1

Supplemental Materials

Context-specific -to- cell reprogramming by forced Pdx1 expression

Yu-Ping Yang, Fabrizio Thorel, Daniel F. Boyer, Pedro L. Herrera, and Christopher V.E. Wright

A. Supplemental Figures and Legends:

Supplemental Fig. 1 related to Fig. 1

Supplemental Fig. 2 related to Fig. 1 and 3

Supplemental Fig. 3 related to Fig. 2

Supplemental Fig. 4 related to Fig. 2 and 3

Supplemental Fig. 5 related to Fig. 2

Supplemental Fig. 6 related to Fig. 3

Supplemental Fig. 7 related to Fig. 3

Supplemental Fig. 8 related to Fig. 4

Supplemental Fig. 9 related to Fig. 4

Supplemental Fig. 10 related to Fig. 4

Supplemental Fig. 11 related to Fig. 1 and 4

B. Supplemental Materials and Methods:

Mouse strains

Morphometric analysis

Supplemental Table 1: List of antibodies used

Supplemental Table 2: Primers used in qRT-PCRs

C. Supplemental References

2

A. Supplemental Figures and Legends

Supplemental Fig. 1

Supplemental Fig. 1. Exogenous Pdx1 expression from Neurog3-expressing cells

(Neurog3Cre-Pdx1OE) selectively affects -cells but not other endocrine cells. (A-B’,

D-E’) Sst and Ppy expression at P1 and adult pancreas showed no obvious difference

between control and Neurog3Cre-Pdx1OE. No Sst-Gcg or Sst-Ins co-expression was

detected (A-B’). At P1, Ppy is expressed in a subset of Ins+ cells in both control and

Neurog3Cre-Pdx1OE (D,D’). However, no Ppy-Ins co-expression was detected in adult

pancreas (E,E’). (C,C’) Pdx1 expression was detected in Sst-expressing cells in control

and Neurog3Cre-Pdx1OE pancreas. (F,F’) Exogenous Pdx1 staining was found in

Neurog3Cre-Pdx1OE adult pancreas (arrows). Note no Gcg+ cells were detected in adult

Neurog3Cre-Pdx1OE pancreas. Ghr expression showed no alteration between P1

Neurog3Cre-Pdx1OE and control pancreas (data not shown).

3

Supplemental Fig. 2

Supplemental Fig. 2. Global glucose homeostasis of Neurog3Cre-Pdx1OE adults. (A) Intraperitoneal glucose tolerance test (IPGTT;

with overnight fasting) (2-3 months old; N=4 for each genotype) and (B) ad lib feeding glucose levels (9-11 months old) revealed no

significant difference, but slightly lower glucose levels.

4

Supplemental Fig. 3

Supplemental Fig. 3. Pooled number of Gcg-expressing and Ins-expressing cells at

key stages. No significant difference between control and Neurog3Cre-Pdx1OE is detected

at each stage (i.e. p>0.05 by one-factor ANOVA). N=3 per stage per genotype.

5

Supplemental Fig. 4

Supplemental Fig. 4. Quantitative RT-PCR analysis of key factors during endocrine

development and maturation at P1 and P12. Results of relative expression

(Neurog3Cre-Pdx1OE to control) were shown as CT±SEM. Asterisks denote significant

difference (p<0.05 determined by Student’s t-test) and those CT values are shown.

Neurog3Cre-Pdx1OE islets could not be consistently isolated, and such difficulties could be

caused by altered robustness (overall integrity, cell adhesion properties) in the absence of

peripheral -cells.

6

Supplemental Fig. 5

Supplemental Fig. 5. No significant difference in proliferation and cell death

between control and Neurog3Cre-Pdx1OE was detected. (A1-D2) Representative

pictures of BrdU (A1, A2) or Ki67 (B1-D2) staining of pancreatic islets at different

stages. (E) Proliferation index of -cells and -cells at different stages is shown in

percentage (%). The percentage was determined by proportion of BrdU+Gcg+ (or

7

Ki67+Gcg+) over total Gcg+ cells for proliferating -cells, and similarly BrdU+Ins+ (or

Ki67+Ins+) over total Ins+ for -cells. No obvious difference was detected between

control and Neurog3Cre-Pdx1OE. BrdU (100g per gram of mouse body weight) were

injected 1 hour prior to animal dissection. (F1-I2) Almost no TUNEL+ cells were found

in either genotype at different stages. (J) An internal positive control at intestine crypt

area shows several TUNEL+ cells.

8

Supplemental Fig. 6

Supplemental Fig. 6. Diminished Arx and MafB and ectopic Pax4 expression in

Neurog3Cre-Pdx1OE -cells at P12. (A,B) Decreased numbers of Arx+ cells were found

in Neurog3Cre-Pdx1OE pancreas, and some Ins+Arx+ cells were detected. (C,D) MafB

expression, normally in most Gcg-expressing cells (C), was not detected in all Gcg+ cells

in Neurog3Cre-Pdx1OE pancreas (arrows in D), suggesting repression of MafB by

exogenous Pdx1. (E,F) Pax4 expression, normally excluded from -cells (E), was

ectopically detected in Gcg-expressing cells in Neurog3Cre-Pdx1OE (arrows in F). Pax4

expression is detected in Ins+ cells in both control and Neurog3Cre-Pdx1OE.

9

Supplemental Fig. 7

Supplemental Fig. 7. Nkx6.1 and Glut2 expression appeared normal in Neurog3Cre-

Pdx1OE pancreas. (A,B) Nkx6.1 expression is detected in most Ins+ cells except for a

small residual number of Arx+Ins+ cells found rarely (arrows in B). (C,D) Glut2

expression is detected in most Ins+ cells except a few located at the islet periphery

(arrows and insets in D).

10

Supplemental Fig. 8

Supplemental Fig. 8. Absent MafB expression but maintained Arx expression in

GcgCre-Pdx1OE -cells. (A,B) MafB expression was not detected in most lineage-labeled

YFP+Pdx1HI -cells, while (C,D) Arx expression was maintained even in the presence of

ectopic Pdx1 expression. Asterisks in each panel denote representative cells that were

also shown in higher magnification in the separated channels. Loss of MafB and

maintenance of Arx were also detected in GcgrtTA/Cre-Pdx1OE lineage-labeled -cells (not

shown).

11

Supplemental Fig. 9

Supplemental Fig. 9. Exogenous Pdx1 in GcgCre-Pdx1OE does not induce Sst or Ppy

expression. (A,B) Sst expression is not detected in GcgCre-mediated YFP+ lineage-

labeled cells in either genotype. (C,D) In the control, Ppy was detected in a small

number of YFP+ cells (arrows in C), which is likely due to the lack of specificity of

available Ppy antibodies. Similarly in GcgCre-Pdx1OE, Ppy was also detected a small

proportion of YFP+ cells (either Pdx1- or Pdx1HI; arrows in D), while the great majority

of YFP+Pdx1HI cells were negative for Ppy immunodetection (e.g. inset and separated

channels in D).

12

Supplemental Fig. 10

Supplemental Fig. 10. Inefficient induction of Ins expression by forced Pdx1 expression in adult Gcg-expressing cells. (A)

Schematic presentation of an inducible genetic system to activate exogenous Pdx1 expression specifically in Gcg-expressing cells.

Gcg promoter driven rtTA (Gcg-rtTA) activates TetO-Cre responder in the presence of Doxycycline and thus drives Cre protein

13

expression, leading to Gcg cell-selective recombination of R26REYFP reporter and/or CAG-CAT-Pdx1 for exogenous Pdx1 expression.

(B) Doxycycline (DOX) treatment scheme. DOX was administered to 2-month-old adults for 2 weeks (“PULSE”), followed by 1

month of “CHASE” period. Analysis was therefore done on 3.5-month-old animals. (C-L) Exogenous Pdx1 expression is detected

in YFP+ lineage-labeled cells in GcgrtTA/Cre-Pdx1OE pancreas (J) but not in the control (E). Gcg expression was efficiently repressed

(H,I) but Ins expression was not induced (K).

14

Supplemental Fig. 11

Supplemental Fig. 11. Expression pattern of Set7/9 in Pdx1HI -cells adopts a -cell-

like nuclear pattern. (A,A’) At P14 control pancreas, Set 7/9 is expressed in the

cytoplasm of Gcg+ -cells (magenta cytoplasm) and is not detected in -cells (A). In

Neurog3Cre-Pdx1OE pancreas, Set7/9 is not detected in -cells or -cells (A’). (B,B’) In

adult, Set7/9 shows a cytoplasmic and nuclear pattern in-cells and a distinct nuclear

pattern in -cells (B; magenta cytoplasm with red nucleus). In Neurog3Cre-Pdx1OE adult,

no magenta cytoplasmic pattern of Set7/9 was detected, and most cells show a nuclear

pattern (B’). (C,C’) Set7/9 is detected in the cytoplasm and nucleus of GcgrtTA/Cre-

mediated lineage-labeled YFP+ -cells (the asterisk in C and separated channels; yellow

cytoplasm for YFP+ and cytoplasmic/nuclear Set7/9+). In YFP+Pdx1HI -cells of

GcgrtTA/Cre-Pdx1OE adult, Set7/9 is restricted in the nucleus (asterisk in C’ and separated

channels; absence of yellow cytoplasm pattern). Arrows in C’ denote two -cells that did

not go through recombination and show Set7/9 expression in cytoplasm and nucleus.

15

B. Supplemental Materials and Methods

Mouse strains

The following mouse lines were used and previously described: Neurgo3TgBAC-Cre

(Schonhoff et al., 2004), CAG-CAT-Pdx1 (Miyatsuka et al., 2003; Miyatsuka et al.,

2006), R26REYFP (Srinivas et al., 2001), GlucagonTgCre (Herrera, 2000), Glucagon-rtTA

(Thorel et al., 2010) and TetO-Cre (Perl et al., 2002).

Morphometric analysis

A systematic and broad analysis of the pancreas was undertaken at E16.5, P1, P7 and

P12, where every tenth pancreas section (5m each) of the whole pancreas was analyzed

completely, from three embryos or animals per genotype per stage. Sections were

Immunofluorescence-stained for Ins and Gcg, and the number of cells was determined by

manually counting every marker+ cell in each section. On average, ~2500 cells per

pancreas were counted for E16.5 and ~10,000 per pancreas for other postnatal stages

(also see Fig. S3). Statistical analysis was performed using single-factor ANOVA tests,

and significance determined with a p<0.05.

For the GcgCre-based studies, which used mice with a different compound genetic

background, Pdx1HIYFP+ cells from GcgCre-Pdx1OE pancreas (~400 cells from 5 animals)

or Pdx1-YFP+ cells from control (~1000 cells from 3 animals) were manually counted to

determine their Gcg and Ins expression status.

16

Supplemental Table 1. List of Antibodies used

Antibody Species Dilution Source

Arx Rabbit 1:1000* P. Collombat

FLAG Rabbit 1:1000* Thermo Scientific

GFP Chicken 1:2000 Aves

Glucagon Guinea pig 1:2000 Linco

Glut2 Rabbit 1:200 Alpha Diagnostic

Insulin c-peptide Goat 1:2000 Linco

MafA Rabbit 1:1000* Novus Biologicals

MafB Rabbit 1:10,000* Bethyl Laboratories

Neurog3 Goat 1:10,000* G. Gu

Nkx6.1 Rabbit 1:2000 BCBC

Pax4 Rabbit 1:1000* B. Sosa-Pineda

Pdx1 Guinea pig 1:20000 Self

Pancreatic polypeptide Guinea Pig 1:2000 Millipore

Somatostatin Goat 1:2000 Santa Cruz

*Tyramide signal amplification (Perkin Elmer) required.

17

Supplemental Table 2. Primers used in qRT-PCRs

Primer name Sequence

Arx CAGCCGCGCTGACCAGGAAA TGGTGGTGGCGGTGGAGGAA

Brn4 CGCACGTAGCCCACCACTCG CCGCTCACGGTGAAGCCTGG

GADPH AACTTTGGCATTGTGGAAGG GGATGCAGGGATGATGTTCT

Glucagon ACATCTCGTGCCAGTCACTT CGTTGGGTTACACAATGCT

Insulin CAGCAAGCAGGTCATTGTTT GGGACCACAAAGATGCTGTT

MafA CTCCTCCAAGCGCACGTGGT TTCAGCAAGGAGGAGGTCAT

MafB CAGGGTTTCTGAGCTTCTCC CCGGGTCTCTCTAACTCTGC

Nkx2.2 GTGCCCGGGCGGAGAAAGGTAT GGGGGTGTGCTGTCGGGTACT

Nkx6.1 ACTTGGCAGGACCAGAGAG GCGTGCTTCTTTCTCCACTT

Pax4 GAGAAAGAGTTTCAGCGTGGGCAG TGTCAGGTCCTGGGAAGCACCT

Pax6 AGCCCAGTATAAACGGGAGTGCC TCCCGGGATACCAACCAGGGC

Pdx1 GGAAGAGCCCAACCGCGTCC GGCGGGGCCGGGAGATGTAT

Pancreatic polypeptide ATGACCCAGGCGACTATGC TGTATCTGCGGAGCTGAGTT

Somatostatin CCCAGACTCCGTCAGTTTCT ACTTGGCCAGTTCCTGTTTC

18

C. Supplemental References Herrera, P.L. (2000). Adult insulin- and glucagon-producing cells differentiate from two

independent cell lineages. Development 127, 2317-2322. Miyatsuka, T., Kaneto, H., Kajimoto, Y., Hirota, S., Arakawa, Y., Fujitani, Y.,

Umayahara, Y., Watada, H., Yamasaki, Y., Magnuson, M.A., et al. (2003). Ectopically expressed PDX-1 in liver initiates endocrine and exocrine pancreas differentiation but causes dysmorphogenesis. Biochem Biophys Res Commun 310, 1017-1025.

Miyatsuka, T., Kaneto, H., Shiraiwa, T., Matsuoka, T.A., Yamamoto, K., Kato, K., Nakamura, Y., Akira, S., Takeda, K., Kajimoto, Y., et al. (2006). Persistent expression of PDX-1 in the pancreas causes acinar-to-ductal metaplasia through Stat3 activation. Genes Dev 20, 1435-1440.

Perl, A.K., Wert, S.E., Nagy, A., Lobe, C.G., and Whitsett, J.A. (2002). Early restriction of peripheral and proximal cell lineages during formation of the lung. Proc Natl Acad Sci U S A 99, 10482-10487.

Schonhoff, S.E., Giel-Moloney, M., and Leiter, A.B. (2004). Neurogenin 3-expressing progenitor cells in the gastrointestinal tract differentiate into both endocrine and non-endocrine cell types. Dev Biol 270, 443-454.

Srinivas, S., Watanabe, T., Lin, C.S., William, C.M., Tanabe, Y., Jessell, T.M., and Costantini, F. (2001). Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Dev Biol 1, 4.

Thorel, F., Nepote, V., Avril, I., Kohno, K., Desgraz, R., Chera, S., and Herrera, P.L. (2010). Conversion of adult pancreatic alpha-cells to beta-cells after extreme beta-cell loss. Nature 464, 1149-1154.