Current Biology, Volume 24

Supplemental Information

Gamete Attachment Requires GEX2 for

Successful Fertilization in Arabidopsis

Toshiyuki Mori, Tomoko Igawa, Gen Tamiya, Shin-ya Miyagishima, and Frédéric Berger

Figure S1. Characterization of gex2-1 (Y47) Line (A) In the gex2-1 line, two sets of unfused sperm cells were rarely observed (arrowheads).

(B and C) Observation of gex2-1 pollen tubes. The fluorescent (B) and DIC images (C) show the same structures. Pollen tubes (arrowheads) reached successfully both ovules leading to developing seeds (ds) and ovules that failed

development (fo). The scale bar represents 100 μm. (D) After positional cloning, a point mutation exchanging G to A was detected in the 8th intron of the GEX2 gene in the heterozygous and homozygous Y47

plants (top left panel, +/gex2-1 and -/gex2-1, respectively). CAPS-PCR was carried out to confirm the gex2-1 (Y47) mutation (top right panel). For the CAPS-PCR, a 5ʹ′ primer (blue text) in which the original bases AC (asterisk) were

changed to TT (slide-upped characters) was produced to create an AflII restriction enzyme site (boxed) in the PCR product from WT plants. The product from gex2-1 plants is expected to be uncleaved because of the point mutation

(red text). The WT product was cleaved after AflII digestion, while +/gex2-1 and -/gex2-1 plants showed longer AflII-uncleavable products. The amino acid sequence of the predicted protein encoded by the gex2-1 product was deduced

(bottom). Because of splicing deficiency, the 8th intron (green characters) was expected to be translated, leading to a frameshift translation in the 9th exon. (E) Complementation of gex2-1 mutation. After introduction of

pGEX2::gGEX2-GFP construct, both snRFP-positive ovules (top panel) and abnormal seed development (bottom panel) were reduced in -/gex2-1 plants homozygously expressing the transgene. Each color of the bar charts

corresponds to that of Figures 1D and 3B.

Figure S2. Observation of Subcellurar GEX2 Localization (A-F) A transient expression assay of GEX2-GFP in onion epidermal cells. The fluorescent images (A-C) and DIC images (D-F) are an identical field group,

respectively. The inserts in (B, C, E and F) are images of plasmolyzed cells. The GFP signal was detected in the nucleus (n) and cytoplasm (cp) of p35S::GFP expressing cells (A). In contrast, GCS1-GFP was detected on the surface of

p35S::cGCS1-GFP-expressing cells (B). A similar signal was also detected in p35S::cGEX2-GFP-expressing cells (C). Both GCS1-GFP and GEX2-GFP signals were similarly detected in cell membrane plasmolyzed after sucrose

solution treatment (B, C, E and F). The scale bar represents 50μm.

Figure S3. Characterization of -/gex2-2 Plants (A) An snGFP construct (pHTR10::HTR10-GFP) was linked with a pGEX2::genomic GEX2 (top) or a pGEX2::genomic gex2-1 (bottom) fragment to

produce the snGFP;gGEX2 and snGFP;ggex2-1 constructs, respectively. The arrows represent the direction of transcription. (B) Observation of silique contents in WT plants after pollination with

-/gex2-2+/snGFP;gGEX2 or -/gex2-2+/snGFP;ggex2-1 pollen. In addition to undeveloped ovules (arrows), aborted seeds (arrowheads) were occasionally detected in the siliques at ~10 DAP with -/gex2-2+/snGFP;ggex2-1 pollen (top panel). Normally

developing seeds, aborted seeds and undeveloped ovules were counted (bottom). Each color of the bar charts corresponds to that of Figure 3B. (C and D) snGFP detection in WT ovules after pollination with

-/gex2-2+/snGFP;gGEX2 (left panel) or -/gex2-2+/snGFP;ggex2-1 (right panel) pollen. The snGFP-positive ovules were frequently detected in plants at 1 DAP with -/gex2-2+/snGFP;ggex2-1 pollen (arrowheads), and counted (D). Proliferation of

endosperm cytoplasm was detected in most ovules after pollination with -/gex2-2+/snGFP;gGEX2 pollen (arrows), and similar proliferation was also detected in snGFP positive ovules from those of -/gex2-2+/snGFP;ggex2-1, probably because

of single fertilization. The scale bar represents 50μm.

Figure S4. GEX2 is an Immunoglobulin-like Gamete Attachment Factor (A) While most unfused sperm cells appear to be attached with egg cells expressing emGFP (left), detached sperm cells were also detected (right) in

gex2-1 plants. The scale bar represents 10μm. (B and C) The gex2-1 sperm cells detached from egg (B) or central (C) cells were also detected in incompletely-plasmolyzed ovules after sucrose solution

treatment. Besides unfused sperm pairs, single sperm cells were also similarly detected (inserts in B and C). The scale bar represents 25μm. (D) All plant species GEX2 homologues are composed of an N-terminal signal

sequence (SS), at least one copy of filamin repeat (FLMN) domain, which forms an immunoglobulin (IG) -like fold, and a transmembrane (TM) domain. Although the primary structure is quite different, Chlamydomonas FUS1 also possesses

an FLMN domain. Mus IZUMO1 possesses an IG domain within its N-terminus. Amino acid positions of those domains above are indicated.

Supplemental Experimental Procedures Sequences of Oligonucleotide Primers GEXcapsf(Afl), AAGCATGCTCGGTTTCTCTTAA; GEX2r2, TGGCTAACATCCCAAAACCAA; GEXRTf, CGACGTAAATGTGTATAGCAATGGA;

GEXRTr, CCAGAGAAGCCACCATATCTAGGAC GEX2r10, CATTCAATGTTTGGCTTTCCTTCTC; GEX2r11, ACACCAGCAAATGAACCATTTTCAC;

GEX2f7, ACGCCAATGAAGAATTTTTCAG; GEX2f8, ACCCACCGTTTATTAATGTTCC; GEX2f14(Sal), TGAGGCGTCGACATGGCGATTAAATTCGTTTCAC;

GEX2r13(Not), TGACTGCGGCCGCCTGCTTATTCTGGTTGCCGGAAG; GEX2f4, GGGAAGAAGATGGAGTTTCAGG; RB, TCACGGGTTGGGGTTTCTACAGGAC;

LB, CGTGTGCCAGGTGCCCACGGAATAGT; GEX2f11, ATTCTACGAATTTGATGCTGATGTGG; GEX2r3, CATCTTTCAAGTAAACAGAGAAGCC;

AtGCS1RTF, GGTGACTGGTTCCATGTTTTCGG; AtGCS1RTR, GCTCTTAGTTCTATCATTAGATTTGTGTTG; GFPf(Not), TGACTGCGGCCGCGATGGTGAGCAAGGGCGA;

GFPr(Not), TGACTGCGGCCGCTTACTTGTACAGCTCGTCCAT; AtGCS1(Nco)f2, TGAGGCCCATGGTGAACGCGATTTTAATGGCT; AtGCS1(Nco)r, TGAGGCCCATGGTACTCTCACGTAGTCTTTGTTTCC;

GEXgenf(Hind), CCCAAGCTTTTACATCGGATGGATTCACTTT; GEX2r12(Xba), TGACCTCTAGACTGCTTATTCTGGTTGCCG; HTR10promF(Hind), TGAGGCAAGCTTTACTTCTCCGACCAAAAACTTTCA;

HTR10stopR(Xba), TGCCCATCTAGAAGCACGTTCCCCACGAAT; GEXgenf(Xba), TGAGGCTCTAGATTACATCGGATGGATTCACTTT; GEX2trueR(Sal), TGAGGCGTCGACAAACCAAAAAGGTAATTATAGAATCA;

Fluorescence Microscopy All the image observations in this study were performed using epifluorescence

microscopes (BX51, Olympus, Japan), except for high-resolution time lapse imaging (see below). The pictures were taken using a digital CCD camera (DP72, Olympus, Japan). The image files were edited using Photoshop CS5 software

(Adobe Systems, USA). Screening of Gamete Fusion-Deficient Plants The DM seeds were treated with 0.3% (w/v) ethyl methanesulfonate (EMS) for 8h as previously described (Mayer et al., 1999) to produce point-mutagenized DM plants (the M1 generation) [S1]. Seeds from developing siliques of 5000 M1

plants were observed using fluorescence microscopy to screen for gamete fusion-deficient lines, in which snRFP signals persisted in the ovules. Of such candidates, the Y47 line was subjected to further investigation. To confirm its

male-sterile phenotype, Y47 plants were maternally backcrossed three times with DM plants. The mutated gene in the Y47 line was identified by positional cloning, as previously described [S2]. The position of the Y47 mutation was

determined by sequencing, CAPS assay and reverse-transcription (RT) -PCR (see Figures 2B and S1D). For the CAPS assay, genomic DNA was extracted from WT (Col-0) and Y47 plants, amplified by the GEXcapsf(Afl) and GEX2r2

primers and digested with AflII. For RT-PCR, total RNA was extracted from the flowers of WT and Y47 plants. The RNA was reverse-transcribed and amplified by the GEXRTf and GEXRTr primers. Because the mutation was detected in the

GEX2 gene, the Y47 was designated the gex2-1 line. Time-Lapse Imaging of Semi In Vitro Fertilization A 1.5-mm-thick silicon rubber frame was mounted on a piece of cover slip, and melted agar medium was poured into the frame and allowed to solidify. Cut styles with WT or gex2-1 pollen and excised WT ovules were set on the medium

as previously described [S3]. The observation and image capturing of sperm behavior in ovules were carried out using a digital CCD camera (ORCA-R2, Hamamatsu Photonics K.K., Japan), which was mounted on the epifluorescence

microscope (BX51, Olympus, Japan), and AQUACOSMOS software (Hamamatsu Photonics K.K., Japan). The fluorescent signals were detected by 200-msec excitation (470 ± 10 nm for GFP and 545 ± 10 nm for RFP), and the

fluorescent images were captured every minute for 12 h. The image files were edited with AQUACOSMOS and Premiere Pro CS6 (Adobe Systems, USA). For higher resolution imaging of gex2-1 sperm cells, an inverted confocal

microscope (CV1000, Yokogawa Electric, Tokyo, Japan), equipped with 40× objective lens (UPLSAPO; Olympus, Tokyo, Japan) and EM-CCD camera (ImagEM C9100-13; Hamamatsu Photonics, Tokyo, Japan), was used. The

fluorescent signals were detected by 100-msec excitation (488 nm for GFP and 561 nm for RFP). Sequential images were acquired at 60 sec intervals. The image files were edited with Photoshop CS4 (Adobe Systems, USA) and ImageJ

(http://rsbweb.nih.gov/ij/). GEX2 Structure Analyses The complete sequence of GEX2 cDNA was determined using 5ʹ′ and 3ʹ′ rapid

amplification of cDNA ends (RACE) PCR on total RNA samples from WT flowers. The cDNA production and cDNA amplification were performed according to the manufacturer’s instructions (GeneRacer kit, Invitrogen, USA). 5ʹ′ RACE PCR

was carried out by nested PCR using the GEX2r10 and GEX2r11 primers, while the GEX2f7 and GEX2f8 primers were used for 3ʹ′ RACE PCR. After sequencing

the RACE PCR products, the GEX2 coding sequence (CDS) without the stop codon was amplified by PCR using the GEX2f14(Sal) and GEX2r13(Not) primers and sequenced to determine the complete GEX2 coding sequence. The

GEX2 amino acid sequence was deduced by GENETYX MAC ver.11.2 software (GENETYX Corp., Japan). The prediction of the signal sequence and transmembrane domain of the amino acid sequences was performed using

on-line available programs TMHMM (http://www.cbs.dtu.dk/services/TMHMM/) and SOSUI (http://bp.nuap.nagoya-u.ac.jp/sosui/). In addition, PROSITE (http://prosite.expasy.org/) was used for a functional domain search of the

protein data. The gex2-2 (FLAG_441D08) line was obtained from INRA (http://dbsgap.versailles.inra.fr/portail/), and its T-DNA inserts were detected, using GEX2f4, GEX2r2, RB and LB primers (See Figures 2A and 2B).

Expression of GEX2 in gex2-2 line was assessed, based on RT-PCR using RNA samples extracted from gex2-2 flowers, and GEX2f11 and GEX2r3 primers. As a

control, GCS1 expression was also similarly assessed using AtGCS1RTF and AtGCS1RTR primers.

Subcellular Localization Analyses of GEX2 Protein The above-described GEX2 cDNA was cloned into the downstream region of a cauliflower mosaic virus 35S promoter in the plant GFP expression vector, a gift

from Dr Niwa [S4], after digestion by SalI and NotI. In addition, a GFP cDNA amplified by the GFPf(Not) and GFPr(Not) primers was inserted into the downstream region of the cloned GEX2 cDNA to produce the

p35S::cGEX2-GFP construct. A full-length GCS1 cDNA without a stop codon was also similarly amplified by the AtGCS1(Nco)f2 and AtGCS1(Nco)r primers and cloned into the same vector after NcoI digestion (p35S::cGCS1-GFP

construct). Those vector constructs were introduced into onion epidermal cells by particle bombardment according to the procedure described by Hirooka et al. [S5] and the manufacturer’s instructions (PDS-1000/He, Bio-Rad, USA). For

plasmolysis induction, the epidermal tissues were treated with 2.0 M sucrose solution for 1 h. The genomic GEX2 (gGEX2) fragment, containing 1278 bp upstream of the ATG start site (pGEX2 region) until the codon for the last amino

acid, was amplified by the GEXgenf(Hind) and GEX2r12(Xba) primers. Because of the HindIII site in the gGEX2 sequence, the amplified product was cloned into the upstream region of GFP cDNA in the previously described pPZP221 vector

[S5] in two steps using HindIII, StuI and XbaI to produce the pGEX2::gGEX2-GFP construct. The construct was introduced into the -/gex2-1 plants, and the resulting transformants were selected as previously described

[S6]. To observe GEX2 localization in pollen tubes, cut stigmas pollinated with -/gex2-1 pollen expressing pGEX2::gGEX2-GFP were incubated in the same media as that of semi in vitro fertilization assay until pollen tubes emerge from

the cut end of stigma. The emerged pollen tube bundles were cut with a syringe needle, transferred into 10% glycerol drop and observed. GCS1-GFP signals were also similarly observed, using an Arabidopsis line expressing

pGCS1::gGCS1-GFP, which was produced in a previous study (GPP line) [S7]. Morphological Analyses of gex2 Mutants

Aniline blue staining of pollen tubes was performed as previously described [S6]. To this end, pistils at 2-3 days after pollination (DAP) were collected from self-pollinated -/gex2-1 plants. The silique contents of manually pollinated plants

were observed at ~10 DAP, and developing seeds, aborted seeds and undeveloped ovules were counted after the removal of carpels. To observe incomplete double fertilization in gex2-1 sperm cells, the female gametic marker

line that expresses enRFP and ccGFP [S7] was pollinated using pollen from -/gex2-1 plants.

Phenotype- and Complementation Assays of gex2 Mutants For the snGFP construct, a genomic HTR10 fragment, containing 1215 bp upstream of the ATG start site (pHTR10 region) until the codon for the last amino

acid, was amplified by the HTR10promF(Hind) and HTR10stopR(Xba) primers. The amplified product was similarly cloned into the GFP cDNA-containing pPZP221 vector described above to produce the snGFP construct. The snGFP

cassette, containing pHTR10 (1150 bp) until the NOS terminator sequence, was excised by EcoRI digestion. The genomic GEX2 and gex2-1 fragments, containing the pGEX2 and a 3ʹ′ region until 131 bp downstream of the stop codon

(GEX2 terminator), were amplified by the GEXgenf(Xba) and GEX2trueR(Sal) primers, and the resulting products were digested by XbaI and SalI. Each of the digested fragments and the snGFP cassette were cloned into pPZP221 vector to

produce the snGFP;gGEX2 and snGFP;ggex2-1 constructs. These constructs and the snGFP construct described above were introduced into homozygous FLAG_441D08 (-/gex2-2) plants, and the resulting transformants were selected

as previously described [S6]. Molecular Evolution Genetics Analysis of GEX2 Gene The sequence of A. lyrata GEX2 (AlGEX2) cDNA and deduced AlGEX2 peptide was determined from the genomic AlGEX2 sequence (GenBank: GL348720.1), based on an alignment with the genomic AtGEX2 sequence. For A. lyrata GCS1

(AlGCS1) gene, its cDNA and peptide sequences were obtained from NCBI database (http://www.ncbi.nlm.nih.gov/; Accession XM_002872573). All the

calculations of Ka/Ks ratio between A. thaliana and A. lyrata were performed with a window-sliding method, according to that of Escobar-Restrepo et al. [S8].

Observation of Behaviors of gex2-1 and gcs1 Sperm Cells gex2-1 sperm cells were observed in ovules expressing pDD45::GFP-PIP2a, which was prepared in a previous study [S9], at 1DAP. To prepare the egg

nucleus/membrane marker line, the pDD45::GFP-PIP2a and pEC1::H2B-RFP expressing lines were crossed. The +/gcs1 plants expressing snRFP were prepared by cross between previously obtained Arabidopsis gcs1 mutant [S6]

and DM lines. At 1 DAP with -/gex2-1 or +/gcs1 pollen, ovules were isolated from the pistils of the egg nucleus/membrane marker or DM lines, and treated with previously described polysaccharide-digesting enzyme solution with a minor

modification (1.0 M sucrose was used instead of 13% mannitol) [S10] for 1.5-2 h at room temperature. As a control, ovules from those marker lines above were similarly treated with 1.0 M sucrose solution, after pollination with -/gex2-1

pollen.

Supplemental References S1. Mayer, U., Herzog, U., Berger, F., Inzé, D., and Jürgens, G. (1999).

Mutations in the PILZ group genes disrupt the microtubule cytoskeleton and

uncouple cell cycle progression from cell division in Arabidopsis embryo and endosperm. Eur. J. Cell Biol. 78, 100–108.

S2. Miyagishima, S.Y., Froehlich, J.E., and Osteryoung, K.W. (2006). PDV1 and

PDV2 mediate recruitment of the dynamin-related protein ARC5 to the plastid division site. Plant Cell. 18, 2517–2530.

S3. Palanivelu, R., and Preuss, D. (2006). Distinct short-range ovule signals

attract or repel Arabidopsis thaliana pollen tubes in vitro. BMC Plant Biol. 6, 7.

S4. Niwa, Y., Hirano, T., Yoshimoto, K., Shimizu, M., and Kobayashi, H. (1999).

Non-invasive quantitative detection and applications of non-toxic, S65T-type green fluorescent protein in living plants. Plant J. 18, 455–463.

S5. Hirooka, S., Misumi, O., Yoshida, M., Mori, T., Nishida, K., Yagisawa, F.,

Yoshida, Y., Fujiwara, T., Kuroiwa, H., and Kuroiwa, T. (2009). Expression of the Cyanidioschyzon merolae stromal ascorbate peroxidase in Arabidopsis thaliana enhances thermotolerance. Plant Cell Rep. 28,

1881–1893. S6. Mori, T., Kuroiwa, H., Higashiyama, T., and Kuroiwa, T. (2006).

GENERATIVE CELL SPECIFIC 1 is essential for angiosperm fertilization.

Nat. Cell Biol. 8, 64–71. S7. Mori, T., Hirai, M., Kuroiwa, T., and Miyagishima, S.Y. (2010). The functional

domain of GCS1-based gamete fusion resides in the amino terminus in plant

and parasite species. PLoS One. 5, e15957. S8. Escobar-Restrepo, J.M., Huck, N., Kessler, S., Gagliardini, V., Gheyselinck,

J., Yang, W.C., and Grossniklaus, U. (2007). The FERONIA receptor-like

kinase mediates male-female interactions during pollen tube reception. Science. 317, 656–660.

S9. Igawa, T., Yanagawa, Y., Miyagishima, S.Y., and Mori, T. (2013). Analysis of

gamete membrane dynamics during double fertilization of Arabidopsis. J. Plant Res. 126, 387–394.

S10. Wang, D.Y., Zhang, Q., Liu, Y., Lin, Z.F., Zhang, S.X., Sun, M.X., and

Sodmergen. (2010). The levels of male gametic mitochondrial DNA are highly regulated in angiosperms with regard to mitochondrial inheritance. Plant Cell. 22, 2402–2416.