A. Jakob, M. Aebi, U. Tuor, The MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay is a fast and reliable method for colorimetric determination of fungal cell densities. Appl. Environ. Microbiol. 65, 3727 (1999). Medline

42. H. Jiao et al., A new 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay for testing macrophage cytotoxicity to L1210 and its drug-resistant cell lines in vitro. Cancer Immunol. Immunother. 35, 412 (1992). doi:10.1007/BF01789020 Medline

43. F. Goodrum, C. T. Jordan, S. S. Terhune, K. High, T. Shenk, Differential outcomes of human cytomegalovirus infection in primitive hematopoietic cell subpopulations. Blood 104, 687 (2004). doi:10.1182/blood-2003-12-4344 Medline