Chemistry & Biology, Volume 20

Supplemental Information

A Small Molecule Inhibitor

of the BLM Helicase Modulates

Chromosome Stability in Human Cells

Giang Huong Nguyen, Thomas S. Dexheimer, Andrew S. Rosenthal, Wai Kit Chu,

Dharmendra Kumar Singh, Georgina Mosedale, Csanád Z. Bachrati, Lena Schultz,

Masaaki Sakurai, Pavel Savitsky, Mika Abu, Peter J. McHugh, Vilhelm A. Bohr,

Curtis C. Harris, Ajit Jadhav, Opher Gileadi, David J. Maloney, Anton Simeonov, and

Ian D. Hickson

Inventory of Supplemental Information

Figures S1-S4 refer to main Figures 1-4, respectively. Table S1 is related to Results. Table S2 is related to Experimental Procedures and is a list of oligonucleotides used in the study.

SUPPLEMENTAL INFORMATION - FIGURES

Figure S1: Refers to Figure 1. (A) Principle of the HTS assay. See text for details. (B)

Representative time-course data demonstrating forked duplex unwinding obtained with

the miniaturized assay at 4 L/well (N=64). Data are expressed as relative fluorescence

units (RFU). (C) Calculated Z’-values, the standard statistical parameter for evaluating

HTS methods, are indicated for each plate from the robotic high-throughput screen

(347,967 compounds). (D/E/F) Effect of ML216 on the ability of BLM (10 nM) to

disrupt a synthetic Holliday junction (D), a G-quadruplex (E) and a mobile D-loop (F).

Reactions lacking BLM (-BLM), lacking ML216 (-Cmpd) and containing 2

concentrations of ML216 (10+50 μM) are shown in each case. The substrates and

reaction products are depicted diagrammatically on the right of each panel.

Figure S2: Refers to Figure 2. (A/B) Effect of ML216 on binding of DNA to BLM assayed by EMSA. [32P] end-labeled single-stranded (A) or forked duplex (B) DNA was incubated with BLM636-1298 in the absence (lanes 1) or presence (lanes 2-12) of increasing concentrations of MLS216. The reactions were then analyzed by non-denaturing gel electrophoresis; the positions of free and protein-bound DNA are indicated on the left of each panel. Binding of the long (2 x 50 nt) forked substrate to BLM (panel B) results in a distribution of shifted bands, which may derive from different binding positions for BLM on the DNA and/or different numbers of BLM molecules per DNA fragment; however, all bands are similarly inhibited by ML216. The upper bands in both panels are probe molecules in the wells, possibly trapped with aggregated protein. The concentrations of inhibitor in the duplicated lanes 2-12 are, respectively: 0.25, 0.5, 1.0, 2.0, 4.0. 8.0, 16.0, 31.3, 62.5, 125, and 250 µM. Lanes 13 contained no BLM protein. (C) Inhibition of the ssDNA-dependent ATPase activity of BLM by ML216. Lineweaver-Burk plot from which a calculated (non-competitive) Ki of 1.76±0.26 M was derived.

C

Figure S3: Refers to Figure 3. (A) Effects of ML216 on SCE levels after a short-term exposure. PSNF5 cells were untreated (-) or treated (+) with ML216 for 8 hours, as indicated below the bars, and the number of SCEs per chromosome was determined. The horizontal bar indicates the mean number of SCEs/chromosome. (B) Representative examples of immuno-fluorescence staining for -H2AX in PSNF5 and PSNG13 cells exposed either to DMSO or 12.5 M ML216 for 48 hours followed by treatment in all cases with 50 ng/ml MMC for 12 hours.

A

B

PSNF5 PSNG13

DMSO ML216 DMSO ML216

Figure S4: Refers to Figure 4. ML216 equally affects WRN+ and WRN- cell proliferation and aphidicolin sensitivity. (A/B) Effects of different concentrations of ML216, as indicated, on the rate of cell proliferation in GM00637 (WRN+, panel A) and AG11395 (WRN-, panel B) cells. Data represent the means of 3 independent experiments. Error bars: SD. At no time point was there a significant difference in the proliferation of the 2 cell lines (p>0.05). (C) Survival curves derived from clonogenic assays are shown for each cell line, as indicated) in the absence or presence of ML216. Cells were exposed to ML216 for 24 hours before aphidicolin was added at the concentrations indicated and the cells were incubated for a further 24 hours. Cells were then washed and incubated in drug-free medium for up to 12 days to allow individual colonies to form. Points represent the average of 3 independent experiments. Error bars: SD.

SI Tables

Table S1. Dose-response curves of potential BLM inhibitors from the primary screen.

Structure Compound ID HTS Concentration

Response Curve

MLS000559245

MLS000416789

MLS000325120

MLS000032669

MLS000775324

MLS000673043

Table S2. Sequences of oligonucleotides used in this study.

Name Oligonucleotide Sequence (5' to 3')

A1 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCGTACCCGATGTGTTCGTTC

A2 GAACGAACACATCGGGTACGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT

A3 GACGTCATAGACGATTACATTGCTAGGACATGCTGTCTAGAGACTATCGC

A4 GCGATAGTCTCTAGACAGCATGTCCATGCAAGCCAGAATTCGGCAGCGTC

A5 GACGCTGCCGAATTCTGGCTTGCTAGGACATCTTTGCCCACGTTGACCCG

A6 CGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTC

A7 GCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGT

A8 ACTGTCGTACTTGTATTTTGGGGTTTTGGGGAATGTGA

A9 CAACCACATGAACGTTGAGGTATCCTGGAAGCTGATATT

SI: EXPERIMENTAL PROCEDURES

Expression and purification of truncated BLM protein in E. coli

A cDNA fragment of BLM encoding residues 636-1298 (spanning the helicase, RQC and

HRDC domains) was amplified by PCR and cloned into the pET based expression vector

pNIC-NHT-CTB (Genbank ID JQ280450). The resulting ORF contained an N-terminal His6

tag (MHHHHHHSSGVDLGTENLYFQ*SM) and C-terminal biotinylation tag

(SENLYFQ*SGGGLNDIFEAQKEWHE), both cleavable by TEV protease (the cleavage

sites are indicated by asterisks). The expression plasmid was introduced into expression

strain BL21(DE3)-R3-pRARE (Savitsky et al. 2010, J. Struct. Biol. 172:3-13). A 10-mL

overnight culture in Terrific Broth (TB; Merck) containing 50 g/mL kanamycin and 34

g/mL chloramphenicol was used to inoculate 1 L of TB/kanamycin in an 2.5-L Ultrayield

baffled flask (Thomson Scientific). The culture was grown at 37°C to OD600 = 3. The

temperature was reduced to 18°C, and IPTG was added to 0.2 mM, followed by overnight

incubation at 18 °C. Frozen cell pellets were extracted by sonication in lysis buffer (50 mM

Hepes (pH 7.5), 0.5 M NaCl, 5% glycerol, 1 mM TCEP) supplemented with protease

inhibitors and benzonase nuclease (Novagen). The supernatant was clarified by

centrifugation (30 min, 30,000 g) and loaded on a 5-mL Ni-IDA (Generon, UK) gravity flow

column. The column was washed with 100 ml of lysis buffer containing 30 mM imidazole

and eluted with 25 ml of elution buffer (lysis buffer containing 250 mM imidazole). The

eluted fraction was then diluted with an equal volume of water and loaded on 5 ml Heparin

column (GE Healthcare) on an AKTA Purifier system at 4 ml/min and eluted with a linear

gradient of NaCl (0.15 – 1.0 M). Fractions containing BLM were combined and purification

tags were cleaved by His10-tagged TEV protease (at 1:50 w/w ratio) overnight at 4°C. TEV

protease and some impurities were removed by passing the solution through 2 ml of Ni-IDA

(30 mM imidazole was added to prevent nonspecific binding). The flow through fraction

was collected, concentrated to 5 ml using centrifugal ultrafiltration (50-kDa MWCO;

Centricon) and loaded on a S200 HR 16/60 gel filtration column equilibrated with gel

filtration buffer (10 mM Hepes, pH 7.5, 0.5 M NaCl, 5% glycerol). Fractions were collected

automatically using an AKTA Purifier system. Fractions containing BLM protein were

combined, divided into 500 l aliquots and flash frozen in liquid nitrogen. Typical yield was

40 mg of BLM from 1L of TB media.

BLM high-throughput screening assay

The screening for inhibitors of BLM activity was conducted using a quantitative, high-

throughput approach (Inglese et al., 2006). For this, a forked duplex DNA substrate [20-bp

duplex with 30-nt oligo(dT) tails], which harbored a tetramethylrhodamine fluorophore

(TAMRA) at the 3'-end of one strand (SI Table 1, A1) and a non-fluorescent ‘Black Hole

Quencher-2’ (BHQ-2) at the 5'-end of the complementary strand (Table 1, A2). An increase

in the fluorescence intensity as a result of the ATP-dependent unwinding of the duplex

region by BLM was used to measure helicase activity. The screening protocol was as

follows: Three µL of BLM (10 nM) in a reaction buffer containing 50 mM Tris-HCl (pH

8.0), 5 mM NaCl, 2 mM MgCl2, 1 mM DTT, 0.01% Tween-20, and 2.5 µg/ml poly(dI-dC)

were dispensed into 1536-well Greiner black solid bottom plates. Compounds (23 nL) were

transferred to the plates via a Kalypsys pintool and the reactions were incubated for 15 min

at room temperature. Next, 1 µL of substrate solution (200 nM forked duplex and 2 mM

ATP) was added to start the reaction. The plates were immediately transferred into a

ViewLux High-throughput CCD imager (Perkin-Elmer) in order to measure the reaction

progress in a discontinuous kinetic mode (two reads spaced one hour apart, with

intermediate room temperature incubation of the covered assay plate) using a 525 nm

excitation and a 598 nm emission fluorescence protocol. The fluorescence intensity

difference between the two reads was used to compute reaction progress. NCGC00094975

(ellagic acid) was used as an inter-plate control at a two-fold, 16-point dilution in duplicate

to produce final concentrations in the range 5.75 µM to 0.175 nM. The results of the high-

throughput screen were deposited in PubChem; assay ID 2528 (pubchem.ncbi.nlm.nih.gov).

Preparation of radiolabeled substrates

For each substrate, a single oligonucleotide was 5′-end-labelled with [γ-32P] ATP

(Amersham Biosciences, Chalfont St. Giles, UK) using T4 polynucleotide kinase (New

England BioLabs, Beverly, MA). The forked duplex, X12 four-way junction (Holliday

junction), D-loop, and G4 DNA substrates were generated as described previously

(Mohaghegh et al., 2001; Sun et al., 1998; Bachrati et al., 2006). Briefly, for the forked

duplex and the Holliday junction substrates, the 5’-end-labeled A3 oligonucleotide was

annealed to unlabeled A4 or A4, A5, and A6 oligonucleotides (Table 1), respectively, by

incubation at 100 °C for 3 min followed by slow cooling to room temperature. The plasmid-

based D-loop substrate was generated by RecA catalyzed strand invasion of the 5’-end-

labeled A7 oligonucleotide (Table 1) into a supercoiled pUC18, as described previously

(Bachrati et al., 2006). Formation of G4 DNA was carried out as described previously using

the 5’-end-labeled A8 oligonucleotide (Table 1) (Mohaghegh et al., 2001). Prior to use,

each substrate was gel-purified and then dialyzed against either TM buffer (10 mM Tris–

HCl, pH 7.5, 10 mM MgCl2) for forked duplex, Holliday junction, and D-loop substrates or

TEN buffer (10 mM Tris–HCl, pH 8.0, 1 mM EDTA, 100 mM NaCl) for G4 DNA. After

dialysis, the concentration of the labeled substrate was determined using scintillation

counting (Beckman LS 5000CE).

DNA helicase activity measured by gel electrophoresis of radiolabeled DNA

Initial screening hits were validated by a standard assay for measuring DNA helicase

activity, which utilizes gel electrophoresis to monitor the BLM-mediated unwinding of a

radiolabeled, partial duplex DNA substrate. Helicase assays were carried out in a 100 μL

reaction volume containing no more than 1% DMSO, with the inhibitors being added in a 1

μL volume. Assays using a number of DNA helicases (BLM, UvrD, RECQ5, and RECQ1)

were carried out in a reaction buffer containing 20 mM Tris–HCl, pH 7.5, 2 mM MgCl2, 2

mM ATP, 0.1 mg/ml BSA, 1 mM DTT. Optimal substrate and enzyme concentrations, as

well as reaction times, were determined empirically. All reactions were performed at 37oC,

and were terminated by the addition of loading buffer containing 20 mM EDTA and 2.5%

bromophenol blue. Reaction products were separated on 10% neutral gels in 1× TBE at 30

mA for 1 h at 4°C. The gels were then vacuum dried at 80°C for 1 h, and the radioactive

DNA was visualized by autoradiography (Storm 840 PhosphoImager). Quantitative results

were expressed as percent unwinding normalized to the untreated (taken as 0%) and

denatured DNA (100%) control samples. Enzyme concentrations required for 50% substrate

unwinding, and inhibitor concentrations required for 50% enzyme inhibition (IC50 values)

were determined using a non-linear regression model using GraphPad software.

DNA helicase activity measured by gel electrophoresis of fluorescently labeled DNA

A gel-based assay employing a fluorescently labeled, forked duplex DNA substrate was also

utilized to ascertain SAR values for selected inhibitors. The forked duplex substrate was

prepared by annealing the 3’-TAMRA-labeled A1 oligonucleotide (Table 1) with the

unlabeled complementary strand, A2 (Table 1). A standard 20 µl reaction contained 50 mM

Tris-HCl (pH 7.5), 50 mM NaCl, 2 mM MgCl2, 2 mM ATP, 1 mM DTT, 0.1% Tween-20

and 200 nM TAMRA-labeled forked duplex substrate. The reactions were initiated by the

addition of BLM protein to a final concentration of 5 nM. Following incubation at room

temperature for 30 min, the reactions were terminated by the addition of loading dye

containing 5% glycerol, 2 mM EDTA, and 2.5% bromophenol blue. Reaction products were

then separated on 15% non-denaturing polyacrylamide gels in 1x TAE, and the DNA was

visualized using the Bio-Rad ChemiDocTM XRS Gel Imager.

Florescence polarization (FP) assays

Equilibrium binding of DNA helicases to TAMRA-labeled oligonucleotides was monitored

by fluorescence polarization in 384-well plate format (Greiner, black solid bottom). Serial

dilutions of selected inhibitors were mixed with the indicated amounts of DNA helicase and

the TAMRA-labeled oligonucleotide (Table 1, A1) in a binding buffer containing 50 mM

Tris-HCl (pH 7.5), 50 mM NaCl, 2 mM MgCl2, 1 mM DTT, and 0.1% Tween-20. ADP or

ATP was added as indicated to a final concentration of 2 mM. Following incubation at

room temperature for ~2 hr, plates were read on a ViewLux High-throughput CCD imager

(Perkin-Elmer) using the polarization filter set, with excitation and emission wavelengths of

525 and 598 nm, respectively.

Electrophoretic mobility–shift assays (EMSA)

A 5’-[32P] labeled single-stranded oligonucleotide (A9 in table S1) and a radiolabeled forked

duplex (oligonucleotides A1 and A2) were prepared as described above. Binding reactions

contained 160 nM of protein in 10 μl of binding buffer containing 5% glycerol. Inhibitor

dilutions were added in 0.5 µl of DMSO; after 10 minutes at room temperature, labeled

DNA (10 nM of ssDNA or forked duplex) was added, and incubation continued for 15

minutes. Free and protein-bound DNA were separated by electrophoresis on 8%

polyacrylamide (19:1) gels in TBE buffer at 4°C. The gels were exposed to a Screen-K

phosphorimaging screen and quantitated using a Bio Rad Personal Molecular Imager

system.

Proliferation Assays

2,500 cells were seeded into each well of a 96-well culture plate. The cells were incubated

overnight and were then treated with BLM inhibitors at the concentration indicated for 24,

48, and 72 hrs. At each time point, the WST-1 reagent (Roche Applied Science, Burgess

Hill, UK) was added at a 1:10 dilution for 4 hours at 37°C in 5% CO2. WST-1 is a pale red

tetrazolium salt that can be cleaved to the dark red formazan dye by mitochondrial

dehydrogenases. Because differences in cell number correlate directly with the quantity of

mitochondrial dehydrogenases available to cleave WST-1, the color intensity provides a

reliable indication of relative cell number. The 96-well plates were then analyzed optically at

450 nm with a reference wavelength of 690 nm using a Bio-Rad Benchmark microplate

reader. To confirm the results of WST-1 assay, cell numbers were also directly determined

in a selected subset of experiments by direct counting using a hemocytometer.

Clonogenic survival assays

Clonogenic growth assays were used to determine the capacity of cells to resist killing by

cytotoxic agents. 200/500 cells were seeded into 60 mm cell culture plates containing culture

medium and either a BLM inhibitor or DMSO. After the 24 hours, cells were treated with

aphidicolin for a further 24 hours before washing in PBSA and growth in fresh media.

Twenty days later, cells were stained (0.1% Coomassie Blue R250, 50% methanol, 7%

acetic acid in H2O) and colonies were counted (Stuart Scientific Colony Counter). Colonies

larger than 50 cells were counted at low magnification as survivors, and the number of

colonies at each time point or drug dose was expressed as a percentage of the colony number

in the untreated control sample.

Sister chromatid exchange analysis

PSNG13 or PSNF5 cells were incubated with medium containing 10μg/mL BrdU for 36

hours, followed by treatment with BLM inhibitors or DMSO for a further 36 hours.

100ng/mL KaryoMAX Colcemid (Gibco, Paisley, UK) was added for the final 30 min of the

treatment period. One hundred metaphase nuclei were scored for each analysis using a

Nikon Eclipse 80i microscope equipped with Lucia G software (Laboratory Imaging,

Prague, Czech Republic). Differences in the distribution of SCEs were compared for

statistical significance using a paired t-test.

Fluorescence microscopy

PSNG13 and PSNF5 cells were treated with either DMSO or ML216 at the concentrations

described for 48 hours before exposure to mitomycin C for a further 12 hours. Cells were

then fixed and permeabilized using 4% paraformaldehyde and ice-cold 70% ethanol.

Nonspecific antibody binding was blocked using 8% bovine serum albumin in PBS. Fixed

cells were stained for 2 hours at room temperature with a specific primary antibody (in 1%

bovine serum albumin at 4°C) and then with appropriate, fluorescently labeled secondary

antibodies (Invitrogen) for 1 hour at room temperature. The primary antibody for γ-H2AX

was obtained from Upstate (anti-mouse; 05-636). Slides were mounted using Vectashield

mounting liquid (Vector Labs) and sealed. Immunofluorescence microscopy was performed

using a Nikon Eclipse 80i fluorescence microscope. Images were processed using Adobe

Photoshop (Adobe Systems Inc.). 4′,6-diamidino-2-phenylindole (DAPI) staining was used

to define the location of cell nuclei.

DNA-dependent ATPase activity

20-µl reactions contained BLM636-1298 protein (0.2 – 4 nM) in a reaction buffer consisting

of 50 mM Tris-HCl, pH 7.5, 50 mM NaCl, 2 mM MgCl2, 1 mM DTT, 0.01% tween 20,

0.1 mg/ml BSA, 5 nCi/µl [γ-32P]-ATP, and varying concentrations of unlabeled ATP (4-

2000 µM) and the inhibitor ML216. All reactions except negative controls contained 200

nM of a 50-nt oligonucleotide (A2, table S1). The reactions were incubated at 37°C.

Aliquots (1 µl) were taken at 10, 15, 20 and 30 minutes and spotted on a thin-layer

chromatography sheet (TLC PEI Cellulose F, Merck, cut to 6.6 x 20 cm strips). The sheets

were developed with 0.5 M LiCl, 1.0 M formic acid and exposed to a phosphorimager

screen (Kodak K). The spots corresponding to ATP and inorganic phosphate were

quantitated. Reactions were performed in triplicate, combining data from different enzyme

concentrations to ensure that less than 25% of the substrate was consumed. The data was

analyzed using GraphPad Prism; inhibition analysis using noncompetitive or mixed-mode

inhibition models gave similar results. The reaction in absence of ssDNA was not

detectable under the conditions used.

Chemistry Methods

Unless otherwise stated, all reactions were carried out under an atmosphere of dry argon or

nitrogen in dried glassware. Indicated reaction temperatures refer to those of the reaction

bath, while room temperature (rt) is noted as 25oC. All solvents were of anhydrous quality

purchased from Sigma Aldrich Chemical Co. and used as received. Commercially

available starting materials and reagents were purchased from Sigma Aldrich and were

used as received. Analytical thin layer chromatography (TLC) was performed with Sigma

Aldrich TLC plates (5 x 20 cm, 60 Å, 250 µm). Visualization was accomplished by

irradiation under a 254 nm UV lamp. Chromatography on silica gel was performed using

forced flow (liquid) of the indicated solvent system on Biotage KP-Sil pre-packed

cartridges and using the Biotage SP-1 automated chromatography system. 1H- and 13C

NMR spectra were recorded on a Varian Inova 400 MHz spectrometer. Chemical shifts

are reported in ppm with the solvent resonance as the internal standard (CDCl3 7.26 ppm,

77.00 ppm, DMSO-d6 2.49 ppm, 39.51 ppm for 1H, 13C respectively). Data are reported as

follows: chemical shift, multiplicity (s = singlet, d = doublet, t = triplet, q = quartet, brs =

broad singlet, m = multiplet), coupling constants, and number of protons. Low resolution

mass spectra (electrospray ionization) were acquired on an Agilent Technologies 6130

quadrupole spectrometer coupled to the HPLC system. High resolution mass spectral data

was collected in-house using an Agilent 6210 time-of-flight mass spectrometer, also

coupled to an Agilent Technologies 1200 series HPLC system. If needed, products were

purified via a Waters semi-preparative HPLC equipped with a Phenomenex Luna® C18

reverse phase (5 micron, 30 x 75 mm) column having a flow rate of 45 mL/min. The

mobile phase was a mixture of acetonitrile (0.025% TFA) and H2O (0.05% TFA), and the

temperature was maintained at 50oC.

Samples were analyzed for purity on an Agilent 1200 series LC/MS equipped with a Luna®

C18 reverse phase (3 micron, 3 x 75 mm) column having a flow rate of 0.8-1.0 mL/min over

a 7-minute gradient and a 8.5 minute run time. Purity of final compounds was determined to

be >95%, using a 3 µL injection with quantitation by AUC at 220 and 254 nm (Agilent

Diode Array Detector).

Preparation and Characterization of ML216

A mixture of 5-(pyridin-4-yl)-1,3,4-thiadiazol-2-amine (0.10 g, 0.56 mmol) and 1-fluoro-4-

isocyanato-2-(trifluoromethyl)benzene (0.07 ml, 0.47 mmol) was dissolved in DMF (2 ml)

and stirred at 90ºC for 1 hour. The solution was allowed to cool and was quenched with

water (1 ml). The resulting precipitate was filtered and washed with water (3 ml), ethyl

acetate (3 ml) and acetone (3 ml) to yield pure 1-(4-fluoro-3-(trifluoromethyl)phenyl)-3-(5-

(pyridin-4-yl)-1,3,4-thiadiazol-2-yl)urea. Yield: 0.083 mg (46%). LC-MS: rt (min) = 3.13

(short), 4.49 (long); 1H NMR (400 MHz, DMSO-d6) δ 9.45-9.65 (m, 1H), 8.69-8.77 (m,

2H), 8.02-8.11 (m, 1H), 7.83-7.91 (m, 2H), 7.70-7.82 (m, 1H), 7.49 (s, 1H); HRMS (ESI)

m/z (M+H)+ calculated for C15H10F4N5OS, 384.0551; found 384.0549.

Characterization of MLS000559245

LC-MS: rt (min) = 3.14 (short), 4.61 (long); 1H NMR (400 MHz, DMSO-d6) ppm 9.42-

9.74 (m, 1H), 8.76 (d, J=4.70 Hz, 2H), 7.94 (d, J=5.09 Hz, 3H), 7.58 (d, J=8.80 Hz, 1H),

7.44 - 7.51 (m, 1H); HSMS (ESI) m/z (M+H)+ calculated for C14H10Cl2N5OS, 366.0000;

found 365.9985.

Supplementary Reference

Inglese, J., et al. (2006). Quantitative high-throughput screening: a titration-based approach

that efficiently identifies biological activities in large chemical libraries. Proc. Natl. Acad.

Sci. U S A 103, 11473-11478.