stm.sciencemag.org/cgi/content/full/12/556/eabc7075/DC1

Supplementary Materials for

A colorimetric RT-LAMP assay and LAMP-sequencing for detecting SARS-CoV-2

RNA in clinical samples

Viet Loan Dao Thi*, Konrad Herbst, Kathleen Boerner, Matthias Meurer, Lukas PM Kremer, Daniel Kirrmaier, Andrew Freistaedter, Dimitrios Papagiannidis, Carla Galmozzi, Megan L. Stanifer, Steeve Boulant, Steffen Klein,

Petr Chlanda, Dina Khalid, Isabel Barreto Miranda, Paul Schnitzler, Hans-Georg Kräusslich, Michael Knop*, Simon Anders*

*Corresponding author. Email: vietloan.daothi@med.uni-heidelberg.de (V.L.D.T.); m.knop@zmbh.uni-heidelberg.de

(M.K.); s.anders@zmbh.uni-heidelberg.de (S.A.)

Published 12 August 2020, Sci. Transl. Med. 12, eabc7075 (2020) DOI: 10.1126/scitranslmed.abc7075

The PDF file includes:

Materials and Methods Fig. S1. Design of the study. Fig. S2. Comparison of the RT-LAMP assay with CT values from RT-qPCR using primer sets E-Sarbeco and N-Sarbeco. Fig. S3. Comparison of the RT-LAMP assay using primer set 1a-A with CT values from RT-qPCR using primer set E-Sarbeco. Fig. S4. Analysis of LAMP-sequencing reads. Fig. S5. Sample classification with LAMP-sequencing. Fig. S6. RNA stability and detection limit of the RT-LAMP assay in pharyngeal swab specimens with IVT RNA. Fig. S7. Swab–to–RT-LAMP assay titration of positive COVID-19 specimens. Table S1. Sequences of primers and amplicons used in this study. Table S2. Sensitivity and specificity of the RT-LAMP test from Fig. 3B. Table S3. Sensitivity and specificity of the RT-LAMP test from Fig. 5B. Legend for table S4 Table S5. Overview of time requirements for various sample handling steps.

Other Supplementary Material for this manuscript includes the following: (available at stm.sciencemag.org/cgi/content/full/12/556/eabc7075/DC1)

Table S4 (Microsoft Excel format). Primers used for LAMP-sequencing. Data File S1 (Microsoft Excel format). Raw data for figs. S6 and S7.

Materials and Methods

Important considerations when using RT-LAMP assays and reagents

1. The buffer capacity of the WarmStart Colorimetric RT-LAMP 2X Master Mix (DNA & RNA)

from NEB (M1800) is very low in order to allow a color change as a function of

synthesized DNA. High sample volumina, buffered samples and compounds influencing

the buffer capacity of the reaction can yield false positive or false negative results.

2. The LAMP reaction can yield non-specific products which induce a pH shift; these appear

at time points > 35 min and thus measurements at time points > 35 min are prone to

contain false positives.

3. Best results were obtained with freshly prepared RT-LAMP master mixes that were kept

on ice in a closed tube prior to the addition of the sample

4. Colorimetric RT-LAMP mastermixes are not very stable. Old master mixes (set up with

primers) are characterized by a color change in the negative control sample already at

the time point 30 min, or even earlier. This yields false positive results. Freshly prepared

master mixes can be stored maximally 14-18 hours at -20°C. We observed in some cases

that longer storage seems to lead to an early color change in negative samples.

5. Exposure to the atmosphere (open lid) leads to a slow drop in pH, presumably due to

acidification by atmospheric CO2. Pipetting of RT-LAMP mixes into 96 well plates needs

to be done immediately before use to avoid air exposure. Keep plates on ice while adding

the samples. Pipette carefully and when adding samples avoid bubbles which, if they

burst, could contaminate adjacent reactions.

Sample and reaction volume

6. For purified RNA samples we use 1 µl of RNA in a total reaction volume of 12.5 µl. Larger

quantities of the RNA (e.g. 4 µl) did not significantly improve detection sensitivity

(probably due to impurities in the RNA preparations, e.g. EtOH). This is an empirical

observation that seems to apply for our set up and could be different elsewhere.

7. For swab-to-RT-LAMP assays we use 1 µl of sample in a total reaction volume of 20 µl.

Likewise, larger quantities of sample input did not significantly improve detection

sensitivity, likely due to the presence of undefined inhibitors. Again, this is an empirical

observation and different sample volumina could be used when different the swabs are

contained in different sample media.

Stability of color change (see also points 1-4)

8. Swab samples in Amies medium are slightly acidic and, depending on the patient, we

observed a drop in pH in the reaction mixture already before the reaction started (see

also Figure 6). Using 0.9% saline solution (instead of the Amies medium used in clinical

samples) does not lead to a pH drop at the time point 0 min. Saline solution might,

however, affect the stability of the samples.

Quantification of the color change

9. The RT-LAMP test, like the qPCR, is based on a time-dependent reaction. Our

experiments show that the measurement is best between 27-30 min and we propose to

implement this time point for read-out.

10. Documentation of the color change can be done in many ways. While we used a Tecan

plate scanner for OD measurements at two wavelengths, we found that placing the test

strips or plates on a color scanner or copy machine with scanner function is another very

reliable and reproducible way to document results. Hue measurements can then be used

to quantify the results. Cameras of mobile phones work also well (Figure 1A), but

reflection of light and perspective distortions make such images less reproducible and

difficult to quantify.

Contamination

11. When pipetting PCR strips, always close the lids to avoid cross-contaminations. When

using 96 well plates, pipette carefully and absolutely avoid bubbles which, if they burst,

could contaminate adjacent samples.

12. Successful RT-LAMP reactions contain large quantities of DNA that are a perfect template

for the assay. Therefore, after the reaction the tubes should not be opened and be

carefully disposed of.

13. Analysis of RT-LAMP reactions for gel electrophoresis requires that the tubes are opened.

This should be done in a well separated location and using equipment that is not shared

with work benches where RT-LAMP reactions are set up or where patient samples are

manipulated.

Fig. S1. Design of the study. Samples available for this study were derived from COVID-19 tests

from the hospital or a municipal testing station and surplus material was passed on to us, usually

within a few hours to one day after the hospital diagnostic laboratory had removed an aliquot for

RT-qPCR analysis. Aliquots of the samples were used for individual assays or for seed plate

generation (96-well format) for multiplexed analyses.

Fig. S2. Comparison of the RT-LAMP assay with CT values from RT-qPCR using primer sets E-Sarbeco and N-Sarbeco. Shown is the comparison of the RT-LAMP with CT-values from RT-qPCR using the two standard primer sets E-Sarbeco and N-Sarbeco (Corman et al. 2020). For all the samples shown in Figure 2 that showed a positive result in the RT-qPCR for the E gene (x axis in Figure 2C), a second RT-qPCR with primers for the N gene was performed. (A) Comparison of the RT-LAMP results (same ΔOD values as in Figure 2B) with the results of the RT-qPCR for the N gene. (B) Comparison of the CT values obtained with the two primer sets: The CT values for N-Sarbeco are higher, on average by 5.6 cycles. (Standard error of this mean difference: 0.26 cycles, number of RT-qPCR-positive samples: 44).

Fig. S3. Comparison of the RT-LAMP assay using primer set 1a-A with CT values from RT-qPCR using primer set E-Sarbeco. Shown is the comparison of the RT-LAMP results (taken af-ter 40 mins of incubation time) obtained with RT-LAMP primer set 1a-A (targeting ORF 1a; Zhang et al. 2020) with the CT values from RT-qPCR (E_Sarbeco primers). For this primer set, many samples with a CT between 25-30 did not score positive in the RT-LAMP, while they scored positive in the RT-LAMP using the N-A primer set. This indicates that the N-A primer set allows a more sensitive detection of the SARS-CoV-2 viral RNA as compared to the 1a-A primer set.

N gene

0 10 20 300

3

6

0

50

100

27.5 28.0 28.5 29.0 29.5 30.0

0

3

6

0

50

100

SARS-CoV-2 genome position (kbp)

ma

pp

ed

rea

ds

/106 cum

ulative mapped

reads (%)

mapped reads (80.6%)

FIP LB LF F3 BIP B3 no match

0.0 5.0 10.0 15.0 20.017.4

0.0 25.0 50.0 75.0 100.089.8

fraction of all reads (%)

fraction of unmapped reads (%)

unmapped reads (19.4%)d

GeneN-A-F3 GeneN-A-FIP GeneN-A-LF (r. c.)

GeneN-A-FIP (r. c.) GeneN-A-BIP

GeneN-A-BIP (r. c.) GeneN-A-B3 (r. c.)GeneN-A-LB

5'-ATGACCAAAT TGGCTACTACCGAAGAGCT A CCAGACGAATTCGTGGTGG TG ACGGTAAAATGAAAGATCTCAGTCC ...

... AAGATGGTATTTCT ACTACCTAGGAACTGGGCCAGA AGCTGGACTTCCCT ATGGTGCTAACAA AGACGGCATCATATGGGTTGCA ...

... ACTGAGGGAGCCTTGAATACA CCAAA AGATCACATTGGCACCCG CA ATCCTGCTAACAATGCTGCA ATCGTGCTAC-3'

28,515

[NC_045512.2]

28,591

28,75128,676

28,590

28,675

reads containsviral subsequence ?

LAMP-sequencing reads

trim off adapter sequences

global analysis of originof RT-LAMP sequences

counting LAMP-sequencing reads for each sample

assign reads to samplesby barcodes, and

aggregate reads by UMI

count asmatching

count asnot matching

(see Figure S5)

map to virus genome

80.6%mapped reads

(panel c)

k-mer analysiswith unmapped reads

(panel d)

17.4%primer k-mer

containing reads

2%other

A

B

C

Fig. S4. Analysis of LAMP-sequencing reads. (A) Depicted is the region of the N gene covered

by the LAMP primers. Green: primers mapping in direct orientation, blue: primers mapping in

reverse complement orientation. Three k-mers marked in red are not covered by primers; reads

containing any of them are counted as "virus-matching", other reads as "non-matching". Purple

arrow indicates the PCR primer binding site used in LAMP-sequencing for specific amplification

of the tagmentation products. (B) Schematic of the analysis workflow to determine the origin of

sequences in LAMP-sequencing results. (C) Coverage of the SARS-CoV-2 (NC_045512.2) genome

by LAMP-sequencing reads. 80.6% of the reads could be mapped directly to the viral genome. All

of them fall into a short region [yellow region, sequence shown in (A)] within the N gene (dark

gray band). (D) Sequence content of the remaining 19.4% unmapped reads. k-mer analysis

identified sequences originating from primers (orange). 2% of the sequences could not be

matched (gray).

Fig. S5. Sample classification with LAMP-sequencing. (A) Plotting the aggregated read counts

(using UMIs) for each barcode combination, i.e., each sample. Negative and positive RT-LAMP

reactions can be distinguished by nearly one order of magnitude of difference in UMI counts. For

14 LAMP reaction products very few UMIs were observed; these samples are considered as

inconclusive (“too few reads”) in Table 2. The 12 samples further analyzed in (B) are labeled. (B)

Analysis by gel electrophoresis of RT-LAMP reactions of one row of one plate (from which 5 of

the inconclusive samples originate) demonstrates that these wells clearly contained RT-LAMP

reaction products. Also, two samples showed low DNA content after RT-LAMP, although they

clearly resulted in LAMP-sequencing results (sample A7 and A8). We therefore attributed the

failure to obtain LAMP-sequencing reads for the 14 questionable samples to an error in the

multiplexing of LAMP-sequencing and omitted them from the subsequent analysis. M: Marker – 1

kb DNA ladder (Thermo Fisher Scientific) (C) Scatter plot comparing LAMP-sequencing with RT-

LAMP. Each point corresponds to a sample. The colours indicate the LAMP-sequencing results,

i.e., each colour corresponds to a quadrant in panel (A) and each sample has the same colour as

in Figures 4B.

Fig. S6. RNA stability and detection limit of the RT-LAMP assay in pharyngeal swab

specimens with IVT RNA. SARS-CoV-2 RNA titration in control specimen by RT-LAMP (A)

Defined numbers of molecules of IVT RNA of the N gene were added to aliquots of control

specimen adjusted or not to 0.1% SDS and/or treated with RNAse inhibitor as indicated. Results

represent the mean ± SD of n = 2. Control specimens from different negative patients were

spiked with RNA or DNA before (B and C), between (D) or after (E) heat treatment (95°C / 5

min). RT-LAMP was performed at 65°C for 30 min, followed by measuring absorbance (OD) at

434 and 560 nm.

As shown in (A), IVT RNA when spiked into swabs taken from control (COVID-19 negative) test

subjects, is hardly detected by RT-LAMP, most likely indicating degradation of the RNA. Neither

the addition of SDS or a heat-stable RNAse inhibitor prevented this rapid degradation. Similarly,

IVT RNA added before heat incubation of swab specimens at 95°C for 5 min failed to be detected

by a RT-LAMP assay, with slight differences depending on the swab specimen tested (panel B).

However, when DNA instead of RNA was used, much higher stability was observed (panel C).

This difference between DNA and RNA could indicate the presence of RNAses or decomposition

of the (chemically much less stable) RNA in the swab specimen due to heat incubation. However,

IVT RNA that was added to heat incubated samples, followed by a second heat incubation, was

still detected in the RT-LAMP assay (panel D). Therefore, RNAses, and not heat, are the likely

cause for the degradation of the IVT RNA. On the other hand, heat incubation is likely to

inactivate RNAses, but does not affect the IVT RNA. Indeed, IVT RNA added after heat incubation

could be detected in a subsequently conducted RT-LAMP assay with the RT-LAMP-specific

sensitivity of approx 100 copies per µl sample (panel E).

This analysis suggests that heat-inactivated swab specimens should be stable enough to allow

detection of RNA, as long as no other components of these samples interfere with the RT-LAMP

reaction.

Fig. S7. Swab-to-RT-LAMP assay titration of positive COVID-19 specimens. (A) A high titer

positive COVID-19 specimen was diluted in control specimens and treated or not with 0.1% SDS

and/or RNAse inhibitor as indicated, prior to RT-LAMP assay, n=2. (B) A high titer positive

COVID-19 specimen was diluted in control specimens, heated (95 °C / 5 min) and then treated or

not as indicated, prior to RT-LAMP assay. RT-LAMP was performed at 65 °C for 30 min, followed

by measuring absorbance (OD) at 434 nm and 560 nm.

In contrast to exogenous IVT RNA, the viral RNA in swab specimens of COVID-19 patients is

present either inside cells or in viral capsids. This probably protects the RNA from RNAses until

the sample is used for diagnostics. We next titrated a positive COVID-19 sample (CT=21) into

control specimens from COVID-19 negative test subjects, alone or in the presence of 0.1% SDS.

This SDS concentration was determined empirically to not disturb a subsequent RT-LAMP assay,

when diluted 1:20 in the RT-LAMP mixture. The mixed extracts were then used for RT-LAMP,

without (A) and with (B) heat treatment. In the absence of SDS, the viral RNA from the positive

sample could still be detected at a dilution of 1:4096, while it was not detected at all in the

presence of SDS, indicating that SDS leads to the release of RNAses and that the RNAs detected in

the RT-LAMP assay are susceptible to degradation by these RNAses. We additionally tried to

block degradation using an RNAse inhibitor that is active at 65°C (SUPERase-In RNase Inhibitor,

Invitrogen), but without success.

Supplementary Tables

Table S1. Sequences of primers and amplicons used in this study.

Name Sequence Concentration in

10x Mix (µM)

N Gene primer*

GeneN-A-F3 TGGCTACTACCGAAGAGCT 2

GeneN-A-B3 TGCAGCATTGTTAGCAGGAT 2

GeneN-A-FIP TCTGGCCCAGTTCCTAGGTAGTCCAGACGAATTCGTGGTGG 16

GeneN-A-BIP AGACGGCATCATATGGGTTGCACGGGTGCCAATGTGATCT 16

GeneN-A-LF GGACTGAGATCTTTCATTTTACCGT 4

GeneN-A-LB ACTGAGGGAGCCTTGAATACA 4

ORF1a

ORF1a-A-F3 CTGCACCTCATGGTCATGTT 2

ORF1a-A-B3 AGCTCGTCGCCTAAGTCAA 2

ORF1a-A-FIP GAGGGACAAGGACACCAAGTGTATGGTTGAGCTGGTAGCAGA 16

ORF1a-A-BIP CCAGTGGCTTACCGCAAGGTTTTAGATCGGCGCCGTAAC 16

ORF1a-A-LF CCGTACTGAATGCCTTCGAGT 4

ORF1a-A-LB TTCGTAAGAACGGTAATAAAGGAG 4

Amplicon

N gene fragment ATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTG

ACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAA

CTGGGCCAGAAGCTGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATG

GGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGC

AATCCTGCTAACAATGCTGCAATCGTGCT

Primers for fragment amplification and RNA production**

T7-GeneN-

Fragment.for

TAATACGACTCACTATAGGGATGACCAAATTGGCTACTACCG

GeneN-

Fragment.rev

GTAGCACGATTGCAGCATTG

*Primer sequences from Zhang et al., (2020)

** Primer sequences from this study

Table S2. Sensitivity and specificity of the RT-LAMP test from Fig. 3B. Sensitivity (for each

CT bin) and specificity of the RT-LAMP test with respect to the qPCR results, as derived from the

results shown in Figure 3A and tallied in Table 1. The values shown here are visualized in Figure

3B. "conf. int." = Wilson's 95% binomial confidence interval.

Table S3. Sensitivity and specificity of the RT-LAMP test from Fig. 5B.

Sensitivity (for each CT bin) and specificity of the direct swab-to-RT-LAMP (left) and the hot

swab-to-RT-LAMP (right) test with respect to the qPCR results, as derived from the results

shown in Figure 5A and tallied in Table 3. The values shown here are visualized in Figure 5B.

"conf. int." = Wilson's 95% binomial confidence interval.

Table S4. Primers used for LAMP-sequencing.

This supplementary table is provided as a separate file:

Supplementary_Table_S4.xlsx

Table S5. Overview of time requirements for various sample handling steps.

Step Procedure Time Working volumes

Sampling Self-swabbing 10 mins 1 ml

Swabbing by medical personnel at

hospital, municipal testing station, or at

patient's home

10 mins 1 ml

Transport to

hospital

Transport of sample by taxi, including

waiting time until sample is processed at

laboratory

5-6 hours

Sample ID Patient ID into LIMS system, create and

print new barcode

1 hour

Assembly of

seed plate

Transfer specimen under biosafety level 2

cabinet into 96-well plate or tubes, record

identity using barcode scanner

1-2 hours 200 µl for QiaSymphony,

140 µl for QiaQube, and

50 µl for direct assays

RNA

extraction

Automated-based RNA isolation

(QiaSymphony/96-well or

QiaQube/tubes)

2-3 hours Elution in 115 µl for

QiaSymphony and 100 µl

for QiaQube

Detection of

viral genome

RT-qPCR to detect E gene, including

pipetting of 96-well plate and run

120 mins 10 µl in 20 µl reaction

RT-LAMP to detect N gene, including

pipetting of 96-well plate and run

40 mins 1 µl in 12.5 µl reaction for

isolated samples and 1 µl

in 20 µl reaction for direct

assays

Analysis Values are entered into LIMS system 30 mins

Notification of

patient

Call patient and send letter 10 mins