Molecular Cell, Volume 58

Supplemental Information

Transcriptional Elongation Factor ENL Phosphorylated by ATM Recruits Polycomb and Switches Off Transcription for DSB Repair Ayako Ui, Yuko Nagaura, and Akira Yasui

Supplemental Information

Figure S1, Related to Figure 2

ENL and AF9 were required for transcriptional elongation. Either knockdown of

ENL or AF9 barely influenced transcriptional activation, but double knockdown

showed a significant defect in transcriptional activation. U2OS/TRE/I-SceI-19 cells

pretreated with siCont, siENL and/or siAF9 were electroporated with pCherry-tTA-ER,

and pYFP-MS2. After Tam-treatment for 120 min, cells were fixed. Left; representative

images are shown. Middle; Graph shows the data presented as the mean±SD of three

independent experiments. Right; Suppression effect of each or double siRNA treatment

on ENL or AF9 expression.

Figure S2, Related to Figure 2

(A) RING1B is recruited at DSB-induced transcriptional repression sites.

U2OS/TRE/I-SceI-19 cells were electroporated with pCherry-tTA-ER and

pEGFP-RING1B and with/without pCMV-NLS-I-SceI. After 120 min Tam-treatment,

DSB was detected by using H2AX antibody. Left; representative images are shown.

Right; data of GFP-RING1B focus are presented as the mean±SD of three independent

experiments.

(B) Endogenous ENL and BMI1 are recruited at DSB-induced transcriptional

repression sites. U2OS/TRE/I-SceI-19 cells were electroporated with pCherry-tTA-ER

and/ pCMV-NLS-I-SceI. Left; representative images are shown. After 120 min

Tam-treatment, DSB was detected by using H2AX and ENL or BMI1 antibody.

Figure S3, Related to Figure 3

(A) ATM was required for DSB-induced transcriptional repression and (B)

Recruitment of RING1B at transcriptional repression sites depend on ATM.

U2OS/TRE/I-SceI-19 cells were electroporated with pCherry-tTA-ER,

pCMV-NLS-I-SceI and (A) pYFP-MS2 and (B) GFP-RING1B. Cells were treated with

ATM inhibitor (Ai) for 120 min before Tam-treatment. After Tam-treatment for 120

min, cells were fixed and detect DSB by using H2AX antibody. Left; representative

images are shown. Right; data of (A) YFP-MS2 and (B) GFP-RING1B focus are

presented as the mean±SD of three independent experiments.

Figure S4, Related to Figure 4 (A) Endogenous ENLand RING1B co-localized at

the same transcription sites in response to DSB. ChIP was performed 2h after

Tam-treatment by using control IgG and ENL antibody. Then, Re-ChIP assay was done

with a control IgG, ENL and RING1B antibodies followed by the ChIP assay with ENL

antibody. The data are expressed as fold enrichment around the transcription start site

(TSS) (+80bp of TSS) relative to negative control (IgG), and the mean±SD of one of

two independent experiments performed in triplicate is represented. (B) DOT1L is not

involved in DSB-induced transcriptional repression. U2OS/TRE/I-SceI-19 cells

pretreated with siRNA were electroporated with pCherry-tTA-ER, pCMV-NLS-I-SceI

and pYFP-MS2. After Tam-treatment for 120 min, cells were fixed and DSB was

detected by using H2AX antibody. Left; representative images are shown. Middle; data

of YFP-MS2 focus are presented as the mean±SD of

Figure S5, Related to Figure 7

AF9 is a paralog of ENL and is also involved in DSB-induced transcriptional

repression.

(A) AF9 has conserved SQ-sites as ENL (B) Direct interaction of recombinant

His-BMI1 with GST-AF9. Recombinant GST and GST-AF9 were incubated with

His-BMI1 and precipitated with glutathione Sepharose. His-BMI1 was precipitated with

GST-AF9. (C) Recruitment of AF9 at transcription-sites during transcriptional

activation and DSB-induced transcriptional repression. U2OS/TRE/I-SceI-19 cells were

electroporated with pCherry-tTA-ER, pEGFP-AF9 and pCMV-NLS-I-SceI or its vector.

Experiments were performed as those in Figure 2E. Left; representative images. Right;

data are presented as the mean±SD of three independent experiments. (D)

Ubiquitination-H2A (ub-H2A) at transcriptional activation site in response to DSB was

reduced in AF9 knockdown cells. U2OS/TRE/I-SceI-19 cells pretreated with siCont or

siAF9 were electroporated with pCherry-tTA-ER and pCMV-NLS-I-SceI. After

Tam-treatment for 120 min, cells were fixed and detect DSB by using H2AX antibody.

Left; representative images. Right; data are presented as the mean±SD of three

independent experiments. (E) The phosphorylation of AF9 is also important for

DSB-induced transcriptional repression. U2OS/TRE/I-SceI-19 cells pre-treated with

siCont or siENL were electroporated with pCherry-tTA-ER, pYFP-MS2,

pCMV-NLS-I-SceI and pFlag-AF9 pEGFP-AF9-SQ-muts or its vector. After 120 min

Tam-treatment, DSB was detected by using H2AX antibody. Left; representative

images. Right; data are presented as the mean±SD of three independent experiments.

Bottom; Expression of AF9 and its mutants.

Figure S6, Related to Figure 7

ENL and AF9 display similar but non-identical functions in DSB-induced

transcriptional repression. U2OS/TRE/I-SceI-19 cells pretreated with siRNA were

electroporated with pCherry-tTA-ER, pYFP-MS2 and pCMV-NLS-I-SceI and

pFlag-ENL, pFlag-AF9 or its vector. After Tam-treatment for 120 min, cells were fixed

and DSB was detected by using H2AX antibody. Top; representative images are

shown. Bottom; data of YFP-MS2 focus are presented as the mean±SD of three

independent experiments..

Figure S7, Related to Figure 7

Models of ENL/AF9 functions proposed from this study. ENL, cooperatively with

PRC1, regulates transcription. I) During transcriptional activation, ENL in Super

Elongation Complex (SEC) promotes transcriptional elongation. II) When DSBs occur

near transcriptional sites, ATM phosphorylates ENL at evolutionally well-conserved

SQ-sites. This phosphorylation of ENL recruits E3-ubiquitine ligase of PRC1 at

transcriptional elongation sites through BMI1 to promote ubiquitination-H2A and

transcriptional repression. This DSB-induced transcriptional repression in close

proximal to DSB sites promotes the access of DSB repair protein at DSB sites and

efficiently DSB repair.

Supplemental Experimental Procedures

Cell culture

U2OS and U2OS/TRE/I-SceI-19 cells were cultured in DMEM supplemented with 10%

fetal bovine serum (FBS) at 37°C with 5% CO2. Stable isogenic Flp-In 293 cells

expressing ENL tagged with a FLAG-HA were established using Flp-In system

(Invitrogen), according to the manufacturer’s protocol. Flp-In 293 cells were cultured in

DMEM supplemented with 10% fetal bovine serum (FBS) at 37°C with 5% CO2.

Plasmids

The pCherry-rTA-ER and pYFP-MS2 plasmids were obtained from Dr. Susan M.

Janicki, The Wistar Institute, Philadelphia, USA. The pCBASce (I-SceI expression

plasmid) plasmid was obtained from Dr. Maria Jasin, the Memorial Sloan-Kettering

Cancer Center, USA. The pEGFP-ENL, pEGFP-BMI1, pEGFP-RING1B, pGST-ENL,

pGST-ENL-N, pGST-BMI1, pGST-RING1B, pHis-ENL and pHis-BMI1 were

constructed by subcloning corresponding cDNA fragments amplified by PCR into the

pEGFP-C1 vector (BD Bioscience Clontech, Mountain View, CA). Wild type and

mutant ENL were constructed in pCherry-tetR by subcloning ENL cDNA fragments..

All constructs were verified by sequencing. Plasmid DNAs were propagated in and

purified from XL1-Blue E. coli cells.

Antibodies

Antibodies used in this study were; anti-phospho Histone H2AX S139 (05-636,

Upstate), anti-ubiquityl-H2A (05-678, MILLIPORE), anti-ENL (NBP1-26653, NOVUS

Biologicals), anti-BMI1 (A301-694A, BETHYL Lab.), anti-RING1B (ab3832, Abcam),

anti-AF9 (ab154492, Abcam), anti-Phospho-(Ser/Thr) ATM/ATR substrate (#2851,

Cell Signaling), -actin (A 5441, Sigma), anti-Flag (Sigma).

Inhibitor

5,6-Dichlorobenzimidazole 1--D-ribofuranoside (DRB) was purchased from Sigma

(cat No. D1916). ATM inhibitor CAS 905973-89-9 was purchased from Calbiochem

(cat No. 118501).

siRNAs

We used the mixture of following siRNAs targeted to 3’-UTR sequences purchased

from Invitrogen; siENL (#1: UCUUCCUGAUACCUGAAGGCAGUGG,

#2: GCUUCCUUUCUUCUCUGGAAACUAA,

#3: AGUUCCUUCAGUCCAAUGUCUUAGU),

siAF9 (#1: UAAAGAAGAUGAUUGCGGAGCAUGC,

#2: UCCAGGGUAAAGAAGAUGAUUGCGG,

#3: GAUAUAACAACUGGAUGCAUCAAGA),

siBMI1 (#1: UUAGCAUCUAGAAAGCUGUAAUGGC,

#2: GAUACUCCUAUGGACGUUAAUUGAA ,

#3: GAUACUCCUAUGGACGUUAAUUGAA),

siRING1B (#1: AUUUGAAUAGCGUAAACUAGUCUGG,

#2: GAAGGGACUGCAAUUAUUCAGUAUU,

#3: AUUAAAGCAGGGCUCAAGCUCUAUU).

Plasmid and siRNA transfection

Transient transfections were performed using Lipofectamine 2000 and Lipofectamine

RNAiMAX (Invitrogen) according to the manufacturer’s protocol.

Interaction between tethered ENL and GFP-BMI1

U2OS/TRE/I-SceI-19 cells were electroporated with the pCherry-TetR (Ve),

pCherry-TetR-ENL (ENL) and pEGFP-BMI1. Twenty-four hours after electroporation,

the cells were fixed with 4% paraformaldehyde, and nuclei were stained by DAPI.

30-60 cells per condition from both Cherry-and GFP- expressed cells were analyzed

from each sample. Data are presented as the mean ±SD of three independent

experiments.

Proteomics

Proteins interacting with ENL were determined by nano/LC/MS/MS analysis (Japan

BioService).

GST-pull down assay

Recombinant full-length of GST-RING1B or GST-BMI1 and HIS-ENL fusion proteins

were expressed in E. coli strain BL21 and purified by glutathione-affinity resin. GST

fusion proteins were incubated with His-ENL protein in binding buffer (50mM

Tris-HCl, 0.3M NaCl, 0.1% NP-40, 1mM EDTA and protease inhibitor) at 4 Co for

overnight. Protein complexes were pulled down with glutathione beads, washed five

times with binding buffer, and subjected to Coomassie Blue staining of Western

blotting using anti-ENL antibody.

Immunoprecipitation

Cells were lysed in a low salt and detergent-containing buffer (NETN100; 20mM Hepes

PH7.5, 0.5% NP-40 and 100mM NaCl) containing a proteinase inhibitor cocktail and a

phosphatase inhibitor cocktail (Roche). The soluble fraction which is a low

salt-extractable fraction (presumably contains cytoplasmic and nucleoplasmic proteins)

was removed by centrifugation and the insoluble fraction containing proteins stably

bound to nuclear structure (presumably contains chromatin and nuclear matrix-related

proteins) was further extracted sequentially with NETN300 buffer (20 mM Hepes, pH

7.5, 300 mM NaCl, 0.5% NP-40) containing DNAase, RNase and Benzonase a

proteinase inhibitor cocktail and a phosphatase inhibitor cocktail (Roche) and incubated

at 4 °C for 30 min. The insoluble fraction was removed by centrifugation and the

soluble fraction was immunoprecipitated with antibody against FLAG, ENL or BMI1.

Precipitated protein bands were analyzed by western blotting.