Supplementary Materials for

Neuropilin-1 expression in adipose tissue macrophages protects against

obesity and metabolic syndrome

Ariel Molly Wilson, Zhuo Shao, Vanessa Grenier, Gaëlle Mawambo,

Jean-François Daudelin, Agnieszka Dejda, Frédérique Pilon, Natalija Popovic,

Salix Boulet, Célia Parinot, Malika Oubaha, Nathalie Labrecque, Vincent de Guire,

Mathieu Laplante, Guillaume Lettre, Florian Sennlaub, Jean-Sebastien Joyal,

Michel Meunier, Przemyslaw Sapieha*

*Corresponding author. Email: mike.sapieha@umontreal.ca

Published 16 March 2018, Sci. Immunol. 3, eaan4626 (2018)

DOI: 10.1126/sciimmunol.aan4626

The PDF file includes:

Experimental Procedures

Fig. S1. NRP1-expressing ATMs accumulate in DIO.

Fig. S2. Deficiency in myeloid-resident NRP1 influences systemic metabolism.

Fig. S3. Macrophage-resident NRP1 promotes FA uptake.

Fig. S4. Gating scheme for ATMs.

Fig. S5. Transfer of NRP1-expressing bone marrow.

Table S1. Fluorophore-conjugated antibodies used for flow cytometry.

Table S2. Primer sets used for reverse transcription PCR.

Other Supplementary Material for this manuscript includes the following:

(available at immunology.sciencemag.org/cgi/content/full/3/21/eaan4626/DC1)

Table S3 (Microsoft Excel format). Raw data.

immunology.sciencemag.org/cgi/content/full/3/21/eaan4626/DC1

Experimental Procedures

Study design.

Genetically engineered mouse strains were used to assess the role of NRP1 positive ATMs in

obesity and metabolic syndrome. Our model of diet induced obesity (DIO) consisted of placing

randomly assigned male mice on either a normal chow diet (NCD) or a HFD (Research Diets,

59% kcal fat) beginning at 8 weeks of age for 10-22 weeks. Analysis of mouse macrophages

included flow cytometry analysis, cell sorting, RNAseq, fatty acid uptake, Seahorse (for

glycolysis and beta-oxidation), immununohistochemistry and qPCRs. Metabolic assessment in

mice included glucose and insulin tolerance, metabolic chamber analysis, and bone marrow

transfers. Investigators were not blinded for glucose or insulin testing, but were blinded for

metabolic chamber analysis, glycolysis and beta-oxidation analyses, flow cytometry analysis,

and qPCRs. The sample size and experimental replicates are indicated in the figure legends.

Sample size was not predetermined, however experiments were performed with group sizes

based on literature documentation of similar experiments.

Primary macrophages culture

8-12 week old LysM-Cre-Nrp1+/+ and LysM-Cre-Nrp1fl/fl mice fed NCD were anesthetized with

2% isoflurane in 2 L/min oxygen and then euthanized by cervical dislocation. Then, a small

incision in abdominal skin of mouse was performed. Skin was pulled to each size of the mouse

and peritoneal cavity was washed with 5 ml of PBS plus 3% FBS (Sigma) for 2 min. Then, the

harvested cells were centrifuged for 5 min at 1000 rpm, resuspended in medium (DMEM F12

(Life Technologies) plus 10% FBS (Sigma) and 1% Streptomycin/Penicillin (Life Technologies)

and plated. After 1h of culture at 37°C under a 5% CO2 atmosphere the medium was changed

and cells were cultured for the next 24h in the same conditions before use in BODIPY uptake,

pHrodo phagocytosis assay, Oil Red-O staining or transwell migration assay.

Macrophage BODIPY intake

Macrophages extracted from LysMCRE-Nrp1+/+ and LysMCRE-Nrp1fl/fl were seeded in 48 well

plates at 1 x105 cells/well. BODIPY 500/510 C1,C12 (Life technologies) was added at a

concentration of 0.5 and 1µg/mL, incubated at room temperature for five minutes, then put on

ice. Wells were washed with cold PBS then fixed with 1% paraformaldehyde (Electron

Microscopy Science). Fluorescence was read with an Infinite M1000 Pro reader (TECAN) at a

wavelength emission of 488nm and 525nm excitation.

In vivo BODIPY uptake

In vivo BODIPY intake assays were performed on LysM-Cre-Nrp1+/+ and LysM-Cre-Nrp1fl/fl

male mice fed with HFD for 10 weeks. Mice were starved for four hours before administrating

an intraperitoneal injection of 100µL of 30µM BODIPY 500/510 C1,C12 (Life technologies) in

1% BSA (Hyclone, GE). Mice were euthanized 3 hour following BODIPY injection. The blood

was collected by cardiac puncture, and the plasma was subsequently separated by centrifugation.

Samples of heart, liver and white adipose tissue were collected and homogenized in 1X RIPA

buffer (Cell Signaling). BODIPY fluorescence of homogenates and plasma was read with

Infinite M1000 Pro reader (TECAN) at a wavelength emission of 488nm and excitation at

525nm and normalised to protein concentration (quantified with QuantiProTM BCA assay kit

from Sigma).

In vitro differentiation of L1-3T3 adipocytes

Mus musculus embryonic fibroblasts (3T3-L1, ATCC) were cultured in complete growth

medium (DMEM high-glucose, w/o sodium pyruvate, Gibco) with 10% FBS and 1%

Streptomycin/Penicillin. Confluent fibroblasts were differentiated into adipocytes by adding 3-

isobutyl-1-methylxanthine (IBMX, Sigma, final concentration of 0.5mM), dexamethasone

(DEX, Sigma, final concentration of 1 µM) and insulin (Sigma, final concentration of 20 µg/mL)

for 48 hours. Adipocytes were maintained in post-differentiation medium containing complete

growth medium and 20µg/mL insulin.

Oil Red-O staining and quantification

Cultured peritoneal macrophages were washed in PBS and fixed in 10% PFA for 30 minutes and

rinsed. Alternatively, 8m cryosections of fixed and OCT-mounted frozen liver sections were

rinsed in PBS. Macrophages or livers were then incubated for 60 minutes with twice filtered

0.3% Oil Red-O (Sigma) solution and rinsed. Pictures were taken under light microscopy at a

10X magnification for the livers and 63X for the macrophages. Lipid droplet quantification was

performed using the limit of threshold method from ImageJ.

Bio-plex

Serum cytokine assays were performed using a Bio-plex Mouse Cytokine 6-plex panel (1x96-

well) (Bio-Rad) according to the manufacturer’s instructions. The Bio-Plex cytokine assay is a

multiplex bead-based assay designed to quantify cytokines as follows. The wells of a 96-well

plate were prewet with 100uL of Bio-Plex assay buffer. 50uL of vortexed multiplex bead

working solution was pipetted into each well and immediately removed. Wells were washed

twice with the Bio-Plex wash buffer before 25uL of vortexed Bio-Plex Detention Antibody

working solution was added to each well and incubated for 30 min. After a triple wash with the

Bio-Plex wash buffer, 50uL of vortexed 1× streptavidin-PE was added to each well and

incubated for 30 min. After 3 washes, the beads in each well were resuspended with 125μl of

Bio-Plex assay buffer, shaken at 1100 rpm for 30s, and the plate was immediately read on the

Bio-Plex system. Cytokine concentrations were calculated from the standard curve by use of

Bio-Plex manager software. Samples were run in duplicate.

Figure S1

Figure S1. NRP1-expressing ATMs accumulate in DIO. (A) Flow cytometry analysis of

NRP1+ ATMs isolated from VAT of WT mice fed either a NCD or HFD for 10 weeks,

represented as percent (left), or total number of cells per gram of tissue (right) (n=9). (B)

Representative VAT IHC of WT mice fed NCD (left), 10 week HFD (center) and 22 week HFD

(right) labelled with NRP1, F4/80, lectin and perilipin (x30 magnification, scale bars = 50μm).

(C) Flow cytometry analysis of NRP1+ ATMs isolated from VAT of LysM-Cre-Nrp1+/+

(control) and LysM-Cre-Nrp1fl/fl mice, represented as MFI (n=6).(D) Flow cytometry analysis of

YFP signal within CD3+ T cells, CD19+ B cells , CD11b+ Ly6G+ neutrophils, CD11b Ly6Chi

monocytes isolated from LysM-Cre/ROSA26EYFPfl/fl mice. (E) Bone density of control and

LysM-Cre-Nrp1fl/fl mice fed NCD (n=6-7). (F) Bone density of control and LysM-Cre-Nrp1fl/fl

mice fed HFD (n=3).

Figure S2

Fig. S2. Deficiency in myeloid-resident NRP1 influences systemic metabolism. (A-H) Area

under the curve of (A) Total beam breaks of control and LysM-Cre-Nrp1fl/fl mice 18 weeks on

NCD (aged-matched controls to HFD mice), or (B) 10 weeks on HFD. (C) VO2, (D) heat

production and (E) RER of control and LysM-Cre-Nrp1fl/fl mice 18 weeks on NCD. (F) VO2, (G)

heat production and (H) RER of control and LysM-Cre-Nrp1fl/fl mice 10 weeks on HFD. (I)

LDL-cholesterol, (J) Total cholesterol and K) Chol/HDL of control and LysM-Cre-Nrp1fl/fl mice

at 8 weeks on NCD, 10 and 22 weeks on HFD. A-H n=24, 4 mice per group; I-K n=3. Student’s

unpaired t-test *p<0.05, **p<0.01, ***p<0.001.

Figure S3

Fig. S3. Macrophage-resident NRP1 promotes FA uptake. (A) Lipid droplet Oil Red O area

quantification of macrophages incubated in DMEM (L1-3T3 medium) (n=18-26), (B) DMEM

and insulin (adipocyte medium) (n=14-21), and (C) DMEM-F12 macrophage culture medium

(n=33-36). (D) Fatp3 and (E) Glut4 expression of 10 week HFD control and LysM-Cre-Nrp1fl/fl

mice (n=5-9 per group).

Figure S4

Figure S4. Gating scheme for ATMs. (A) ATM gating scheme: 1) gating of live cells, 2)

removal of doublets, 3) gating of viable and hematopoietic cells, 4) exclusion of Ly6G positive

cells, 5) exclusion of CD11c high cells, 6) gating of macrophages, 7) CD206+ and CD206-

discrimination, 8) Specimen FMO control. (B) NRP1 ATM signal and isotype control.

Figure S5

Figure S5. Transfer of NRP1-expressing bone marrow. (A) FACS dot plots of CD45.1+ and

CD45.2+ monocytes from control and LysM-Cre-Nrp1fl/fl irradiated mice having received

CD45.1 bone marrow (BM), and CD45.1 irradiated mice having received control or LysM-Cre-

Nrp1fl/fl bone marrow. (B) Quantification of CD45.1+ and CD45.2+ monocytes in bone marrow

transfer mice (n=6-8 per group). (C-D) Weight of bone marrow chimeras prior to HFD feeding:

(C) LysM-Cre-Nrp1+/+ or LysM-Cre-Nrp1fl/fl +CD45.1 bone marrow (n=8); (D) CD45.1 +LysM-

Cre-Nrp1+/+ or LysM-Cre-Nrp1fl/fl bone marrow (n=6-10). (E-F) AUC of bone marrow chimeras

prior to HFD feeding: (E) LysM-Cre-Nrp1+/+ or LysM-Cre-Nrp1fl/fl +CD45.1 bone marrow (n=4-

7 per group), (F) CD45.1 +LysM-Cre-Nrp1+/+ or LysM-Cre-Nrp1fl/fl bone marrow (n=6-7). (G-

H) GTT AUC of bone marrow chimeras after 10 weeks of HFD: (G) LysM-Cre-Nrp1+/+ or

LysM-Cre-Nrp1fl/fl +CD45.1 bone marrow, (H) CD45.1 +LysM-Cre-Nrp1+/+ or LysM-Cre-

Nrp1fl/fl bone marrow (n=5-7 per group). (I) Flow cytometry analysis of ATMs, B and T

lymphocytes isolated from chimera VAT presented in percent (n=2-4). Student’s unpaired t-test

(E-H AUC histograms), two-way ANOVA with Bonferroni post hoc test (E, F) *p<0.05,

***p<0.001.

Table S1. Fluorophore-conjugated antibodies used for flow cytometry.

Antibody Clone, Supplier

Brilliant Violet 785 anti-mouse CD45.2 104, BioLegend

Brilliant Violet 711 anti-mouse/human CD11b M1/70, BioLegend

APC/CY7 anti-mouse Ly-6G 1A8, BioLegend

Pe/Cy7 anti-mouse F4/80 BM8, BioLegend

PE anti-mouse CD11c N418, BioLegend

FITC anti-mouse Ly-6C HK1.4, BioLegend

APC anti-mouse CD304 (Neuropilin-1)

or

APC Rat IgG2a, κ Isotype Ctrl

3E12, BioLegend

RTK2758, BioLegend

Brilliant Violet 421 anti-mouse CD206 (MMR) C068C2, BioLegend

Pacific Blue anti-mouse CD45.1 (for chimeras) A20, BioLegend

Table S2. Primer sets used for reverse transcription PCR.

Genes Forward (5'-3') Reverse (5'-3')

Nrp1 ACCCACATTTCGATTTGGAG TTCATAGCGGATGGAAAACC

Sema3a GCTCCTGCTCCGTAGCCTGC TCGGCGTTGCTTTCGGTCCC

Tgfb1 GGACTCTCCACCTGCAAGAC CATAGATGGCGTTGTTGCGG

Tnfa CGCGACGTGGAACTGGCAGAA CTTGGTGGTTTGCTACGACGTGGG

Vegfa GCCCTGAGTCAAGAGGACAG CTCCTAGGCCCCTCAGAAGT

Vegfb TCTGAGCATGGAACTCATGG TCTGCATTCACATTGGCTGT

Plgf CTGCTGGGAACAACTCAACAGA GCGACCCCACACTTCGTT

Hgf CATTGGTAAAGGAGGCAGCTATAAA GGATTTCGACAGTAGTTTTCCTGTAGG

Pdgfd CCAAGGAACCTGCTTCTGACA TCCGAATTGATGGTCAAAGGA

bfgf CCAAGCAGAAGAGAGAGGAGTTGTG TGCCCAGTTCGTTTCAGTGC

Pdgfb CCGGAACAAACACACCTTCT TATCCATGTAGCCACCGTCA

Sema3e TCTGCAACCAACCATCCA ACCACAAGAGGGAAGCACAGAC

Il-6 CTTCCATCCAGTTGCCTTC ATTTCCACGATTTCCCAGAG

Tnfα CGCGACGTGGAACTGGCAGAA CTTGGTGGTTTGCTACGACGTGGG

Il-1a CGAAGACTACAGTTCTGCCATT GACGTTTCAGAGGTTCTCAGAG

Fatp3 CGCAGGCTCTGAACCTGG TCGAAGGTCTCCAGACAGGAG

Glut4 TTCCTTCTATTTGCCGTCCTC TGGCCCTAAGTATTCAAGTTCTG