Suburban Edition 01/11/16

Q

M

Top sports stories for 2015See page 14

Th

eServing More Than 33,000 Homes & Businesses in 4 Countiesh

Ph 33 000 H & B i i 4 C tih

RESS

Since 1972

““

uoteof The Week

John SzozdaSee page 8

Christmas wish comes trueSee page 10

Continued on page 2

Continued on page 2

January 11, 2016 FREE

...she and her boys joined the “league of forgotten victims”

Levy renewalup fi rst forWoodmore

City projects revenue growth

3239 Navarre Ave. Oregon. 419-693-4311 Fax 419-693-5005Mon, Tues, Wed, Fri. 10am-6pm, Thurs. 10am-8pm, Sat. 10am-5pmfrom $899

StorytimeHayes Eiden, age 3, enjoys a story about freight trains read by Children's Librarian Victoria Forgette at the Walbridge Branch Library. Family storytime is held on Tuesdays at 11:00 am. (Press photo by Ken Grosjean)

By Kelly J. KaczalaPress News [email protected]

Oregon City Council last month ap-proved the 2016 municipal budget with a General Fund total of $20,843,868. Income tax revenue this year is pro-jected to be “substantially higher” than the income tax revenue collected last year, according to City Administrator Mike Beazley. “For 2015, we projected an approxi-mate 3 percent income tax growth over 2014 budgeted revenues. Even with a weak December, we will comfortably exceed the income tax revenue estimate,” said Beazley, adding that it is over $21 million. “The work scheduled at our major in-dustrial employers and the ongoing con-struction at Oregon Clean Energy should keep income tax revenue strong through 2017. Due to the unknowns associated with the changes in the tax code, I believe a more conservative estimate is the respon-sible course of action at this time,” he said. “Consistent with the course we chart-ed over the past two years, we will con-tinue to focus on investment in the city’s infrastructure and on capital investments that can improve services or lower our long-term operating costs and help ensure that Oregon is prepared for the next fl uc-tuations in our cyclical economy,” said Beazley.

“The steps the city took in the past to move toward structural balance coming out of the recession and to deal with changes in state funding practices have allowed us to keep our overhead lower and make it easier to deal with operating challenges during the year. We expect to be able to success-fully continue the Oregon practice of a high level of local government services in 2016,” he said. Status quo The 2016 budget calls for the city to maintain the status quo on the operating side except for the addition of two staff positions in the public service department that was approved in last year’s budget pro-cess to help the city meet service needs and to responsibly manage many pending capi-

tal projects, according to Beazley. “Capital investment over the last sev-eral years should allow us to considerably reduce our energy consumption in the up-coming year. New pumps and blowers at the wastewater plant, variable speed pumps at the water treatment plant, and new light-ing, HVAC and geothermal systems at our administrative complex should allow us to reduce our energy costs by hundreds of thousands of dollars a year. As these sys-tems are new, we will wait to reduce the budget estimates in these categories until after we have a year’s experience with the new systems, but we are excited about the long-term savings opportunities. We have not budgeted for lower gasoline and diesel fuel costs but anticipate savings in those categories as well.” Public safety continues to be the top General Fund spending priority with po-lice, fi re and courts accounting for the majority of the General Fund spending, according to Beazley. “The budget does already include considerable funding for needed fi re safety equipment. The police budget this year also includes continued investment in our fl eet and an investment in our facilities to better facilitate depart-ment operations.” “In 2016, we will continue our focus on investment in our street, water, sewer, drainage, and facility infrastructure,” said Beazley. “During the recession and the

Our stronger cash position will continue to allow us to invest in the range of $1 million to $2 million a year...

By Larry LimpfNews [email protected]

With a levy renewal request headed for the March ballot, members of the Woodmore school board Tuesday organized for 2016 and informally discussed what they see as priorities for the school district. Members selected incumbent Joe Liszak as the board president and Sam Preston, who was elected to the board in November, as vice president. Liszak on Wednesday told The Press he would like to see more input from the public and said the board will have to dem-onstrate “fi scal responsibility and viability” to gain the public’s trust and garner support for the upcoming levy renewal. The levy, originally approved by voters in May 2011 as an emergency measure, gen-erates about $600,000 annually. “I think all of us on the board will try to build the trust of the public,” Liszak said. “We have an emergency levy coming up that we need to pass. We want the public to know the board is committed to transpar-ency and that we’ll work hard to make sure our fi nances stay where they’re at so we’re not coming back to them for more money. Last May, voters rejected a ballot re-quest for an earned income tax that would have generated about $1.05 million annu-ally over 10 years and a renewal request for the property tax that will likely be on the March ballot. Preston said he also would like the board to soon have a clearer picture for the public of the district’s fi nancial situation. The results of a special audit may be completed by next month, he said. “I think there is immense potential on this school board. Especially if we operate above the table on everything we can. We have a supportive public and they’ve had to swallow real hard the past couple years just because our situation, especially fi nan-cially, was very ambiguous,” he said. Sean Rizor, who won a board seat in the November election, said he wants the board to clarify policies and rules, includ-ing those covering personnel evaluations, and as chairman of the community rela-tions committee wants the district to be

2 THE PRESS JANUARY 11, 2016

Continued from front pageOregon

““

years leading up to it, Oregon under-invest-ed in our infrastructure, and the projects that are underway now and that are sched-uled in our long-term capital plan should allow Oregon to responsibly meet our fu-ture capital needs. Our stronger cash posi-tion will continue to allow us to invest in the range of $1 million to $2 million a year on our streets program, allowing us to pro-vide for the largest roadway investment in our history for several years.” In addition, the city is spending up to $1 million annually on a waterline replace-ment program and will continue to upgrade facilities to meet lower long-term costs and service needs. “These projects are in addition to our much discussed upgrades at the water and sewer plants. Also, continuing at the wa-ter treatment plant will be the upgrade to our intake system that will be paid for by the Oregon Clean Energy and our partner-ship on Cedar Point Road with BP Husky Refi nery,” said Beazley. Navarre safety The city will be moving forward with its Navarre/State Route 2 Safety Grant ex-penditures and will make decisions about the betterments and beautifi cation pro-gram. “The city has budgeted $1 million to help make our primary business corridor more attractive,” said Beazley. An upgrade in recreational facilities is also expected this year. “It’s one of the things we continue to look at each year,” said Beazley. “Do we have the facilities to meet the needs of the community? I think we’re going to take some steps to upgrade the playground equipment in South Shore Park. We’re also looking at putting in practice baseball dia-monds on land the city already owns di-rectly east of the municipal complex. It’s not expensive to add those things.” Other areas the city will focus on are: • Lakefront access. The city hired a consultant to conduct an analysis of lake-front development. Hearings are planned to allow community input. • Navarre Avenue/Dustin Road Area zoning overlay. Over the last year, the city has discussed possible approach-es to put Oregon in a better position to provide for future development in the Navarre/Dustin corridor. Early this year, the city will ask the economic develop-ment committee to explore some possi-ble approaches creating a zoning overlay district that could help achieve objec-tives, according to Beazley. Beazley noted that the city will re-ceive less funding from the state and federal governments for local capital and service needs that continue to decline in most categories. “Historically, we could rely on federal or state grants more often for equipment for our life support vehicles, our safety equip-ment such as bulletproof vests and CDBG dollars to meet a variety of needs. Funds in all of these categories have either disap-peared or are in decline,” he said. “Changes in these areas will be noticed this year and will be felt more in the future.”

Ringing in the new yearAssistant activities director Beth Kruzel, and other volunteers, set up displays for a New Year's party at the Little Sisters of the Poor. Residents enjoyed live music, food, and a raffl e for prizes. (Press photo by Ken Grosjean)


Flint, Michigan residents have been under siege since last year when high lev-els of lead found in their drinking water, which was drawn from the Flint River. The city, which switched from the Detroit water system to the Flint River as a drinking water source to cut costs, recon-nected to the Detroit water system last year after it was determined that the corrosive river water was drawing lead from aging pipes. Just last week, Michigan Gov. Rick Snyder declared a state of emergency in Flint due to the lead in the drinking water. At an Oregon City Council meeting last month, Councilwoman Sandy Bihn asked the city administration about the condition of Oregon’s waterlines. “I’ve been following the Flint water situation and what’s happened with their drinking water,” said Bihn at a Dec. 21 council meeting. “It just never occurred to

Bihn wants update on Oregon waterlinesme that this would be the case, but a lot of the problem there is actually in the pipes.” She noted that the source of the drink-ing water, the Flint River, was also a prob-lem. It has a history of poor water quality due to industrial pollution. “But the pipes themselves were a prob-lem. In talking with some others in our re-gion, I understand the transmission pipes can be problematic for the quality of water we all get out of our taps. At some point, we need a committee hearing or some assess-ment of that situation. It would be prudent to look into the matter,” said Bihn. Bihn, who is also executive director of Lake Erie Waterkeeper, Inc., said she re-cently watched a documentary on the wa-ter problems in Flint. “If you have a transmission pipe, and it has standing water around it, at some point the water becomes putrid, and the concrete is also impacted over time by that interac-tion. That was part of their problem. I knew the river was a problem. That’s kind of a no-brainer. But I didn’t realize that some of the problem they were having in their taps

was from what was in the pipes, and the problems of the pipes themselves in trans-mitting the water.” City Administrator Mike Beazley said he, Public Service Director Paul Roman, and Doug Wagner, superintendent of water treatment, have discussed the issue. “So much of the outcome at the tap has to do with the acidity PH level of the water, and making sure it’s in the correct range so you’re not corroding the pipes and deliver-ing that to homes,” said Beazley. “Doug is very mindful of that in our conversations. When things like that happen in Flint, we follow those things as well. At some point, in one of our hearings, maybe Doug can give an update to council.” Oregon has been very proactive in im-proving its water quality. The city will be-gin a $13 million upgrade to its water treat-ment plant that will add the use of ozone in the pretreatment process. It will be very effective in treating microcystin, the toxic algae that caused a three day tap water ban in Toledo in 2014.


Northwood’s 2016 municipal budget, passed by city council last month, projects $4,697,956 in revenue, which is $61,576 more than what was collected in 2015. The General Fund revenue is $2,456 higher than the $4,695,500 in General Fund expenditures, according to Finance Director Ken Yant. Income tax collections are estimated at $3,635,000, which are $67,800 more, or 2 percent higher, than last year. The $4,695,500 in expenditures increased by 1.2 percent, or $60,245, compared to last year’s approved budget. Seventy percent of the income tax is allocated to the General Fund, 20 percent to the Capital Improvement Fund, and 10 percent to the Capital Replacement Fund. Yant said there were few changes in this year’s budget. “As far as the operating budget, it’s pretty much status quo. Nothing much has changed,” he said. One of the biggest expenses this year will be the purchase of a fi re engine over a fi ve year period at an annual cost of $145,440, said Yant. “To pay for it, we’ll go out for fi nancing for fi ve years,” he said. Other highlights include the part-time replacement of a full time retired position in the court; the retirement replacement of

Northwood

Revenue, expenses higher this year

a patrolman in the police department; and 24/7 BLS (Basic Life Support) operations in the fi re department. In addition, the city this year will no longer provide supplemental contributions to the employees’ Health Saving Accounts (HSAs). “That’s not a high dollar item,” said Yant. “Four years ago, when the city intro-duced the HSA plans, council was offering contributions as an incentive to employees who chose that plan because the premiums were less.” The contributions were reduced in each of the four years. Road Projects This year’s budget includes capital im-provement expenditures of $574,438 for engineering and repaving of various road projects, including Bordeaux Rue resurfac-

ing and curb repairs (Curtice Road to Parc Rue), Terri Rue resurfacing and curb repairs (Bordeax Rue to Curtice Road) Brentwood Drive (Oregon Road to Maryland Place), Bihl Avenue (Woodville to Old Curtice roads), Ritter Avenue (Woodville to Old Curtice Road), Royal Avenue (Woodville to Oram roads), Tracy Road (Wales Road to Arbor Drive), Mason Street, and McNerney Place. Resurfacing of the parking lot at the municipal building totals $32,482.50. Phase II resurfacing of the parking lot at the municipal building totals $32,482.50. The cost of drainage projects on Mason Street and at the Parc Du Langlade storm pump station total $325,243. Besides the fi re engine, capital replace-ment costs include two Ford patrol SUVs, which replace 2012 Chargers, at a cost of $56,000; a dump truck in the public service department, replacing a 2001 dump truck, at a cost of $146,000; an administration ve-hicle (small SUV) that will replace a Liberty Jeep and Ford Taurus, at a cost of $24,000; and two dispatch consoles that will replace 2009 models for $30,000. The Fire Department was appropriated $10,000 from the Redfl ex fund for tactical EMS equipment. The Redfl ex traffi c camer-as were discontinued, but revenue from ci-tations that were issued remain in the fund and are used for safety improvements. The equipment will allow the fi re department to enter a “hot zone” and perform life sav-ing tasks in the event of a school shooting.

As far as the operating budget, it’s pretty much

status quo.

more innovative in how it promotes itself. The board will continue to meet the third Tuesday of the month for regular meetings. Board members Cara Brown and Corinna Bench could not be reached for comment.

Continued from front pageWoodmore

Grant workshop set The Ottawa County Community Foundation (OCCF) invites non-profi t or-ganizations located in or serving Ottawa County to submit applications for grant funding. OCCF awards grants in the fi elds of ed-ucation, social services, physical and men-tal health, safe and positive living environ-ments, natural resources, and the arts. Guidelines for grant seekers and the grant summary form can be downloaded at ottawaccf.org. Grant applications should be submitted by mail to Ottawa County Community Foundation, P.O. Box 36, Port Clinton, OH, 43452. The deadline to apply is March 15. Grant applicants are strongly encour-aged to attend a free “Grants 101” workshop being sponsored by OCCF Thursday, Jan. 28, from 8:30-11 a.m. at the Ottawa County Resource Centre, 8043 W. SR 163, Oak Harbor. Participants will learn more about the OCCF grants process. For more info go to [email protected].

THE PRESS JANUARY 11, 2016 3

SUBURBAN EDITIONThe Press serves 23 towns and surrounding townships in Lucas, Ottawa, Sandusky and Wood Counties

P.O. Box 169 1550 Woodville Rd. Millbury, OH 43447 (419) 836-2221 Fax: (419) 836-1319 www.presspublications.com 1550 Woodville Rd., Millbury, OH 43447 • 419-836-2221 • presspublications.com • Vol 44, No. 41

Thurs. Jan. 21 at 12:30 p.m. at the East Toledo Senior Center.

Code Enforcer to talk home demolition in East Toledo.

The Senior Center is located at 1001 White Street

in Navarre Park between Woodville and Navarre.

The meeting is sponsored by the East Toledo Club and is open to the public.

Cindy Geronimo, commissioner of the division of code enforcement for the City of Toledo, will update East Toledoans about code

enforcement and demolitions of dilapidated homes in East Toledo.

Geronimo says the number of homes demolished in East Toledo funded from a state grant will total 190 from April, 2014 to June 2016.

419-693-3000

New Year

New Car

New Image!

New Year

New Car

New Image!

See Scott Lawson

for a Great Dunn Deal!

419-250-5218

Oregon, OH dunnchevybuick.com

PRESSThe

Metro Suburban Maumee Bay

P.O. Box 169 • 1550 Woodville, Millbury, OH 43447

Since

1972

Looking for a way to compliment your weight

loss program, but lack the incentive to start

walking? Try a Press walk route. (Wages

earned and calories burned will vary according

to route size). Call Jordan (ext. 32)

at 419-836-2221 or 1-800-300-6158.

MOVE IT AND

LOSE IT WITH

A PRESS ROUTE

Great Lakes debris is often ignored Sunday Fun Swims Sunday Fun Open Swims will begin at the Oak Harbor High School Pool Jan. 10. Swims are open to all B-C-S students, families, and commu-nity members. Racquetball courts will be open during swim sessions, which run 2-4 p.m. through March 6. Additional dates may be added on the district website (www.bcssd.com) if the dis-trict gets a good response. Pool admission is $1 for B-C-S students and $2 for adult district mem-bers. Racquetball courts will be open to adults only for an additional charge of $2 (limit 4 per court). A lifeguard and site director will be on site to en-sure safety. Sunday Fun events will be can-celled if Ottawa County is on a Level Two or Level Three Emergency. For info, call the B-C-S Board of Education offi ce at 419-898-6210.

Soup & chili cook-off The 11th Annual Friends of Lake Township Parks Chili & Soup Cook-off will be held Saturday, Jan. 23 at the Lake Township Administration Building, 27975 Cummings Rd. (cor-ner of SR 795 and Cummings Road). Entries must be submitted in an 8-quart electric slow cooker or elec-tric roaster. Registration will begin at noon, followed by judging at 1 p.m. Public tasting, for a donation, will be available at 1:30 p.m. A Dessert Cook-off will also be held during the event. Pre-registration is suggested. To register or for more information, call Ron Hanely at 419-392-3235. All proceeds raised will benefi t Lake Township Parks.

Memorial breakfast A memorial pancake breakfast in honor of fallen Toledo fi refi ght-ers James Dickman and Stephen Machinski will be held Sunday, Jan. 17 from 8 a.m.-1 p.m. at the Millbury Fireman’s Recreation Hall, 28410 Oak St., Millbury. Breakfast will include pancakes, eggs, sausage, applesauce and a bever-age for a donation of $6 for adults, $5 for senior citizens and $3 for children under 10. A portion of all proceeds will go to the Live Your Dream Foundation. For more info, call 419-345-6067.

Arndt offi ce hours State Rep. Steven Arndt (R-Port Clinton) will hold offi ce hours Jan. 12 from 10 a.m.-noon at the Harris-Elmore Public Library, 328 Toledo St., Elmore, and Jan. 14 from 2-4 p.m. at the Sandusky Library, 114 W. Adams St., Sandusky. Appointments are not necessary.

By Lisa Aurand Riceand Christina DierkesOhio Sea Grant Communications

Marine debris is a problem that’s easy for most people to ignore on a daily basis – but it’s not something you can ignore when it’s tangled in your trawl net, inside the stomach of the fish you catch or under your microscope in the lab.

To help address the problem in the Great Lakes, staff from NOAA’s Marine Debris Program have partnered with Ohio Sea Grant and Stone Lab on a variety of education and outreach programs that focus on preventing marine debris and minimizing its harm on the environment. Marine debris, especially plastics, has direct and indirect impacts on wildlife and the ecosystems of our oceans and other waterways.

“Marine debris is a global problem, not just an ocean problem,” explained Sarah Lowe, Great Lakes Regional Coordinator for the NOAA Marine Debris Program. “Essentially the same types of debris are found in the Great Lakes: There are the general litter-type items, there are micro-plastics problems, and there’s derelict fish-ing gear that we see in both places, so it’s really one and the same issue.”

Most plastic debris breaks down into smaller pieces, but does not fully degrade in the water. These microplastics par-ticles, which include microbeads found in personal care products like facial scrubs, are the subject of much current research because little is known about what hap-pens to them after they go down the drain or break down in open water.

“Microplastics can be ingested by wildlife,” said Lowe. “It’s been shown that fish have ingested microplastics and there’s some beginning evidence of birds ingesting plastics as well. The question then becomes what is it doing in the organ-ism once it’s ingested?”

In addition to research, education about marine debris is an important focus for both the Marine Debris Program and Ohio Sea Grant. In partnership with The Ohio State University’s Stone Lab on Lake Erie, the organizations held a free three-day workshop on marine debris for teachers and informal educators in June 2015.

The thirteen participants trawled for debris in Lake Erie and then spent time analyzing their trawling finds. With the help of lab microscopes and guidance from instructor Dr. Lorena Rios Mendoza from the University of Wisconsin-Superior, par-ticipants viewed microplastics up close.

The following day, during a fish dis-section lab led by Sarah Orlando, Ohio Sea Grant Extension educator and Clean Marinas Program manager, they used the microscopes to compare fish gills with the microplastics, judging which plastics would be filtered out and which may be ingested. Fortunately, none of the fish dissected during the workshop showed

evidence of having ingested microplastics, Orlando said.

The educators also participated in a beach clean-up at South Bass Island State Park with the Alliance for the Great Lakes and created monofilament fishing line recy-cle bins to take back to their communities.

“I think it was a good introduction to the topic for a lot of the educators,” said Lowe. “They really enjoyed the workshop and will take a lot of it back with them to use in the classroom.”

Ohio Sea Grant Education & Outreach Assistant Sue Bixler said the workshop strengthened her knowledge of the subject and helped her come up with ideas for a few educational activities she’s currently working on.

The educators who attended taught at levels from elementary school through high school, and there was even one com-munity college teacher, Lowe said. In addi-tion to the cost of the workshop, grant funding through the NOAA Marine Debris Program and Ohio Sea Grant also covered transportation for participants.

Educators in Ohio’s Ninth Congressional District will also be able to involve their students in continued efforts to educate the public about Great Lakes marine debris by participating in a public

service announcement contest launched by Congresswoman Marcy Kaptur’s office. The competition is open to students in grades 9-12, and entries close on March 1, 2016.

“The topic of marine debris has been a major component in the outreach and edu-cation efforts for Ohio Sea Grant and Stone Lab this past year, and we are very excited to be able to help co-sponsor this contest raising awareness of this important Lake Erie issue,” said Dr. Kristin Stanford, Stone Lab’s education and outreach manager.

To reach out to the general public about marine debris, NOAA and Stone Lab are collaborating on a display housed at Ohio Sea Grant’s Aquatic Visitors Center at Put-in-Bay. The display, which is still under construction, shows debris that has been found on nearby Lake Erie beaches to make visitors aware of the kinds of things that cause problems near their vacation spot, and will also emphasize what people can do themselves to avoid contributing to the marine debris issue.

“We want to make sure that we’re get-ting the message out there that prevention is key,” said Lowe. “While we definitely encourage clean-ups for debris already in the environment, keeping it from getting there in the first place is the best solution.”

Educators in Ohio State University’s Stone Lab marine debris workshop on Gibraltar Island trawled for debris in Lake Erie and analyzed their fi nds while still on the research vessel. (Photo courtesy Lyndsey Manzo/Ohio Sea Grant educator)


Awards

Peoples Choice • Judges Choice

Savory Soup • Business Category

• Dessert Award

For Pre Registration call Ron Hanely 419-392-3235. Proceeds benefit Lake Twp. Parks.

Schedule of Events

• Soup or chili registration........12:00

• Chili & Soup Judging...............1:00

• Public tasting (for donation).....1:00

• 50/50 Drawing..........................2:30

Lake Township

Chili & Soup Cook-offChili & Soup Cook-offSaturday, January 23, 2016

Entry Requirements

1. 8 qt. Electric crock pot or

electric roaster of chili or soup.

2. A great recipe

Held at Lake Twp. Administration Building,

27975 Cummings Rd.

Corner of SR 795 and Cummings Rd.

11th annual

Don’t Forget...

Dessert Cook-Off!

Wynn Road closure expected with sewer installation

Charity cyclist in the Panhandle, 4,400 miles behind him

Lu the Hippo preening for the spectators. Now I’m ready to eat...feed me!

“

“Almost every major highway features a dedicated cycling lane or has a berm

wide enough to provide you a margin

of safety while peddling along.

Al Thompson left Northwest Ohio on August 17 on a bicycle ride around the pe-rimeter of the United States in an effort to raise funds for Habitat for Humanity and Save the Children. Here is an excerpt from his blog, which you can follow by going to presspublica-tions.com and clicking on the icon on the upper right.

Happy New Year Folks:

I saw something quite strange the other day about 25 miles southeast of Tallahassee. I was mystifi ed and befuddled. I didn’t think that they existed anymore--just a thing of some storyteller’s wild imagina-tion. It had a pleasing and rounded shape, and there appeared to be trees and grass protruding from its surface. Lofty aspira-tions were its trademark. It was totally be-yond my comprehension — it was a hill! I knew not what to do about it, so as always, I proceeded on...and up. I hadn’t seen anything resembling a hill for quite some time — probably over 1,700 miles ago back in Virginia. In fact, it was quite pleasing to enter the rolling coun-tryside leading into and around Tallahassee - to pump those peddles for a while, and then sit back and enjoy the just rewards of climbing to the top of a hill. The fl ats are nice, but there is no rest for the weary cy-clist - the pedals must continue to spin, and you are the only one to spin those pedals. After leaving Dunedin, my Christmas Eve was decidedly strange — it was a rid-ing day that took me to Crystal River, but on the way I stopped off at Homossasa Springs State Wildlife Park to spend some time with Lu the Hippo. One of Lu’s favorite pastimes is to fl ing his dung at visitors. You are forewarned to beware when Lu dips his head and raises his hind end — be ready to dive for the bushes. The park is really a showcase for Florida’s natural habitats, and many of the native animal species that pop-ulate them, including three gentle resident manatees. This unusual Christmas Eve conjured up thoughts of another strange Christmas Eve 30 years ago. Jaipur, India, 1985. My riding mates Alison and Paul and I cycled out of Bombay (Mumbai) heading north-eastward toward the capital of New Delhi through the semiarid, desert like state of Rajahstan. It was near the “Pink City” of Jaipur, India, on Christmas Eve that I had my cycling accident — a seriously frac-tured elbow--although I didn’t know that until two weeks later. That night, Christmas Eve, with my arm wrapped and on ice, we all made calls home to our parents. It took about an hour to set up the call from Jaipur to Toledo, back in 1985. But it was worth it to hear the voices of my family. I didn’t tell

my parents, Ruth and Charlie, about the ac-cident I had that day, not wanting to worry them. When I talked to them again weeks later after my operation in New Delhi, my Mom said she had felt something was wrong that night — a Mother’s intuition. I fi nd myself now in the western Panhandle of Florida having crossed into the Central Time Zone. I’m actually farther west than all of you in Toledo, and almost as far west as Chicago. In fact, it’s about 2,200 miles from here to Los Angeles — half of the 4400 miles I have already tra-versed. Whereas my time in Southern Florida was blessed, for the most part, with very warm temps and sunny skies, Northern Florida and the Panhandle has been just the opposite. The last couple of days, and especially yesterday, New Year’s Eve, have been truly miserable days of riding — dark and brooding skies, in and out of rain showers, some of them quite heavy . . . tre-mendous humidity, and now falling tem-peratures. I arrived in Destin in the midst of a heavy downpour, soaked to the core. A bright spot in the otherwise gloomy ride across the Florida Panhandle was spy-

ing another heavily laden cyclist coming toward me from the opposite direction - one of the few that I have encountered on this journey. We brought our wheels togeth-er and talked. It was Jack Camino, a young man from Ecuador who has been living in Texas for about 10 years. Jack is riding for Immigration Reform, and his destination is Washington D.C. where he hopes to gar-ner support, fi nancial and otherwise. Jack told me he had been on the road for about fi ve weeks, and that he’s riding slow...and that “this is tough.” We traded cards, good wishes, and then went our separate ways. I must praise Florida for the winds; they have been for the most part favorable to me, encouraging me down the east coast, turning the corner and ushering me west-ward, and then most considerately chang-ing direction and shooting me up the west coast into the Panhandle. I also praise the infrastructure Florida has provided for cyclists. Almost every major highway features a dedicated cy-cling lane or has a berm wide enough to provide you a margin of safety while ped-dling along. Other states — especially the Carolinas - should learn from Florida.

On the social consciousness spec-trum however, Florida has much room for improvement. I think I’ve seen more Confederate battle fl ags fl ying here than in the other southern states I’ve traveled…well…South Carolina was not a shining beacon in that regard either. Outside of Perry, Florida, I passed the Taylor County Sports Complex where a huge Confederate fl ag fl uttered in the breeze - twice the size of the U.S. fl ag that fl ew nearby. This appar-ently was not private property, but a public facility — a sports complex where children and adults come to play and exercise...and exercise fair play. I believe that if I were an African American living in Taylor County, I would want nothing more than to tear that fl ag down and place it where it belongs - in a museum of history — because it IS History, in more ways than one. As I posted on Facebook, I had a bit of a media blitz while in Tallahassee. I did a radio interview with WGN out of Chicago, and a reporter from WCTV, the CBS af-fi liate in Florida’s state capital, caught up with me as I was heading west out of town into the Panhandle. Charlene, the reporter, tracked me down and did a nice report on my ride. If you are not on Facebook and missed those, here are the links:

•http://wgnradio.com/2015/12/29/mike-stephen-alan-thompson-us-perime-ter-ride-via-bicycle-for-history-and-chari-ty/ •http://www.wctv.tv/home/head-l ines/Toldeo-Ohio-Man-Biking-the-Perimeter-of-the-US-for-Charity-Stops-in-Tallahassee-363805831.html Proceeding On . . . a day at a time.

Al Thompson

Phase 1 of the Cedar Point Road trunk sewer installation in Oregon that started last Monday is expected to be completed by the end of June. The city awarded a contract to install a 24-inch trunk sanitary sewer along the west side of Wynn Road starting just north of Eagles Landing Drive and ending just south of the Wynnscape subdivision. The work will be in the existing public right of way along Wynn Road, according to

Public Service Director Paul Roman. The trunk sanitary sewer will have the capacity and depth to be extended down Cedar Point Road to the east in the future. Some sanitary sewer crossovers will be provided for future service to properties on the east side of Wynn Road that do not cur-rently have access to a sanitary sewer. The contractor for the project is Underground Utilities, Inc., of Monroeville, Ohio.

At a pre-construction meeting for the project, the contractor was told to in-sure minimal inconvenience and adverse construction conditions during the proj-ect, according to Roman. The city hired Poggemeyer Design Group, of Bowling Green, to provide a full-time project repre-sentative/inspector on the job. Motorists can expect daily road clo-sures during working hours on Wynn Road between Bay Shore Road and Cedar Point

Road so the contractor can install the sani-tary sewer along the west side of Wynn Road. The contractor will close Wynn Road to through traffi c and maintain one lane of traffi c through the work area for local traffi c with portable traffi c signals or fl aggers. Due to the nature of the project, the city recom-mends motorists avoid driving through the construction area as much as possible. The detour for vehicles is Cedar Point Road to Stadium Road to Bay Shore Road.

Common People,Uncommon Challenges

by John Szozda

50 stories of inspiration

The

RESSPMetro Suburban Maumee Bay

For your copy of John Szozda’s book, send $15 to The Press, Box 169-J Millbury, OH 43447 or call 419-836-2221.

Read about the heroes living in the homes next to you.In these 50 short stories, Press columnist John Szozda tells the stories of common people who have met uncommon challenges with vision, courage, passion and determination. These men and women include a real life Indiana Jones, the

Polish-American boy who survived gruesome medical exper-iments during WWII and the woman, once a victim of fear, who fought back against crime and founded CrimeStoppers.

Support askedfor Care-A-Van By Press Staff writer Is there support in Lake Township for the Community Care-A-Van service that provides round-trip transportation for res-idents to medical-related appointments? The township trustees Tuesday heard a brief presentation from Sue Hart-Douglas, a member of Walbridge Village Council, who asked them to consider supporting the van service and the Active Older Adults pro-gram at the Eastern Community YMCA. Richard Welling, a township trustee, said after the meeting he may prepare a res-olution for the board of trustees to consider at its Jan. 19 meeting. Hart-Douglas said the service is op-erated by a non-profi t organization. Users are asked to make donations but are not charged fees for their trips. Jeff Pettit, chairman of the board of trustees, said the board would like to deter-mine how many township residents would be interested in the service before commit-ting to it. In April 2010, the trustees approved a contribution of $2,000 to the program but Welling said last week he wasn’t sure why the township stopped its fi nancial support. He said the program had provided fi g-ures on how many residents used the ser-vice. In addition to contributions from local governments and businesses and donations from users, the service has also received funding from the United Way of Greater Toledo, which contributed $18,000 in 2015 to the service in Wood and Lucas counties, according to the agency’s website.

Lake Twp.

Pay hikes forpolice OK’dBy Larry LimpfNews [email protected]

Pay raises for patrol offi cers in the Lake Township Police Department were ap-proved Tuesday by the township trustees as part of a new three-year contract. The raises of 2.5 percent went into ef-fect Jan. 1 and will continue each year of the contract that expires Dec. 31, 2018. Under the agreement, which covers corporals and full and part-time patrol offi -cers, the employee share of monthly health care premiums will increase to 15 per cent. Under the former contract, the employee share began at 10 percent and rose to 12 and 14 percent. Police Chief Mark Hummer said the of-fi cers and administration were able to con-clude negotiations without having to bring in attorneys. “The raises are deserved,” he said. The offi cers are represented by the Ohio Patrolmen’s Benevolent Association. Chief Hummer said negotiations are underway with the bargaining unit repre-senting command offi cers. The trustees used their year-end meet-ing of 2015 to approve pay raises for other non-union employees. Raises of 2.5 percent were approved for the police chief, the police department offi ce manager, a secretary in the adminis-tration offi ce and the zoning inspector. The raises are retro-active for 2015, Richard Welling, a trustee said, and a 2.5 percent increase will also go into effect in 2016. The salary of the township administra-tor, who is also the police chief, was raised by $100 per month and the fi re chief’s sal-ary was raised to $64,500 annually starting this year. Similar pay raises for nine employ-ees who recently formed a union were ap-proved by the trustees during a meeting last month.

By Larry LimpfNews [email protected]

The Ottawa County Prosecutor is ex-panding his policy covering updates of legal issues by making them available not just to law enforcement agencies in the county but also to the public. Mark Mulligan last week said he will provide the updates – known for years in local law enforcement circles as “Mulligrams” – to local news outlets as well as police agencies. He began sending the updates to the agencies shortly after he began prosecuting cases to keep offi cers up to date on devel-opments in criminal justice. “The law is not static and justice re-quires keeping up with the latest develop-ments,” he said, adding the county’s law enforcement offi cers have come to depend on these updates as one source of current information. The most recent Mulligram pertains to 9-1-1 calls that report drunk or erratic driv-ing and stresses the importance of identify-ing the caller. A case decided last year, State v.

It was a labor of love Dec. 12 as the Sunday School students at St. John Lutheran Church in Williston helped pack care packages for soldiers. In the weeks prior, the church col-lected phone cards, Beanies Babies (the soldiers like to hand out to the kids they come across) and cash contributions. The Sunday School children colored pictures of thanks and encouragement. “The goal was to collect enough to send to 100 soldiers, we surpassed that quickly,” said Cheryl Berger, church member and chairperson for the Christian Community Life Committee, which was responsible for the collection. “With the money from our very gener-ous congregation, we were able to purchase 100 socks, 128 granola bars and some can-dy to send off to soldiers located through the website, ‘AnySoldier.com,’” Berger

Sunday School packages for soldiers a labor of love

said. “Our wish is to brighten their day, to show them we care and are keeping them in our prayers.” In total, the church sent out 11 boxes fi lled with items. In addition, during the summer, the church gathered the names of veterans in the congregation, as well as those who were related to church members. “We had a lot of fun with that and made our own ‘Wall of Honor,’” Berger said. “Now we have three

posters full hanging in our church base-ment.” The church held an ice cream social for all veterans in September, and organized the collection to support and encourage the men and women fi ghting for America’s freedom.

Bikers helping children Members of BAANC (Bikers Against Abused and Neglected Children) presented Ottawa County CASA with Christmas gifts for all of the children in out-of-home place-ments. Angel Trees were in Coffee Express, Grace United Church, Sew Much More and Gifts Galore and Waldo Pepper’s Bar and Grill. Gifts were collected and delivered to the CASA offi ce where volunteer advocates delivered those gifts to the children.

Sunday School children from St. John Lutheran Church, Williston, with care packages to send to soldiers. (Submitted photo)

“Mulligram” updates now available to publicDellagnese, involved a 9-1-1 call to police of a Range Rover being driven erratically on W. Market Street from the City of Akron toward Fairlawn. A motorist had supplied the dispatcher with a description of the vehicle, its location and the license plate number. The caller also supplied contact information so police could follow up with him. An offi cer located the Range Rover and approached the driver in the parking lot of a McDonald’s Restaurant and charged him with driving while under the infl uence of alcohol and driving with a prohibited blood alcohol content. Quoting an analysis from the Columbus City Attorney’s Offi ce, the Mulligram says when an offi cer conducts an investigatory traffi c stop and relies solely on the informa-tion provided through dispatch, “the state must demonstrate at a suppression hearing that the facts precipitating the dispatch jus-tifi ed a reasonable suspicion of criminal ac-tivity.” If the dispatch is based on informa-tion provided by an informant’s tip, “the determination of reasonable suspicion will be limited to an examination of the weight and reliability due that tip.”

Courts consider whether the informant can be classifi ed as an anonymous tipster, a known confi dential informant or an iden-tifi ed citizen informant. As a general rule, anonymous informants are “comparatively unreliable” and the tip will require inde-pendent corroboration by police. Conversely, the court ruled, “If an un-questionably honest citizen comes forward with a report of criminal activity – which if fabricated would subject him to criminal liability – we have found rigorous scrutiny of the basis of his knowledge unnecessary.” The 9-1-1 caller testifi ed the Fairlawn police did call him the next day to verify what he told the dispatcher. “…the offi cer could stop/detain the motorist based on the call because the 9-1-1 caller was an identifi ed citizen informant, the court ascribes a high degree of reliabili-ty to the information that he provided, and it need not have been supported by inde-pendent observations by Offi cer Reilly,” the analysis says. However, if the tip is non-specifi c, or lacks critical details, even if from a known caller, it will not support a stop.



EMA plans update The Ottawa County Emergency Management Agency will be hosting work sessions this month to gather in-put from the public on natural disaster planning. The work session schedule is:

• Jan. 12 – Genoa Village Hall, 10 a.m.; Oak Harbor Village Council Chambers, 2 p.m.

• Jan. 14 – Ottawa County Emergency Operations Center, Port Clinton, 10 a.m.

• Jan. 19 – Allen-Clay Joint Fire District Headquarters, 4 p.m. (Includes Allen, Clay and Harris townships)

• Jan. 14 – Carroll Township Hall, 7 p.m. (Includes Bay, Carroll, Erie, Salem and Benton townships)

• Jan. 21 – Catawba Township Hall, 7 p.m., (Includes Danbury, Portage, Catawba and Put-in-Bay town-ships)

• Jan. 20 – Rocky Ridge Fire Department, 7 p.m.

• Jan. 20 – Harris-Elmore Fire Department, 4 p.m., for Village of Elmore. For information call Fred Peterson, EMA director, 419-734-6900.

Texas man charged After being stopped in Sandusky County last month, a Texas man has been charged with transporting illegal aliens in the U.S. According to Steven Dettelbach, U.S. Attorney for the Northern District of Ohio, Arely Gonzalez-Corea, 37, Katy, Texas, was charged after having three juveniles who were in the country illegally; two from Guatemala and one from Nicaragua. The investigating agen-cy in the case is the Bureau of Customs & Border Protection Sandusky offi ce.

Special meeting Oak Harbor Village Council will hold a special meeting Tuesday, Jan. 12 at 5:30 p.m. to interview candidates for a vacant seat on village council, and to make an appointment to that seat. The meeting will be held in council cham-bers located at 146 N. Church St.

Code enforcementoffi cial to speakto East Toledoans Cindy Geronimo, commissioner of the division of code enforcement for the City of Toledo, will update East Toledoans about code enforcement and demolitions of di-lapidated homes in East Toledo Thursday, Jan 21, 12:30 p.m. at the East Toledo Senior Center. Geronimo told The Press the number of homes demolished in East Toledo fund-ed from a state grant will total 190 from April, 2014 to June 2016. The complete list and location can be found on the web-site of the Lucas County Land Bank under the Demolition Program option on the left hand side of the web page. East Toledo is classifi ed as Target Zone E. The public is invited. The talk is spon-sored by the East Toledo Club. Reservations are not needed.

At the clubs The Eastern Maumee Bay Chamber of Commerce will host its annual State of the Communities address Thursday, Jan. 28, 7:30 to 9 a.m. in the Michigan Room at ProMedica Bay Park Hospital. Expected to participate are government leaders from Oregon, Northwood, Jerusalem Township, Walbridge and East Toledo. Call Yvonne at 419-693-5580 for more information.

*** The Oak Harbor Chamber of Commerce will hold its annual member dinner Friday, Jan. 29, 6 p.m. at the Ottawa County Fairgrounds. For more information contact Valerie Winterfi eld at 419-898-0479.

*** Email items before Wednesday, noon to The Workplace at [email protected] or send to The Press, Box 169, Millbury, OH 43447.

Workplace

The Press

Church Worship GuideDeadline: Thursday 11:00 am

Lake Twp.

�� 26535 Pemberville Rd.837-5023

Between 795 & Genoa Rd. (163)

Just east of 280

Sunday School 9:00 am

Sunday Worship 10:15 am

Walbridge

See you

in church!

Trinity

Lutheran Church

412 Fremont St.

419-862-3461

Stephen Lutz, Pastor

Worship 8 am - 10:45 am

Sunday School - 9:30 am

Lutheran Church-Missouri Synod

Elmore

Pastor Mark Wentz

Northwood

1930 Bradner Rd./Corner

of Woodville & Bradner Rds.

419-836-8986

Calvary Lutheran Ch.Calvary Lutheran Ch.

Sunday School 9:00 am.

10:30 amSunday worship:8:00 am &

Wed. 7:30 p.m. Pastor Robert Noble

Every 2nd Sun. 10:30 am Praise Service

Genoa

Sunday School 9:15 am

Worship 10:30 am

Main at 4th, Genoa

Ramp & Elevator

www.genoatrinity.comPastor Cherl Matla

Trinity

United Methodist

WoodvilleSolomon LutheranChurch and School

305 W. Main St. 419-849-3600

Recovery Worship Thurs. 6:30-7:30 pm

Sunday Worship: 8 am & 10:30 am

Sunday School for all ages 9:20 am

School Open Enrollment-Nursery thru 6th grade

Pastor Kristina Ahlman

ZION UNITED

METHODIST CHURCH

ZION UNITED

METHODIST CHURCH

18045 W. William St.

419-862-3166

www.ellistonzion.com

Elliston

Breakfast 9:30am

Sunday School for all ages 10am

Worship 11am

Handicap Acces. Nursery Avail.

Sunday Worship-9:00am

Sunday School-10:15 am

Wednesday Worship-7:30pm

I M Wnspirational essage of the eek: Make Room for FaithScience and philosophy are both truly important human

endeavors. Without them, we would probably still be

stuck in the Dark Ages. And it is worth pointing out, that

science and philosophy, and indeed, all areas of learning,

give one a renewed appreciation for the wondrous

creation of which we are all a part. But, it is also important

to realize that knowledge has its limits. We might say that

knowledge is limited to the empirical realm, the realm of

experience, whereas faith takes us beyond the realm of

experience. As the great German philosopher Kant

stated in his Critique of Pure Reason, we must “limit

knowledge in order to make room for faith.” Kant was

warning the metaphysicians of his day, who incorrectly

thought that they could know about God and the super-

sensible realms of the universe, that human knowledge

simply could not extend that far. And at the same time, he

was battling the unbelief of atheists who thought that faith

was nullified by modern science. Quite to the contrary,

Kant showed that human knowledge is limited to the

empirical realm, i.e., the realm of experience, but that this

has the very important benefit of making room for faith.

So, we must make room for faith in our lives and open up

our hearts to the reality of God. He has made everything

beautiful in its time; also he has put eternity into man’s

mind, yet so that he cannot find out what God has done

from the beginning to the end. R.S.V. Ecclesiastes 3:11

Real Estate TransfersWeek ending Dec. 11

Allen Township 12-10-15 David T and Anna M Balmert to James K and Pamela S Heninger, 23959 West Walbridge Road, $240,000. 12-11-15 Paul A Johnson et al to John R and Lisa Ann Moses, 5901 North Genoa Clay Center Road, $47,000.Bay Township 12-11-15 Gary J Nickel to Dean R Beck, Lot #3 South Nickel Road, $40,000.Carroll Township 12-7-15 Robert D and Judith A Bowman to Stephen E and Annmarie Schade, 6620 North Russell Road, $210,000. 12-11-15 Derek S Talmage to John C Kuzeroski, 11241 Toussaint Portage, $7,500.Danbury Township 12-7-15 Patrick J and Linda A Whelan to H and E Albright, 5703 East Mistic Bay Blvd., $233,500. 12-8-15 Debra R Hullinger to Equity Trust Company Robert L Phiefer, 365 Erie Beach Road Lot 33, $24,000. 12-11-15 Marblehead Partners LLC to Jason W and Leslee D Millington, 409 North Lake Pine Dr. #1, $71,900. 12-11-15 Stanlene Zimmerman to Patricia A Ahrens, 361 North Lighthouse Oval, $118,000. 12-11-15 Johana Goldney to Donald R and Katherin M Reeves, 120 Perryview, $51,000. Portage Township 12-8-15 Phillip S Hart to James T and Susette M Ditz, 1760 South Douglas, $310,000. 12-11-15 Karyn C Hsnley to Emerson R and Patti A Howell, 1123 Ottawa Drive, $125,000.Put In Bay Village School 12-7-15 Blue Sky Rentals Inc. to Nicole Major, 181 Mariners Cove, $182,000.Salem Township 12-10-15 Pamela S Hoffer to Charles Lynn Danner Sr and Lillie Glenrose Danner and Frank and Monica j Mitchell, 852 South Green Bayou, $55,000. 12-11-15 Gaillard J Risch to Matt W and Sherrill E Johnson, 844 North State Route #19, $26,500

Week ending Dec. 18

Benton Township 12-17-15 Eddie D and Julie A Nolen to David A and Michelle R Ibarra, 18255 Wesr State route 163, $95,000.Rocky Ridge Corp 12-14-15 Emil Bloomfi eld to Don Lewis Miller jr, 14665 West Third Street, $82,000.Bay Township 12-16-15 Steven C Wadsworth and Kyly R Bahnsen to US Bank National Association, 1402 West Fremont Road, $76,667.

Catawba Township 12-15-15 Pappy A and Brice L Poorbaugh / Grandpa’s Cheesebarn to Kellie N and Keith E Gonya, 853 Falling Waters Blvd., $258,000. 12-16-15 Ohio Heartland Real Estate Ventures to Alan and Patricia Cerny, Waterslip Unit 113 Come Sail Away, $2,000.Salem Township 12-14-15 Robert L Ellerbush to Russell D and Lysah M Hodges, 426 Behlman Road, $95,000.Oak Harbor Corp 12-18-15 Wells Fargo Bank to Robert A Witt, 117 Bank Street, $30,500..

Week ending Dec. 31 2015 Carroll Township 12-28-15 Britt M Bowers to Eileen N Gore, 10060 Scott Street, $20,000.Catawba Township 12-28-15 W Kent and Julie A Joy to Isaac and Carly E Salines, 3665 North Karwood Drive, $180,000. 12-30-15 Robert and Keane Mahl to Edwin and Cynthia Loovis, 5232 East Blue Teal, $281,000. 12-30-15 Jane L and Cheryl Melle to Donald E Habegger and Mary O’Neill, 4540 East Marsh’s Edge, $310,000. 12-31-15 Joyce W Bohlander to Gregory Alberty, 2770 North Sanctuary $1,450,000.Genoa Corp. 12-29-15 Genoa Savings & Loan Company to Lee R Yackee, 622 Main Street, $160,000. 12-31-15 Elmer C and Barbara A Terrell to Tom Wojo, 518 Superior Street, $37,000.Danbury Township 12-28-15 John M and Brend J Wamsley to Kenneth M and Mary L Veneskey, 1091 South Englebeck Road, $129,000. 12-29-15 Mctech Corp to Tech Ready Mix Inc, 7016 East Sunview Drive, $974,500. 12-29-15 Safe Harbor Development to Robert J Koch and Angela Morehead, 5686 State Route 163 Unit B19, $69,750. 12-29-15 Safe Harbor Development to Michael T and Michelle Manion, 5686 State Route 163 UnitB20, $74,827. 12-30-15 Safe Harbor Development LTD to Ohio Outdoor Properties LLC, 5686 State Route 163 Unit B18, $110,000.Port Clinton Corp 12-31-15 Judith Carpenter to MOD Development LLC , 1010 Perry Street, $115,000.Portage Township 12-30-15 Jennifer T Riddle to Karl S Kopchak, 986 South Madison Street, $95,500.Oak Harbor Corp 12-31-15 Lisa M Wilson to Eric R and Katie L Suder, 11590 West State Route 163, $127,500.

The More You Buy, The More You Save!

Findlay Implement Co.1640 North Ridge Rd.

Findlay, Oh 45840419-424-0471

Bay Tractor & Turf4558 County Rd. 137

Gibsonburg, OH 43431419-862-3969

Northwest Tractor Co.799 State Route 224Ottawa, OH 45875

419-538-7072

Tiffin Ag & Turf2000 West County Rd 54

Tiffin, OH 44883419-447-6633

Wood County Implement13051 Kramer Rd.

Bowling Green, OH 43402419-352-4908

Wyandot Tractor10264 County Hwy. 121Upper Sandusky, OH 43402

419-294-2349

SAVE on the PARTS you need for the upcoming

year with our preseason discounts!

Please no add-ons, this must be a one time order. Cash/checkand in-house account only. Credit Card use reduce discount 3%.

Check us out online at www.FICDealerships.com

and find us on Facebook and Twitter!Like us! @FICDealerships

yy pppp

Pl no add-ons, this must be a one time ord . CC h/// hPPPPPPlllPlPlPlPlPlPP eeeelleeeelll aaaaeaeaeaeasssaaaasssseesesese no no addadd-dd-d--o-oonons,ns,s, ththhihis isi mumususstst be be a ononone ne tiitimimi eme oordorderdr erder. erer. rr. rr CCCCCCCaaaaaCCaCaCaCasssshaaaasssshhhhhh////hshshshsh///////hh////cc/c/c///c/c/c/ hhhhhhcccchhhhheeeehehehehecccceeeecccckkkkkckckckck

January 18th, 2016 - January 30th 2016

Save Order Total

10% $500-350012% $3500-650015% $6500+

If you’d like to buy now and pay later we have a deal for you.

Receive 180 Days No Payments No Interest through JDF Multi-Use programs*.

*Minimum purchase $250 subject to JDF approval see dealer for all program details.

John Deere catalog pricing during these dates. 16-000003JJJJo oo ng during these dates 16-JJJJJoooJoJoJohhhhhooohhhhnnnhhhnhnhn DDDeeeDDDeeeeeeeeeeeerreeerrreeererererr ccaaacccaaatttttatatataaattttaaallllala ooolllooll gggogogog ppprrppprrririr cciccii icinini gng dudururirinini gng ththehesesese dadaateatetesess 16-16-6--0-000000000000000000000000000000000333030303

February 2nd, 2016 – February 28th, 2016

Save Discounts

John Deere Filters 12%Sweeps 10%Coulters 10%Disc Blades 10%Batteries 10%John Deere Oil 10%

Don’t let fear, worry hold you back from your goals

General Manager:News Editors:Sports Editor:Features Editor:Writers:

Photographer/Graphics:Sales:

Classifieds:

Circulation:Webmaster:Social Media:

John SzozdaLarry Limpf, Kelly KaczalaJ. Patrick Eaken

Tammy WalroMark Griffin,

Alex Sobel, Yaneek SmithKen Grosjean, Stephanie Szozda

Julie Selvey, Lesley Willmeth,Leeanne LaForme, Alyce Fielding, Peggy Partin

Cindy Harder, Melinda Sandwisch,Stephanie Szozda

Jordan SzozdaAlyce Fielding

Tammy Walro

Cindy Jacoby, Melissa Burden,Jeffrey D. Norwalk,

Printed with Soy Ink. Member of IFPA

P.O. Box 169 • 1550 Woodville Rd., Millbury, OH 43447419-836-2221 Fax 419-836-1319

www.presspublications.comDistribution: 33,977

Metro Edition: 17,611 Suburban Edition: 16,366

PRESSThe


Since

1972

CIRCULATION

C O U N C I L

VERIFICATION

Audited by:

Publication Date:Classified Deadline:Display Advertising Deadline:News Deadline:Hours:Classified Dept:

Monday1 p.m., Thursday

Noon, ThursdayNoon, Wednesday

Monday-Thursday. 9 a.m.-5 p.m.Closed Friday


Letters Letters should be about 350 words. Deadline Wed. Noon. Send to [email protected]

Dare to Live

by Bryan Golden

sponsored byLadies Auxiliary Post 9963

For more info call 419-666-0367

The First & Third The First & Third Sunday of each monthSunday of each month

Lightning Bingo 1pmRegular Bingo 1:30pmDoors open at 12:30pmFood & Drink available

(Nothing can be brought in)

VFW Banquet Hall109 S. Main St., Walbridge

January 16thJanuary 16thNew Games! Higher Prizes!New Games! Higher Prizes!

Walbridge VFWWalbridge VFW

Your Voice on the Street: By Stephanie Szozda

Cheryl OttneyElmore

“Over because it’s so much easier to just pull it straight out. I hate it when it’s under. If it is, I will change it! I won’t leave it that way... To me it’s just awkward!”

Larry ConleyGenoa

“Well I like it over the top because if you have it under the bottom you have to reach further to get it and you have to work harder to get the paper off there too.”

Debbie EppardMillbury

“I put it on under because the heater vent is right under the roll so when the heat turns on, it spins the roll loose if you don’t.”

Andrea DwyerGenoa

“It must be over! My husband and I argue about it all the time. He likes it under! It doesn’t make any sense to me to do it that way!”

Patrick PattersonCurtice

“I always have my toilet paper over! It’s more convenient that way.“

Do you put the toilet paper roll on so the paper comes off over or under the roll?

To cast your ballot, go towww.presspublications.com

The Press Poll

Last Week's Results

YesNo

Environmentalists say manure from factory farms plays a major role in feeding dissolved phosphorous to

Lake Erie’s harmful algae. Factory farms should be:

46% Regulated more strictly27% Shut down.19% Current regulations should be better enforced 8% Left alone-they contribute to economy

Do you agree with President Obama’s executive actions designed to close the so-called “gun show loophole?

Astonishing generosity To the editor: It is this time of year that I report on the success of The Salvation Army – Port Clinton Service Unit’s Holiday Season Programs. Each day, as we hear in the media, there are events happening that have a way of putting our perspectives in order. Words cannot describe the pride and admiration I feel living in Ottawa County. It is because of the caring and giving county residents that I am able to report that we surpassed our $64,000 Red Kettle Campaign goal by raising $77,215.48 this year. This not only is astonishing, but is an all-time record for the Salvation Army Red Kettle Campaign in Ottawa County. If not for our 556 volunteers and their 1,599 hours of bell-ringing and our Red Kettle sites – Bassett’s, Walmart, Kroger, Friendship Food Stores, Miller’s Market and Community Market in Oak Harbor – this would not have been possible. We also were able to distribute more than 150 turkey vouchers through our Thanksgiving Program and to distribute more than 6,000 toys, along with hats, gloves, mittens and coats to over 1,300 chil-dren. It is, without a doubt, an honor to be able to say I work and live in Ottawa County and am able to serve those in need through The Salvation Army Port Clinton Service Unit. I am truly blessed.Maureen M. SaponariDirector, The Salvation Army – Port Clinton Service Unit

Surprised? To the editor: As former Woodmore Board of Education president, I write to correct board member Joe Liszak’s account of how the agreement with the teachers’ union was approved last month. The negotiating teams for the board and union reached a tentative agreement in early December. By law, once an agreement is reached by a public employer, it must be submitted to the legislative body for ap-proval or rejection within 14 days. Given this short timeframe, public bodies approv-ing tentative labor agreements rarely have available a full draft of the new agreement. Rather, the employer’s negotiating team typ-ically provides a summary of the agreement. In this case, members of our board, in-cluding Mr. Liszak, were fully briefed on the tentative agreement by the superinten-dent and the treasurer in executive session. The tentative agreement was discussed in detail and we were given a printed copy of all language changes, and board members had the full opportunity to ask any questions. Mr. Liszak professes that he was sur-prised when the board took up the subject of the labor agreement within the 14-day period, as is required by Ohio law. None of the other board members were surprised. Following the executive session briefi ng, we all knew what was in the tentative agreement, and we were all prepared to do

our job as board members and vote on it. Mr. Liszak was not.Steve HussWoodville

Thank you To the editor: The Elmore Unit of the Salvation Army wishes to thank the Elmore Kiwanis, the Key Club of Woodmore High School, Woodville’s Richard Harman and all the volunteers for faithfully standing by our kettles. A grand total of $8,173.90 was collected from the Elmore and Woodville communities. The money collected in Elmore and Woodville was spent within our local com-munities. Last year, we assisted people with heating, rent, utilities, fuel and other emergency needs. This past year, we dis-bursed $2,582.80 back to those in need. We were given a budget of $7,700 and at years end, the unused balance is returned to the Toledo offi ce of the Salvation Army to help serve the area’s needy. If you have a need for any assistance, please contact Sharon Arndt at 419-862-3589. We are here to help you. A special thanks to all who donated money and bought gifts for the Angel Trees in Woodville at Pills ‘N’ Packages and in Elmore at Red, White and Brew. Also to Sharon Arndt and her elves who wrapped and disbursed the gifts. Our Angel Trees

Are there goals which you cannot achieve? Are you moving forward at a slower than desired pace? Are there objec-tives which are proving to be elusive? If there is anything you want which you have not, or feel you cannot achieve, what’s holding you back? It’s easy to make excuses for why you can’t or won’t achieve your objectives. It’s even easier to blame external forces such as other people or circumstances. The econ-omy, fate, bad luck, bad timing, criticism, bad experiences, poor self-image, lack of confi dence, poor education, or insuffi cient knowledge, are all common justifi cations for failure. You may be convinced there are exter-nal forces holding your back. Regardless of what you think they may be, your response is up to you. Pick any example of an exter-nal force supposedly holding you back and there will be countless examples of other people who have excelled in spite of them. Therefore, any limitations impeding your progress are invariably self-imposed. It doesn’t matter which obstacles you are facing, the solutions you need are within you. To fi nd them, fi rst identify exactly what’s holding you back and then adjust your strategy to enable you to move for-ward. One powerful force which may be holding you back is negative self-talk. Your mind believes whatever you tell it. So when you tell yourself you can’t do some-thing, you won’t. You should be saying “I can, I will, and I’ll fi nd a way,” whenever you face a challenge. A positive belief in yourself always precedes accomplishment. Fear is another signifi cant impediment which holds you back. Fear of failure, fear of the unknown, or even fear of success, are all substantial barriers. Fears exist entirely

in your mind. A simple way to overcome fear is by doing what you are afraid to do. Any fear can be whittled away step by step in this fashion. Doubts erode your confi dence. Doubts have the same negative impact as fear. The solution is the same; take small steps forward. Each success chips away your doubts. Begin with easy tasks which are readily accomplished. As your doubts di-minish and your confi dence grows, you can tackle more challenging objectives. Worry holds you back. Worry leads to fear. You worry about the future, the past, and what you should do right now. Worry is exhausting, frustrating, and stressful, with-out producing any positive results. Worry cannot fi x problems. The past is over, let it go. The value of the past is learning what worked and what didn’t. As for today and tomorrow, action gets things accomplished. So stop worrying and start doing. Approval is a basic human need. That’s why fear of ridicule or criticism holds you back. You then avoid any behavior you fear will generate negative reactions from others. Your decisions are based on what will be most accepted. Being concerned about what others will think strangles your ambition. Live your life the way you want to. It doesn’t matter what other people say, think, or do. Bad experiences hold you back. They make you hesitant to do anything which

will repeat a negative experience. Rather than past experiences serving as a stepping stone, they become an anchor which pre-vents progress. Learn from bad experienc-es. Make appropriate adjustments in order to get back up and move forward. You have total control over what’s holding you back. You are the only one who can prevent your progress. Take responsi-bility for your life. Don’t make excuses for why you can’t do things. Although there are external events beyond your control,

you do have control over your response, thoughts, and actions. You can cut all the chains which are holding you back.

NOW AVAILABLE: “Dare to Live Without Limits,” the book. Visit www.BryanGolden.com or your bookstore. Bryan is a management consultant, motivational speaker, author, and adjunct professor. E-mail Bryan at [email protected] or write him c/o this paper. 2015 Bryan Golden

Angels among us To the editor: December is a hard month for me, because it is the fi rst Christmas, New Year’s Eve and wedding anniversary with-out my partner and soulmate, Tom. “Angels Among Us” was sung at our wedding, for that song was very dear to us. One night, as I was sitting at the supper ta-ble, the front door bell rang and there stood an angel, Julie, holding a spectacular bas-ket of fruit for me from the Elmore Kiwanis Club. That wonderful gesture brightened up my evening and brought a bright ray of sunlight to my holidays, knowing some or-ganization cared enough to have the gift de-livered to me. It means a lot to live in a community where there is love for one another in time of sorrow and need. May God bless the Elmore Kiwanis Club and guide them as they continue to help oth-ers in bringing sunshine to their lives.Betty Marlow MillerElmore

Overfl owing To the editor: Some people see the glass as half empty. Some people see the glass as half full. Betty Marlow Miller sees the glass as overfl owing.Charles DiebertElmore

served 25 families.Janice NetcherTreasurer, Elmore Unit


Opinion The Press

Tip Your Carrier & Receive$164.00 worth of coupons

for Press Classified Advertising.

Fill out this form and mail to: The Press, Box 169, Millbury, OH 43447

Name____________________________________________________

Address__________________________________________________

City____________Zip___________Phone_______________________

Crossroads________________________________________________

We're proud we've been able to

deliver the Metro & Suburban editions of

The Press, free to your home since 1972.

When you TIP YOUR CARRIER, you will

receive SIX (6) FREE CLASSIFIED

COUPONS & FIVE (5) DISPLAY COUPONS

That’s a $164.00 Value!

Your carrier will receive $8.00 from every $16.00 tip.

The rest goes for plastic bags, rubber bands, tubes & posts.

Enclosed is $16. Please tip my carrier and send me $164 worth of coupons.

Enclosed is $23. Please tip my carrier, send me $164 worth of coupons and the book

by John Szozda, 50 stories of inspiration

about local people who rose to meet the uncommon challenges they faced.

Common People, Uncommon Challenges

Enclosed is $23. Please tip my carrier, send me $164 worth of coupons and the book

by Bryan Golden, advice on how to break free from

limitations and lead a full, rewarding life.

Dare to Live Without Limits

As a bonus, for $7 more you

can receive a copy of the book,

“Common People,

Uncommon Challenges.”

50 uplifting stories

about local people.

Or the book

“Dare to Live Without Limits.”

Advise on how to break

free from your limitations and

lead a full, rewarding life.

PRESSThe


Since

1972

Daily SpecialsMONDAYMONDAYChef’s Custom-GroundChef’s Custom-GroundBurger with Fries orBurger with Fries orColeslaw. Coleslaw. $3 Margaritas!$3 Margaritas!

TUESDAYTUESDAY

$8.99$8.99

HUMPDAYHUMPDAYPork Ribeye with aPork Ribeye with a Seasonal Side and Seasonal Side and a Baked Potato.a Baked Potato.$2 Yuengling Drafts!$2 Yuengling Drafts!

$10.99$10.99

GAME DAY!GAME DAY!One of Smokey’sOne of Smokey’sFamous Pulled Pork Famous Pulled Pork Sliders and Fries.Sliders and Fries.$2 Miller Light Drafts!$2 Miller Light Drafts!$1 off All Smoked Drinks!$1 off All Smoked Drinks!

$2.99$2.99

FreshFreshHomemadeHomemadeEveryday!Everyday!

Sun 11am-9pm, Sun 11am-9pm, Mon-Weds. 11am-10pm, Mon-Weds. 11am-10pm,

Thur.-Sat 11am-11pmThur.-Sat 11am-11pm www.smokeysbbqroadhouse.comwww.smokeysbbqroadhouse.com

SmokedSmokedCocktails!Cocktails!

SMOKEY’SSMOKEY’SBBQ ROADHOUSEBBQ ROADHOUSE

2080 Woodville Rd.419-725-2888

$19.99$19.99Dinner for Two! BeefDinner for Two! BeefBrisket & Pulled PorkBrisket & Pulled Pork3 sides & 4 muf ns. 3 sides & 4 muf ns. Miller Light Drafts only $2!Miller Light Drafts only $2!

Get your Workout Time...ANYTIME!We’re a 24 hour access gym.

5845 N. Russell Rd. Oak Harbor, OH. 419-515-4640

It’s never been easier to keep that New Year’s resolution than with our

24 hr. access

And...No Hidden Fees

Located just south of Rt. 2 across from Wild Wings Marina.

Lequan Lofton wanted out of the street life and, most importantly, he wanted a bet-ter life for his three children. All fathers do, but how does a convict-ed felon make the transition from prison to the workforce and active fatherhood? Enter The Ridge Project, a Christian-based organization located in McClure, Ohio. Its mission: To establish a path of honor, discipline and integrity by way of education, motivation, and inspiration to lead families into a future defi ned by hope, peace and righteousness for generations to come. Such idealism generates skepticism. It did with Lequan Lofton, 30 at the time, who was serving time for possession of crack cocaine. “I fi rst thought it was a joke,” he said. “But, a friend of mine, Willie, who I knew from the streets, told me to try it. It has helped me know what it means to be a bet-ter father and husband, and I just have a better way of thinking.” The Ridge Project supplies services to the Ohio Department of Corrections. Its goal is to build strong families by chang-ing the way criminals think and by pro-viding them with an alternative means of income—a job. Lofton is just one of more than 600 men since 2011 who have obtained full-time jobs after completing The Ridge Project’s fatherhood program. The program is enti-tled TYRO, a Latin word for young soldier or apprentice. Lofton works for Superior Packing in Toledo. The security of a paycheck and the skills he learned through the program have stabilized life for him, his wife and their three children ages 14, 12 and 9. “I don’t have to go out in the street and do street things anymore,” he said. The predictable income and schedule also means he has more time to spend with his kids. He helps with homework and takes them bowling, fi shing and to the mov-ies. The Ridge Project was founded in 2000 by Ron and Catherine Tijerina while Ron

Prisoners learn to become better fathers through program

Ron and Catherine TijerinaFounders, The Ridge Project

“

“They were feeling like

misfits. I took innocence from

them...

was 10 years into a 15-year prison stay for a rape he says he did not commit. Cathy, just 24 at the time of Ron’s sen-tencing, found herself raising two sons, ages 2 and 4, by herself. She believed her husband was wrongly convicted and made the decision to stand by him and raise their boys on her own. She cleaned houses and did at-home work including inspecting fac-tory parts. She also went back to college and became a paralegal. She said she and her boys joined the “league of forgotten victims,” the families of men incarcerated. They are, at times, shunned or made fun of for crimes commit-ted by their loved ones. Her boys also missed the guiding hand of a father in their day-to-day living, some-one to teach them how to play baseball, how to shave and how to live a life of hon-or. “They were feeling like misfi ts,” Ron said. “I took innocence from them…These words shouldn’t have been in their vocabu-lary at four, fi ve or six years old — correc-tional, warden, prison…” It was through this personal journey

Page Twoby John Szozda

that Ron and Cathy found their calling — build strong families and they could change the world, or at least, their corner of it. “Fatherhood is the cornerstone of who we are and what we do,” Cathy Tijerina said. Ron added, “Bloods, Crips, Hindus, Jews, it doesn’t matter. Every father who comes into our program has one thing in common. They’re all Dads. Every father in the last nine years has said, `We want something better for our children’.” The road to get to there is not an easy one. The TYRO program takes 13 to 22 weeks to complete. It teaches men to be responsible fathers, to abandon destructive or self-serving behavior and to become men worth following. A couples component teaches talking and listening techniques to better commu-nicate with a signifi cant other and skills to help in decision making, confl ict resolu-tion and anger management. The job ethics component teaches the attitudes and skills you need to be success-ful in the workplace. These include how to set goals, how to effectively work with oth-

ers and how to communicate with respect to co-workers and customers. Thirty percent who enter the pro-gram fail, but the 70 percent who tough it out become eligible for job training and placement. In Lequan Lofton’s case, TYRO helped him earn his CDL license and placed him with a trucking fi rm. Those who land-ed jobs after completing TYRO earned an average of $14.42 an hour. The program has been wildly success-ful reintegrating fathers into the lives of their children. The recidivism rate for those who have completed the program is fi ve percent. That earned The Ridge Project in 2011 a “Best Practice” award from the U.S. Department of Health & Human Services. TYRO has served some 20,000 fathers since 2006. It has expanded from Ohio to Dallas, Texas and Baltimore, Maryland. A major factor in the rise of our pris-on population has been absentee fathers, Cathy Tijerina said. Consider that 95 per-cent of men in prison, 70 percent of juve-niles in state-run institutions and 90 per-cent of homeless and runaway children do not have fathers in their lives. Ron and Cathy Tijerina are uniquely qualifi ed for this calling. They know, from personal experience, the cost of absen-tee fathers. They also know, like Lequan Lofton knows, that a willingness to change behavior and learn how to be a good father can help build a strong family and a better life. “Your past doesn’t defi ne who you are, but it can quickly defi ne you for your fu-ture, if you let it,” Ron Tijerina said.

To learn more go to theridgeproject.com. Comment at [email protected]

CounselingCorner

The


HealthPublished second week of month.

Owner, David Owens

2004 Waite High School graduate

3 time Toledo City League Wrestling

Champion 2002-2004

419-691-8171 • 34 years experience

Member of Bay Area Credit Union

2665 Navarre Ave., Oregon - 419-691-8171 • (In the Freeway Plaza, across from St. Charles)

Open Mon-Tues. & Fri 9-6, Thurs. 9-8, Sat. 9-2, Closed Sun. And Wed.

J.C. CumminsCall or text 419-917-8119

New Year! New Fresh Cut! New Look!

Only at Owens Authen-i-cut!

Call For Your Appointment Today!

Walk-ins

Welcome

2 Bucks!

2 Bucks!

2 Bucks!

Chips & 21 oz. Drink, 5 Cookies,

Bowl of Soup

1501 Woodville Rd. Millbury

419-836-3325

Catering $5 OFF

Any cateringorder $30 +up

$6 Any

FootlongMillbury Restaurant only. Plus applicable

tax. Additional charge for extras. Must surrender coupon at point of purchase.

No cash value. ©2015 Doctors Associates Inc. Subtol -24941. Exp. 1/31/16

Millbury Restaurant only. Plus applicable tax. Additional charge for extras. Must surrender coupon at point of purchase.


$3Any 6”

SandwichMillbury Restaurant only. Plus applicable

tax. Additional charge for extras. Must surrender coupon at point of purchase.


Double Meat on any

Footlong

By Melissa BurdenPress Contributing [email protected]

Whether you are a novice runner or a more seasoned marathon veteran, learn-ing the biomechanics of running may save you from some common injuries down the road. Heartland Rehabilitation Services of Perrysburg will be offering a special pro-gram, “Running Biomechanics and Injury Prevention Clinic,” Tuesday, Jan. 12, from 6-7:30 p.m. at Second Sole Toledo, located at 4190 Levis Commons Blvd., Perrysburg. According to Matt Schultz, manager and physical therapist at Heartland, now is the time to learn what you may be doing wrong when running in order to prevent an injury own the road. “The Glass City Marathon is in April and many runners are beginning to train now for the event,” Schultz said. “We saw a lot of runners last year with injuries so we decided a clinic might help prevent some of the injuries this year.” Schultz said he is hoping new and experienced runners come out for the free program in order to prevent common inju-ries like plantar fasciitis, which causes heel pain, injuries to the Achilles tendon, ham-string issues as well as other knee and hip injuries. “A lot of times, new, younger runners may have great fl exibility and strength, but not good form,” he said. “Older, ex-perienced runners may have good form, but they have lost some mobility and have wear and tear issues which makes them subject to injuries. This clinic is meant to get a head of the game, to be a preventative measure and hopefully help runners pre-vent injuries which could keep them from running for a while.”

Clinic aims to keeping runners healthy

Matt Folk

Therapists will be on hand to offer complimentary screenings that will look for gait abnormalities, balance, posture, range of motion and fl exibility. “If we see a major issue we can make the runner aware of it so that they can man-age it on their own or they can come into Heartland for more in-depth treatment,” Schultz said. “There are signs and symp-toms of injuries that the sooner they are recognized the sooner they can be correct-ed.” Matt Folk, owner of Second Sole Toledo, is not a newbie to the Glass City Marathon. A 1994 Clay High School grad-uate, Folk won the Toledo marathon in both 2010 and 2012. He has also ran in the Boston and Chicago marathons.

A long distance runner, Folk went to Youngstown State University where he qualifi ed for the 1998 Division I Cross Country National Championships at the University of Kansas, becoming YSU’s fi rst male cross country runner to compete at the national level. Folk was a nine-time Mid-Continent Conference all-aca-demic selection and helped the cross coun-try and track and fi eld programs capture fi ve conference titles. He set school records in the fi ve-mile run, the 10K in cross coun-try and the outdoor 10,000 meters. “This clinic will offer an overview of the common injuries runners face and what causes them,” Folk said. “It will be really hands-on with people. We will watch how they run, their gate, and then we will make recommendations based on the evalua-tions.” Second Sole, which specializes in run-ning shoes and apparel, will also offer rec-ommendations for shoes if needed.“Plantar faciitis is the number one issue runners face,” he said. “If your shoes are not supportive enough, not cushioned enough, or you are not getting enough arch support, that can create issues.” Folk opened the Levis Commons store in 2008. He and his wife, Lindsay, a run-ner and YSU graduate, have a 2-year-old daughter, Emma, to keep them on their toes. “I will be doing the half-marathon this year,” Folk said. Space at the clinic is limited. For more information, call Heartland at 419-874-2657 or email [email protected]. Participants at the clinic will receive a discount on shoes and apparel that eve-ning, Folk said. Second Sole Toledo offers free group runs every Thursday. The 5K runs include freebies, prize raffl es and give-aways. For more information, visit Second Sole Toledo on Facebook.

A brand new year is a great time to get your mind back in shapeThe American Counseling Association

It’s the time of the year when many of us get serious about getting our bodies back in shape. After all those holiday treats, we may notice that our clothes are just a wee bit tighter and that we seem out of breath much more often. But while getting and staying physi-cally fi t is a great goal, many of us ignore the idea that we also need to be mentally fi t. And just as you can exercise your mus-cles to get in better physical shape, there are things you can do to reduce stress and get your feelings and attitudes into better shape. One starting point for shaping up your mental health is simply to make some time for yourself. It’s easy in today’s busy world to fi nd yourself buried in work, family is-sues and social obligations, leaving little or no time for yourself. An easy fi x to that is to create a dai-ly schedule that includes a time slot for “you.” Actually schedule a time each day when you can do one thing that you fi nd relaxing or enjoyable, then stick to that schedule. When it’s “you” time, pick up a book or take that walk and leave the stress behind. You can also improve mental well-be-ing by doing things outside yourself. When you give something back to others, it can offer a meaningful escape from your own problems while also providing a sense of fulfi llment and self-worth that’s essential for good mental health. Look for volunteer opportunities with community, civic or re-ligious groups that will give you a chance to do some good for others. And yes, staying physically active and fi t also plays a role in improved mental health. Studies have found, for example, that exercise is a great way to fi ght depres-sion. And as we get ourselves into bet-ter shape we begin to feel more confi dent about how we look and what we can do – feelings that add up to good mental health. Just as those extra pounds from all those holiday cookies are not going to disappear like magic, reducing stress and eliminating problems also takes effort to keep those issues under control. But when you build a little relaxation into your life, reach out to help others, and stay physical-ly fi t, you’ll fi nd mental health improving, making it easier to cope with the challenges of everyday life.

Counseling Corner” is provided by the American Counseling Association. Direct comments and questions to [email protected] or visit the ACA website at www.counseling.org.

By ProMedica HealthConnectpromedicahealthconnect.org

Ear piercings are a beauty norm in American culture, but how young is too young to receive them? Just this summer, mother Susan Ingram began a campaign to capture thousands of signatures to put a ban on piercings for ba-bies and toddlers in the U.K. Are the pain and risks high enough to warrant a ban? Susan Clay-Hufford, MD, a pediatri-cian with ProMedica Physicians, said that generally speaking, ear piercings are a very safe procedure. However, there are some risks and recommendations that parents need to consider. “Babies could get an infection more easily since their immune system isn’t developed very well,” explains Dr. Clay-Hufford. Also, if the earlobes are too small, it’s possible that there could be some rip-

Are babies too young for ear piercings?ping, depending on the size of the earring. In addition to the earring size, the material is also a risk factor. “You have to get a certain type of metal – gold, platinum, titanium, non-allergenic – so you don’t get swollen earlobes and an infection,” says Dr. Clay-Hufford. “Cheap” earrings, such as stainless steel earrings, are more likely to cause in-fection. Granulation tissue may also form as the body tries to push the foreign metal out by creating extra cells. To avoid these risks, Dr. Clay-Hufford suggests having a piercing done in a com-mercial store, in a regulated parlor or at your doctor’s offi ce. She herself offers some piercings at her pediatric offi ce at Toledo Peds. “I’ve pierced ears at my offi ce be-cause I know it’s clean, safe and I know what I’m using,” she says. The American Academy of Pediatrics says that there is little risk when pierc-

ings are “performed carefully and cared for conscientiously”, no matter the age of the child. However, the Academy does recom-mend as a general guideline that parents wait until children are mature enough to care for the pierced site herself. Dr. Clay-Hufford generally waits until patients are at least four months old, for two reasons: “The ear lobe is bigger, so it’s easier to get a good piercing, and because they’ve had two sets of vaccinations.” Regardless of age, she recommends parents seek the guidance of their provider before piercing their child’s ears. “Parents should talk to their physician about it beforehand,” she advises. “We’re pretty good at knowing places in the com-munity that do it safely.” Looking for additional baby articles? Read more in HealthConnect’s “Preparation for Parenting” series at promedicahealth-connect.org.

Health The Press


No matter what your goals are, Snap Fitness has all of the tools and support to help you look good, feel great, and get results. As a Snap Fitness member, you’ll receive one-on-one instruction with a personal trainer, unparalleled support from club staff and fellow members, and access to over 2,000 locations worldwide. Stop in today and let us help you start your journey towards creating a better you.

Limit one per household. No cash value. Access card fee, other fees and some restrictions may apply. Valid only for local residents on rst visit at participating clubs. © 2015 Snap Fitness, Inc. Offer expires 1/25/16

3555 Navarre Ave. Oregon 419-697-SNAP (7627)www.snap tness.com/oregonoh. In Center with Buffalo Wild Wings

JOIN NOW - NO DUES TILL FEBRUARY!

COOLEY CANAL

YACHT CLUB

12235 Bono Rd., Curtice, Ohio

Located at the Bono Curve off of Rt. 2.

New Membershipsavailable at

Call Fritz Goeckerman 419-344-4654

or the Clubhouse 419-836-3500

Docks Clubhouse Facilities

Complete Marina

• Shirts • Hats • Sweats • Nylon Jackets • Bags

• Scarfs • Mittens • Pants • Shorts • Socks

329 RICE STREET(across from Post Office)

ELMORE

419-862-3891

Varsity Jackets

Woodmore Genoa

New Hours: Mon. & Tues. 10-5;

Wed. 10-8; Thurs. & Fri. 10-5; Sat. 9-12

Cancer fi ghter gets Christmas wish

Darling Mensing on her new wrap around porch. (Press photo by Ken Grosjean)

By Melissa BurdenPress Contributing [email protected]

Darling Mensing, 56, of Martin, is still in awe of all of the people who came and helped make her Christmas wish come true. Her wish was a simple one, really. Mensing hoped for new siding for her fam-ily’s 100-year-old home. What she received in the end was a deep understanding of how much people in the community care. Not only did the house get brand new sid-ing, she also received a brand new wrap-around porch in the process. “There were people from the lo-cal community as well as from Sylvania, Toledo and Swanton,” Mensing said. “It was so cold and the teenagers came as well. They gave up their Christmas vacation to help with this project. The amount of peo-ple who showed up was amazing. I am just so grateful.” Mensing was diagnosed with Stage IV pancreatic cancer in late September. Her physicians have told her the cancer is ag-gressive, spreading to her liver and lungs. “I was in the hospital last March with kidney stones and had a CT (computer-ized tomography) scan at that time,” she explained. “In September, I thought I was having gall bladder problems. I had tests and they told me I had pancreatic cancer. The doctors looked at my scans from March and there was nothing there. There was no sign of cancer at that point. Now, it is also in my liver and lungs. I never, in a million years, would have guessed that I had can-cer.” Mensing said the support she has received from her husband, Charles, and children, BriAnna, of Martin; son, Micah, a student at Ohio State University ATI (Agricultural Technical Institute), in Wooster; Daniella, of Monroe Falls; Tiffany, of Newark; Lindi and Lesli, both of Perrysburg, and Brittany, of Toledo, has been wonderful. The support from the community was inspiring, she said. Her cousin, Rob Boss, a local contractor, designed and helped coor-dinate the building of the porch. Joni Meyer-Crothers, otherwise known as the “Coupon Lady,” started a GoFundMe site to raise money for the materials needed for the siding and porch projects. Her hus-band, Jamie, helped gather a crew and side the house. “My husband does not own a siding company, he is just handy,” Meyer-Crothers said. “Mary Beth and Rick, from 101.5 The River, gave me a let-ter they received from Darling asking for a Christmas wish. They knew they were not able to help to make her wish come true and knew with the following I had and my husband, Jamie, being handy, that we could probably organize something to help make this happen.” Meyer-Crothers gained both local and national fame after appearing on TLC’s “Extreme Couponing.” She currently has a book out, “Extreme Couponing: Learn How

to Be a Savvy Shopper and Save Money... One Coupon at a Time.” She also appears on local and national television shows, maintains a Facebook page and a website, “Freetastesgood.com.” “We are a very spiritual family and fo-cused on outreach,” she said. “When this was presented to me, I felt God had given us this opportunity. My mom passed away at 56 from cancer and Darling was 56 so I just felt a tugging on my heart.” Meyer-Crothers said a total of 70 peo-ple worked on the porch and siding. “I think everyone that helped felt more blessed than Dar and her husband, Charlie did,” she said. “We feel like we have life-time friends now. All the glory goes to God. We were just being obedient. It had nothing to do with us at all.” Mensing said the care and attention to detail by those who donated their time to the home has made a big difference in her and her family’s lives. “Everyone treated this house as their own house,” she said. “There was no cut-ting corners. They all made sure everything was perfect. Jamie, and his wife Joni, took this project on. They worked together and they were able to fi nd the right people to work on it as well. My daughter, BriAnna, said it was really real warm upstairs. She thought someone turned the heat up in the house. We actually had to turn the heat down.”

Mensing is currently receiving che-motherapy treatments at the Martha Morehouse Medical Plaza, a part of The Ohio State University’s Wexner Medical Center, in Columbus. She goes once a week for three weeks at a time. The fourth week is a resting week. Then, the process starts all over again. “Today I am doing better, but I go Thursday to Columbus to start all over again,” she said last week. “They (doctors) were hoping to do surgery, but since the cancer spread, it was taken off the table.” Mensing is also taking part in an exper-imental program where she injects herself twice daily with a shot that could either be a blood thinner or a placebo. Neither she nor her doctors know what she has been given. “They are doing research to see if the blood thinner combined with chemo will kill the cancer cells,” Mensing explained. “The CT I had last week showed the cancer has not moved past the liver and lungs. I am hoping the cancer starts shrinking so I can go into remission. I have fi ve grandkids plus my own children. I want to be around, watch them grow, and see what they do.” Donations to the GoFundMe account have reached $8,100, just short of the $10,000 needed to pay for materials. To donate to the project, visit Gofundme.com/darchristmaswish.

Giving blood lifesaving January is National Blood Donor Month and the American Red Cross encourages community members to make a lifesaving commitment to donate blood to help ensure a suffi cient blood supply in the new year. Britton Lund made her fi rst blood donation as a high school student. Though it was easy and she knew her type O negative blood was in high demand, she only gave sporadically over the next 10 years. Then, her sister was diagnosed with brain cancer, motivating Lund to become a regular donor. National Blood Donor Month has been observed in January since 1970 with the goal of increasing blood and platelet donations during winter – one of the most diffi cult times of year to collect enough blood products to meet patient needs. Severe winter weather may result in canceled blood drives, and seasonal illnesses, like the fl u, can cause donors to be temporarily unable to give. Blood donors of all types are needed to maintain a suffi cient supply. Eligible donors with types O, B negative and A negative blood are encouraged to donate double red cells where available. During a double red cell donation, two units of red cells are collected while most of the plasma and platelets are returned to the donor. To make an appointment to donate blood, download the free Red Cross Blood Donor App from app stores, visit redcrossblood.org or call 1-800-RED CROSS (1-800-733-2767). Upcoming blood donation opportuni-ties include: Jan. 16 – 9 a.m.-3 p.m., Bethlehem Lutheran Church, 220 Cedar St., Pemberville.

Bariatric Seminar Bariatric, or weight loss surgery, often results in not only safe, long-term weight loss, but improved overall health and well-being, including increased energy and the resolution of type 2 diabetes. Informational seminars will be offered Tuesday, Jan. 12 and Wednesday, Jan. 27 from 6-8 p.m. at ProMedica Toledo Hospital Metabolic and Bariatric Center, 3909 Woodley Road, Suite 200, Toledo. To sign up for a seminar, call 419-291-6777 or visit https://www.promedica.org.

Re-do, Re-new, ReFit ReFit Revolution – a free dance party with fi tness, friends and community – will begin Saturday, Jan. 16 at 10 a.m. at St. Mark Lutheran Church, 611 Woodville Rd., Toledo. The class will include dance cardio, goal setting and a prize drawing. Those who raise money for the charity of the month can win even more. Learn more by visiting REFIT on the Bay on Facebook.


Allison

Dollman M.D.

Dr. David Kouba

Welcomes

Oregon Dermatology

Navarre Medical Building

2702 Navarre Ave., Suite 320

Oregon, OH.

419-724-5820

The Toledo Clinic

Specializing in the diagnosis

and treatment of

skin cancer

Specializing in the diagnosis

and treatment of

skin cancer

Allison brings over 10

years experience of

caring for patients.

Dr. David Kouba , MD, PhD

We have something for every smile!

Make Healthy SmilesMake Healthy Smilesa Family Tradition

Check out our Dental Specials at:www.walbridgedental.com

* Handicap Accessible ** New Patients Welcome ** Emergencies Welcome *

Call for an appointment today!

Jody E. Freytag, D.D.S.Jody E. Freytag, D.D.S.Matthew D. Freytag, D.D.S.Matthew D. Freytag, D.D.S.

3601 Ayers Rd.Millbury, Oh 43447

419-836-1033

Does Snoring Disrupt Your Sleep?Don’t let snoring ruin the quality of your life…

ForHELP

You bothdeserve a good

night’s rest.

Call…the Toledo Snoring Instituteat ENT PHYSICIANS INC. (419) 474-9324

www.toledosnoring.comWe offer the Pillar Procedure—a simple, quick in-office

procedure that may cure your snoring in one visit!Clinically proven • FDA Approved • High Satisfaction Rate

(419) 698-4505

STOP SMOKING LOSE WEIGHTWITH HYPNOSIS

Need help with yourNew Year’s Resolution?

Hypnosis is a safe, natural and effective way to help you kick dysfunctional habits. Whether you are a nail biter, overeater, smoker, depressed or anxious, hypnosis may be able to help you reprogram your-self to live a life free of those hard habits to break. Give us a call for a FREE phone consultation and nd out how easy and effective hynotherapy can be.

Now Serving 2 LocationsCounseling and Hypnosis

421 W. Main StreetWoodville, Ohio

419-849-2414

900 Croghan StreetFremont, Ohio419-552-4374

www.counselingandhypnosis.net

Insurance Accepted

Health The Press12 THE PRESS JANUARY 11, 2016

Financing & Delivery Available

262 W. Water St., #2, Oak Harbor, OH

419-707-1995

$899 $250

Complete Frame (base)& Mattress Setstarting at...

Queen Flat Setstarting at...

Sleep better, live longer!

Adjustable beds help everyone

Open Tues.-Fri. 10 am-8 pm; Sat., 10 am-4 pm

Appointments available HarborMattress.com

Heat Your HomeFor Less!

with renewable resources

Central Boiler Dealership

• Sales

• Service

• Installation

• Parts

B & B Woodburner, LLC

20533 Bradner Rd.

Luckey, OH

419-466-6200

•Outdoor Wood Furnaces

•Outdoor Corn & Wood

• Pellet Furnaces

We Finance

InnovationsPortrait Studiowww.visualimpact.com

Caregiver programs set Hospice of Northwest Ohio, in part-nership with the Area Offi ce on Aging, will present free “Caring for the Caregiver,” workshops designed to help those who are caring for a friend or family member. The program will be offered Thursdays, Jan. 21 and 28 from 2-4p.m. at the Hospice of Northwest Ohio Toledo Center, 800 South Detroit Ave. Registration is required by Monday, Jan. 18. Workshops will also be offered Thursdays, Feb. 18 and 25 from 6-8 p.m. at the Hospice Perrysburg Center, 30000 East River Rd. Register by Feb. 15. Register by calling Julie Tucholski at 419-931-5534.

Dr. Jalil joins clinic staffSaman Jalil, MD, has joined Mercy

Health Oregon Clinic. Dr. Jalil is a graduate of King Edward Medical College, Lahore, Pakistan, and completed her Internal Medicine residency at The University of Toledo Medical Center. Dr. Jalil will begin seeing patients on Jan. 29 at the clinic, located at 3841 Navarre Ave., Oregon. Call 419-691-8132 to learn more about Dr. Jalil or to schedule an appointment.

By Ken ChisholmSpecial to The Press

Welcome to 2016. It’s a brand new year, and with it comes a fresh new batch of healthcare benefi ts waiting to be utilized. For many of us who are now in “that age group,” preventive testing and screen-ings play an increasingly important part of our health maintenance. I originally wrote this article about Health Care Reform a few years ago, but the content is as relevant today as it was then and, in light of all the healthcare and eco-nomic changes that have occurred, perhaps it’s important to take another look. In an effort to create more opportunity for individuals to seek, and obtain, preven-tive services, insurance providers are of-fering coverage of the costs of these tests/procedures for people, largely for little-to-no out-of-pocket expense to the individual. After all, ‘tis cheaper to pay for an “ounce or prevention” than a “pound of cure,” right? Two examples – and there are many more – of “screenings” that fall under the presumed “free” and “preventive” label are eye examinations and colonoscopies. The key phrase in this whole discussion is the term “preventative.” Point of clarifi cation here – the term “free” means no out-of-pocket expense, i.e. no co-pay and no out-of-pocket responsibility. Let’s take colonoscopy as an example of preventive, colon/rectal cancer “screen-

Avoid costs when seeking “preventive” healthcare ing” procedure. Let’s say you are interest-ed in getting a colonoscopy as a “preven-tive” screening. You’ve had no personal medical history of any intestinal or bowel problems in the past and you’re now in the age range where these procedures are being encouraged. You’ve even had a prior colo-noscopy several years ago with a “clean bill.” OK...you have your colonoscopy and everything went smoothly and there was no evidence of any problems, except for a small “polyp-type” thing that was removed for evaluation, which ultimately came back “normal.” Fast forward a few weeks. You receive from your insurance provider, an E.O.B. (explanation of benefi ts) for the cost of the procedure; the physician’s charge, the “fa-cility fee” which is the cost of the operating room used for the procedure, anesthesia/sedation charges and pathology charges for a “specimen” sent for evaluation (remem-ber that “polyp-thing?). Oh, and there in its own section is the “patient responsibility” section which itemizes your total fi nancial responsibility for this procedure. “Wait a minute! I thought this was a free/preventive screening!” Well, it was – right up until that “pol-yp-thing” was removed or biopsied. From then, on it became “diagnostic” versus “preventive.” A mere language issue, right? Wrong. As part of the overall health reform, the federal government has mandated that insurance carriers cover the costs of “pre-

ventive” services. If a test or other screening procedure such as a colonoscopy is performed and absolutely nothing extra was done, biop-sies, scrapings etc. then yes, it was preven-tive. The minute something “diagnostic” or “therapeutic” is done, it now falls outside the parameters for acceptability as preven-tive. Medicare provides a listing of what is covered under “preventive” services. Those of you on Medicare should try to be-come familiar with them. You can check them out by visiting www.medicare.gov. The important thing to remember when seeking “preventive services” in a quest to get/remain healthy, it is entirely your re-sponsibility to understand what preventive is, and to question tests and procedures as to acceptability for consideration as such. Ask your physician, and get answers that you understand. Do not undergo test-ing, screenings or procedures unless/until you are certain you understand their pur-pose, and also what the potential is for a “preventive” service to become one in which you are fi nancially responsible. There is much to know and be aware of when it comes to health care. It is daunting and confusing even for those in the industry.

Ken Chisholm is Program Director at the Mercy St. Charles Hospital Wound Care & Hyperbaric Center in Oregon. Contact him at [email protected].

Pediatric & Family Care Designer Frames & Sunglasses

Contact Lenses (new colors) Ocular disease treatments

Diabe c evalua ons LASIK & cataract co-management

Emergency & A er Hours Care Most Insurances Accepted

Stop by & SEE our NEW Loca on:

603 Main Street

Auto - Home - Business - Farm - LifeGroup and Individual Health - Annuities Medicare Supplement - Long Term Care

JennyCaughorn

PersonalLines

Specialist

Genoa 419-855-4170

� Steering & Suspension

�

�

�

�

Wheel Alignments

Charging & Starting Systems

Chemical & Fluid Maintenance

Heating & Air Conditioning

�

�

�

�

�

Brake & A.B.S. Systems

Engine & Transmissions Repair

Drivability

Tire Service

Custom Exhaust

��

Joshua GoldsbyASE Certified Master Technician

Owner/Operator

501 Main St., Genoa419-855-6212 ~ 419-764-8540501 Main St., Genoa419-855-6212 ~ 419-764-8540501 Main St., Genoa419-855-6212 ~ 419-764-8540

Attention widows of veterans

You could be eligible for widow's pension, burial

benefits, survivor benefits, or financial assistance.

FREE evaluation!

Phone: (419)898-2089

www.co.ottawa.oh.us/veterans

Attention veterans of all erasYour service may be worth

more than you think. You could be eligible for health, education, home

loan, or financial assistance.FREE Services!

Mon., Tues., Thurs., Fri. 9 am-5 pm;

Wed. 9 am-8 pm; Sat. 9 am-2 pm

644 Main Street 419-855-7221

Visit Our Website

Floor Coverings

GENOA CUSTOM INTERIORS

Carpet • Hardwood • LaminateVinyl • Ceramic Tile

WindowTreatmentsWall Coverings

Want to Beat the Winter Doldrums?

Genoa AreaChamber of Commerce



Shop Our Merchants for

the Perfect Holiday Gifts

Come to historic Genoa to enjoy a fine selection of

restaurants and shops, and experience the

joy of our town!

All-You-Can-EatPancakes, Sausage,

Scrambled Eggs,

Gravy and

Biscuits

& Applesauce

302 West St., GenoaFor details call 419-855-7049

If you are interested in renting the Legion Hall

please call Tom Chalfin at 419-460-3265

Genoa AmericanLegion Post #324

Sun. Jan. 31st8:00am-1:00pm

Adults $7. Kids $4.00 00

419-855-7755300 Cherry StreetGenoa, OH 43430

genoahs.com

Home Again. Independent Again.Our Home Again rehabilitation program combines innovative therapy approaches with expert therapists and hotel-like amenities. Our goal is to get you back home and back to maximum independence as quickly as possible. But, once you experience our homelike environment, chef-prepared meals and beautiful private suites, you may just want to stay! For more information or to schedule a private tour, please call or stop by today!

Stop in & See Us!!

419-707-5800419-707-5800

22361½ Holt Harrigan Rd.22361½ Holt Harrigan Rd.Next to Hong Kong RestaurantNext to Hong Kong Restaurant

We’ve Movedto our

43 yrs. experience

$10 OFF $10 OFF Your Next Service CallYour Next Service Call

Call TODAY for a FREE Estimate!Financing Available24 Hr. Emergency ServiceResidential & CommercialGenerac Automatic Backup Generators

21700 W. St. Rt. 51, Genoa419-855-6112

KAYLORKAYLORKAYLORKAYLORPLUMBING, WIRING & HEATING

lG t

Larry Dean, AAMS®Financial Advisor22051 W State Rte 51Genoa, OH 43430419-855-0096

Brian J GreggilaFinancial Advisor22051 W State Rte 51Genoa, OH 43430419-855-0096

Market swings making youuneasy? Let’s talk.

Make sure your business Make sure your business stands out stands out in the crowd!in the crowd!

Join this page for only $37.00 a month and you will get a 2.38” by 4” ad

and reach over 16,000 homes in 20 communities including Genoa, Elmore, Woodville, Gibsonburg and Walbridge

Call The Press at 419-836-2221

Find your favorite superstar!Find your favorite superstar!Find your favorite superstar!Find your favorite superstar!HEHphotos.smugmug.com

419-509-6883

HEHphotos.smugmug.com

419-509-6883



24 Hour Service24 Hour Service

419-243-6115 3401 Woodville Rd., Northwood

www.bobshomeservicehvac.com

Bob’s Home Service Heating & CoolingLicense #19337

Like our facebook page for discounts!

Helping families in Northwest Ohio since 1975Helping families in Northwest Ohio since 1975

For Fall Furnace check to be valid, furnace has to be in working order and parts

Are not included. Gas Furnace Installed, does not include chimney liner if needed,

does not include any work on ducts, and minimal sheet metal work.

Must be presented at time of service.

Not valid with any other offers Expires 1/31/16

$79.95

Bob’s Home Service Heating & Cooling

Furnace Check

Check: heat exchanger, burners, vent pipe and

draft, chimney, gas valve, blower assembly.

(It’s a 22 point inspection and we can provide the list)

Must be presented at time of service.

Not valid with any other offers Expires 1/31/16

$2200.00

Bob’s Home Service Heating & Cooling

Gas Furnace Installation

Reconnect into existing duct work, reconnect

into existing gas and electrical, flue venting

to existing chimney liner

(add'l for new chimney liner drop)

Keep Warm

this Winter! 10% Off on Car Repairs up to $60.00

• 3Yr-36,000 Mile Warranty• Loaner Cars

• Free Towning

4041 Navarre Ave Oregon, OhCall today 419-693-6141

(some restrictions apply. expires 1/30/16)

We Service All Makes

Wild Card SavingsWild Card SavingsWild Card Savings

REPAIRS MAINTENANCE TIRESREPAIRS MAINTENANCE TIRES

Individual athletes from our area have a way of accomplishing the ultimate goal—winning a state or national championship. On the other hand, it seems like team state championships from this area are few and far between. If you’ve been to the state basketball tournament recently, good luck fi nding a champion from the Eastern Maumee Bay community, or even the metro Toledo area, for that matter. However, local individuals do have a knack for playing a role in team cham-pionships — like Ohio State synchronized swimming coach Holly Vargo-Brown, a Waite graduate who led OSU to a national title last year. So, here are the best of the best individ-uals, with a few teams sprinkled in-between, and their accomplishments from 2015.

1. For the second straight year, we have three state wrestling champions from this side of the Maumee River. While Genoa senior grappler Jay Nino and Central Catholic senior Nate Hagan (an East Toledo native) repeated as state champions, Clay junior Matt Stencel won his fi rst title. Stencel rolled through four opponents en route to claiming the Division I title at 195 pounds. Nino won a D-III title at 220 and Hagan won a D-II championship at 138. Meanwhile, the Clay wrestling team fi n-ished eighth in D-I. 2. Clay senior Grace Winckowski wins the D-I state title in the 300-meter hurdles, becoming the fi rst Clay track athlete to ever win a state championship. She fi nished in 43.5 seconds at Ohio State’s Jesse Owens Memorial Stadium, just under one-fi fth of a second faster than runner-up Sydney Stokes (43.67), a senior from Gahanna Lincoln. Meanwhile, the Eastwood boys track team fi nished third in D-III for the second year in a row. It was the fi fth time in eight years (2008-2015) Eastwood placed third or higher as a team, which includes two state championships. 3. Wayne State University senior diver Dylan Szegedi, an Oregon native, wins his second national title at the NCAA Division II Championships. The 22-year-old won the 3-meter competition and placed third on the 1-meter board. Szegedi, a 2011 gradu-ate of St. Francis de Sales, was a three-time state qualifi er in high school, placing fourth as a senior. He has been diving since he was 6 years old. 4. For Indianapolis Fever 6-foot-3 forward Natasha Howard (Waite/Florida State), playing in the WNBA fi nals in her second year of professional basketball was a dream realized. Howard was a role player for the Indianapolis Fever, which fell in the fi fth and fi nal game to the Minnesota Lynx in front of a national ESPN television audi-ence. 5. Under the tutelage of Ohio State syn-chronized swimming coach Holly Vargo-Brown, a Waite graduate, the Buckeyes win the U.S. Collegiate National Championship for an unprecedented 29th time. The synchronized swimming title was the Buckeyes’ fourth national championship in 2015. The others came in football, wres-tling, and pistol shooting. On the strength of season-best performances across the board, Ohio State was able to top defend-ing champion Lindenwood, 93-89. 6. The City of Oregon changes its name to “Oregon, Ohio Buckeyes on the Bay, City of Duck Hunters” for one day,

Top 15 sports events

Around here, individuals rule — teams, not so much

Top photo, Clay senior hurdler and eventual state champion Grace Winckowski wins a Three Rivers Athletic Conference championship. Below that, Genoa senior wres-tler Jay Nino on his way to a second straight Division III state title. (Press fi le photos by Scott Grau/TRACsports.org and Harold Hamilton/HEHphotos.smugmug.com)

Monday, January 12 — when the Ohio State University Buckeyes and the University of Oregon Ducks played for an NCAA Football Bowl Subdivision national cham-pionship. The idea to show Oregon, Ohio was supporting the Buckeyes was spurred by Oregon natives Matt Squibb and Mark Rabbitt, and quickly went viral on social and national media. Mayor Mike Seferian found himself giving multiple interviews on ESPN and Fox Sports, and the city also designated May 5-12 as “The Ohio State Buckeye Week in Oregon, Ohio.” 7. University of Kentucky thrower Brad Szypka, a 2011 Genoa graduate and Curtice native, began to hit his stride as a junior at UK, winning the Southeastern Conference indoor title in the shot put with a throw of 63 feet, 10½ inches and then fi n-ished third in the outdoor competition his senior year with a toss of 63-9. In March 2015, Szypka, who graduated with a de-gree in education, had a throw of 63-6 at the NCAA D-I national indoor competition,

good enough to fi nish fi fth and earn All-American honors for the second time. 8. Kent State wrestler Ian Miller (Oak Harbor) became the Golden Flashes’ fourth two-time All-American. Miller, a 157-pound junior, was seeded seventh and took fi fth place at the NCAA D-I Championships held March 19-21 at the Scottrade Center in St. Louis. He joined Dustin Kilgore, Nic Bedelyon and Don Horning as Kent’s only two-time All-American wrestlers. Miller took fourth place the previous season at 157. He went 15-3 during the regular sea-son and 5-2 at the NCAA tournament. 9. Six-foot-6, 300 pound Ohio State lineman John Glesser, a 2011 Clay graduate, was asked his senior year by Coach Urban Meyer’s staff to join the Buckeyes, which won an FBS national championship. This might have been the No. 1 sports item of the year had he seen action during a game, but he was on the sidelines when Ohio State de-feated Oregon, 42-20, for the national title. His parents, Rita and Philip, received four

tickets and attended the game, too. Coaches say the role John played all season simulat-ing opposing defensive and offensive lines in practice was vital to Ohio State’s success. He dressed for every game after OSU’s 35-21 loss to Virginia Tech in week two. 10. Olympic wrestling hopeful and Oak Harbor native J.D. Bergman gets the unique experience of working on the movie “Foxcatcher” starring Steve Carell, Channing Tatum and Mark Ruffalo. He played a wres-tler. The fi lm is based on the true story of two Olympic champion brothers, Mike and Dave Schultz and wrestling enthusiast John du Pont, who developed a complex relation-ship with the men before things turned hos-tile. Du Pont ended up shooting and killing Dave Schultz on Jan. 26, 1996. 11. Eastwood senior football player Brennan Seifert receives the Tim Berta Courage Award at a National Football Foundation banquet. His father Doug had been battling prostate cancer since 2009 and he passed away the morning after Brennan scored two third quarter touchdowns to tie unbeaten and fourth-ranked Marion Pleasant at 28-all in a D-V playoff game. A video screened at the NFF dinner showed Brennan looking toward his father on the sideline, and his father was ambulanced to the hospital at midnight that evening. 12. The Genoa baseball team, for the third time in the program’s history, ad-vanced to the state tournament, falling 6-4 to Cincinnati Summit Country Day in a D-III semifi nal at Huntington Park in down-town Columbus. Behind seven seniors, Genoa fi nished the season 24-5 and won a Northern Buckeye Conference title. 13. Two football teams, Gibsonburg and Lake fi nish 10-0 seasons, but both lose in fi rst round playoff games. Lake senior Branden Short, a 5-foot-9, 200-pound half-back, rushed for 2,011 yards, is named fi rst-team All-Ohio in D-V. Lake’s career rush-ing leader with 4,181 yards and 66 rushing touchdowns, The Flyers lost to regional fi nalist Doylestown Chippewa, 42-35, in its playoff opener. The Golden Bears out-scored opponents 452-183, before falling to eventual regional fi nalist Van Buren, 45-16, in a Division VI regional quarterfi nals. 14. Ohio State thrower Carly Pendleton (Woodmore) joins three sisters in qualifying for the NCAA D-I national track meet. Pendleton realized her goal to advance to the NCAA Outdoor Track & Field Championships June 10-13 at Hayward Field in Eugene, Ore. She com-peted in the discus for OSU, fi nishing 23rd out of 24 competitors. 15. Eastwood and Cardinal Stritch boys’ basketball teams have historic bas-ketball tournament runs — both reaching the regional tournament semifi nals, and Gibsonburg completes a perfect 22-0 sea-son, but loses to the Cardinals in a sold-out district semifi nal.

(To see the best of the rest, visit PressPublications.com/Sports. Press writ-ers Yaneek Smith and Mark Griffi n contrib-uted.)

Behind the Scenesby J. Patrick Eaken


“This is what I was meant to do.”

Greg Swartz, DO Mercy Family Physicians

Listen. Help. Heal.

A Catholic healthcare ministry serving Ohio and Kentucky

Cincinnati | Irvine | Lima | Lorain | Paducah | Springfield | Toledo | Youngstown

Choosing a Mercy Physician is one of the healthiest choices you can

make. We are more than your doctors, we are partners in your long-term

health. We listen, help and heal, and we are there when you need us

most. Because caring for you, your family and the ones you love — this

is what we were meant to do.

To find a physician like Dr. Swartz in your area, call 888-204-8775 or visit mercy.com

The Biggest LittleFurniture Store Around!

Tues., Wed., Thurs. & Sat. 9-5:30

Mon. & Fri. 9-9:00

(419) 637-7292

6 Months FREE Financing With Approved Credit!

In Gibsonburg, OH

Did you know…

We also sell carpet &

• Many styles and colors,

including berbers

• Affordable pricing

• Removal and disposal of

old carpet

• Furniture moving

• Quality installation

• Free measuring

• Free professional design

consultation

We offer:

Hurry In Soon!

www.vehandson.com

customwindow

treatments?

By Mark Griffi nPress Contributing [email protected]

There are a lot of interesting things to tell you about the path Woodmore junior wrestler Conor Emch has taken.

Like the fact that Emch has tried to model his wrestling moves by watching and wrestling his older brother. Or that Emch practices against not only former Woodmore wrestling standouts but his own coaches.

Head coach Steve Ulinski said Emch has the mentality and talent to become the next great Woodmore wrestler. Emch is 13-2 this season and has won the Northwood Invitational and taken second at the Bellevue Invitational, both at 126 pounds. He won fi ve matches at Northwood and won his fi nals match by a 12-2 major decision.

“Conor typically doesn’t make a lot of mistakes on his feet,” Ulinski said. “He doesn’t put himself in bad situations when it’s time to wrestle. He’s really strong on top, he rides well and he can turn. When guys open up, he can turn them. He’s a genuinely good kid and very coachable. He listens, he absorbs everything and he tries to apply it, which gives us immediate feed-back on whether it’s working or not.”

Conor’s brother Dexter, 22, was a state qualifi er for Woodmore at 132 pounds and now attends the University of Toledo. Conor said he took up wrestling in the eighth grade, partially because of his brother.

“I always watched him and went to his matches,” Conor said. “I learned from him and watched him. I still hit the same moves

Woodmore’s Emch — he’s not your typical wrestler

he did. I’ve always looked up to him. He’s come up (from UT) a couple times to help me out this season, help me brush up on my moves. He pushes me to get better every day.”

The Wildcats’ lineup is thin this sea-

son, with only eight wrestlers on the roster including one who is out with an injury. Emch practices against junior teammate Jake Amstutz, who competes at 113 and 120 pounds, and he periodically practices with former Woodmore wrestlers Thomas Schnitker, Colton Datkun and Evan Ulinski. Steve Ulinski and assistant coach Dane Bonnigson also get on the mat with Conor.

Schnitker is a freshman wrestler at Heidelberg University, while Evan Ulinski, a two-time state runner-up (2013, ‘14), at-tends the Air Force Academy.

“Conor wrestled over Christmas break with Thomas and Evan, and he’s made a major improvement,” coach Ulinski said. “It’s hard for him to wrestle me because he’s so much smaller than me and so much bigger than the other kids. He’s getting pol-ished. That advantage of only having seven or eight kids and me and coach Bonnigson, he is (getting) a lot more personal attention.”

Emch said practicing against older wrestlers is making him a better technician on the mat. He likes the fact that the older guys know what buttons to push to help make him a more complete wrestler.

“I like wrestling Evan and Thomas,” Emch said. “They’re both in college and both wrestled in college. They help me a lot. Evan taught me a lot during Christmas break. I learned what it takes to beat those high-level wrestlers (who have) college ex-perience.”

Emch bounced around from 120 to 126 to 132 pounds as a freshman, but it was dif-fi cult to get into the starting lineup because he kept losing wrestle-offs with teammates.

Emch decided to bump up to 138 pounds, and lo and behold the fi rst person he faced was fellow freshman Kaleb Romero from Mechanicsburg, at a mid-season tourna-ment in Lima.

Emch won 10 matches that season, but the Romero match was not one of them. Romero pinned Emch and won the 138-pound state title that year before win-ning the state title at 152 last season.

“I don’t remember much about that (match),” Emch said. “Coach never said how (Romero) was projected as a state champ. I went into it thinking he was just another wrestler. He was pretty special. He hit a move on me I really didn’t know.”

Emch bounced back last season and won the Northern Buckeye Conference title at 126 pounds. He qualifi ed to the district tournament, but did not have a good per-formance.

“I don’t know if I was unprepared,” Emch said. “I went into it and just made it a bigger deal than it needed to be. It was the next step to state and I didn’t wrestle to my ability because it was in my head that it was a big tournament. I wasn’t relaxed at all. That’s what’s driving me this season.”

Coach Ulinski said he wants Emch to peak toward the end of the season, but he warned that the competition in some of the lower weights in Division III in Northwest Ohio will be as tough as ever at the section-al and district level.

For Emch, it’s state tournament or bust.“That’s what would make my year,” he

said. “I just have to keep practicing hard every day and keep pushing myself.”

Woodmore junior wrestler Conor Emch winning a Northern Buckeye Conference match. (Press photo by Harold Hamilton/HEHphotos.smugmug.com)

Stay warm this winter with a white hot smile

Joseph P. Sexton, DDS

We Welcome New Patients & EmergenciesWe Welcome New Patients & Emergencies3448 Navarre Avenue, Suite #1 • Oregon, Ohio 43616 • Phone: (419) 693-6872 • Fax: (419) 697-1044

www.drsextondental.com

Virginia D. Carner, DDS


A third Eli family member will play collegiate sportsBy Yaneek SmithPress Contributing [email protected]

To say Athena Eli has accomplished a lot during her track and fi eld career would be an understatement. The accolades are numerous for the Oak Harbor senior.

They are so numerous that she has earned a scholarship to continue her track career at Notre Dame College in South Euclid, Ohio.

Over the last two years, Eli, with the help of Alexa Weis, Allie Jett, Abby Dornbusch, Annie Quisno, Cydney St. Clair, Karis DeWalt and Rebekah Rayburn, has been a part of fi ve relay teams that placed at the Division II state track meet, enough to sustain her a place in Rocket sports history. However, there’s so much more to her resume.

Eli has helped her team win three con-secutive Sandusky Bay Conference titles, pushing the streak to six straight. At the league meet, Eli has won seven events in all — three individual (200, 200, 400) and four relays (4x200, 4x200, 4x400, 4x400) — and also fi nished second once in the 200 and was part of four relay teams — 4x100, 4x200, 4x200, 4x800 — that also fi nished second. Her highlight came two years ago as a sophomore when she won the 200 and 400 and was part of two relay-winning teams, the 4x200 and 4x400, coming up just short of winning Most Valuable Player honors.

In Columbus two years ago, she was part of three relay teams that placed — the 4x400 (fourth), the 4x100 (sixth) and the 4x200 (eighth). Last season, the 4x100 fi n-ished sixth while the 4x400 came in eighth. As a team in 2014, the Rockets fi nished 30th in Division II. Eli was also part of two relay teams that came up just short of quali-fying for the fi nals at the state meet in 2013.

Eli has also helped the Rockets win two consecutive district titles in track af-ter not having won the crown since 1985. She’s been part of three relay teams that won district titles and the 4x400 relay won a regional title in 2014. At some of the dis-trict meets, Eli, who also places routinely in the 200 and 400, has forgone competing in some individual events to fully invest in running the relays, a sign of her selfl essness and commitment to the program.

Eli, who earned three letters as a vol-leyball player and has been part of that pro-gram’s rebuilding process, also won a dis-trict title with the basketball team, but it’s as a runner where she truly excels.

“Track is the one sport where I’m fully and completely confi dent in my abilities. Nothing else really matters except for getting that gold (in track),” she said. “Not only for myself, but for my teammates, too. Don’t get me wrong, I love basketball and volleyball, but track has given me amazing and reward-ing experiences that I will never forget.”

Eli is that rare breed of athlete, one who will have 10 varsity letters when it’s all said and done. She participates in three sports when she could specialize in one, a further indication of how much she wants to represent her school to the fullest.

Motivation is not in short supply in the Eli household. Her father, Art, a local leg-end, played baseball at Bowling Green State University and was a teammate of Indiana basketball great Steve Alford’s at Chrysler High School in New Castle, Indiana in the 1980s.

Athena’s older sister, Simone, starred in basketball, cross country and track at Genoa before going on to play basketball at Bowling Green State University, graduating in 2013. Simone currently works as a sportscaster for KPRC, the NBC affi liate in Houston.

Their brother, Nolan, golfed at Trine University in Angola, Indiana and anoth-er brother, Connor, was a standout soccer player at Oak Harbor who currently works as a student assistant coach with the BG women’s basketball team. Athena’s young-er sister, Sophia, is a good basketball player as well.

“Motivationally, my siblings and my father have had a huge impact on my drive to run track in college. The experiences they each had made me want that, too,” Eli said. “I’ve always strived to be the best, and having my siblings there to push me along with my dad has shaped me into the athlete and person I am today!”

Eli had high praise for her track coach, John McKitrick, who has built something special at Oak Harbor, winning seven league titles in the last eight years.

“He believes in everyone and gives ev-eryone the opportunity to gain a spot on a relay or in an event,” she said.

Woodville is a Charming Village Steeped in History

Firmly Grounded in the Present and Moving Toward an Exciting Future

Come Home to Woodville!

Glen A. Davis

D.D.S.

Family Dentistry

New Patients

Welcome

109 N. Elm St.

Woodville

(419) 849-3771

Hours: Tues. 11:00-7:00

Wed./Thurs. 9:00-5:00

Fri. 9:00-2;00

Member A.D.A./O.D.A.

Burgers - Hot Dogs - Ice-Cream - Breakfast Prime Rib

Daily Specials Daily Specials

125 West Main Street (Route 20)Woodville, OH 43469

One Trusted Office for All Your Dental NeedsCaring & Courteous Staff • Low-Radiation Digital X-Rays

419-849-2641 • www.WoodvilleDentalCare.com

Trusted, Comfortable & Caring Dentistry

© c

hris

ad 2

015

Village Village BarbershopBarbershop

Walk-InsWelcome

119 W. MainWoodville419-849-2320

Tues., Wed. - 8:30 - 5:30Thurs. 8:30 - 7:00

Fri. 8:30 - 4:00 Sat. 7:00 - 2:00

Closed Sun. & Mon.

Under New Ownership Judy Karchner

115 Water St., Woodville, OH419-849-2009

Open Tuesday thru Saturday

Offering Professional Services and Outstanding Hair Care with Stylists;

Cheryl Emch, Nina Gutierrez, Angie Costantini, Angelica Rozzi Earley and Nail Tech Jasmine Reineck.

UnlimitedTanning

January Specials with Stylist

Angelica Rozzi Earley

Angelica is available for walk-ins & Appointments Wednesday, Friday & every other Saturday

$5.00 OFF Any Color or Partial Hi-Light$10.00 OFF

Full Hi-Light

$30.00+ tax

For One Month

•Designer Frames•Contact Lenses•Diabetic, Cataract & Ocular Disease Evaluations & Treatments

Emergency Care AvailableMost Insurances Accepted

Dennis Laub, OptometristNicholas Peiffer, Optometrist

Terri Kruse, Optician

107 S. Walnut Street, Woodville419-849-3811

www.woodvillefamilyeyecare.com

“Personalized Small Town Care”

Daily Lunch Specials 11:00 til Gone

Sunday Coney Dog Special & Bucket of Beer

Monday 50 Wings 5:00pm-Gone

Taco Tuesday - All Day

Thirsty Thursday - Drink Specials 5-9

Friday Caveman Food Specials 5:30-Gone

¢

115 E. Main St. Woodville

Jo Jo’s

Nite ClubWoodville

Check Us

Out...

Check Us

Out...Something’s

Always Happening!

• Live Bands

• Fish Fry

• Karaoke

• Drink Specials

The Woodville

Historical

Museum

The Woodville

Historical

Museum

107 E. Main St., Woodville

The Museum can open by

Special Request.

Contact the library for number.

FREE Admission

OPEN Wed. & Fri.

2:00-4:00Last Day 12/18

Reopen 3/2

Original Photos can be

copied & returned if preferred.

For more info contact

Mike O’ Connor 419-849-2349

Original Photos can be

copied & returned if preferred.

For more info contact

Mike O’ Connor 419-849-2349

We are lookingfor old photos of

Woodville.

We are lookingfor old photos of

Woodville.

GRANNY'S KITCHEN 1105 Main St.

Woodville

419-849-2203DEBITCARDSMon. - Sat. 7am-7pm • Sun. 7am-2pm

Lunch & Dinner $6.95

Tuesday & Wednesday

Mon. Meatloaf or Creamed

Chicken over Biscuits

Tues. Baked Mushroom Steak

or Beef & Noodles

Wed. Ham & Scalloped Potatoes or

Goulash

Thurs. BBQ Ribs or Veal Parmesan

Fri. AYCE Fish ($9.95) or Roast Beef

Sat. Liver & Onions or Fish

Sun. Baked Chicken or Veal

99 Desserts¢

Homemade Daily Specials!Homemade Daily Specials!

Call Judy or Wendy 419-849-3994

Judy’s Pet Grooming, LLC

Main St. • Woodville

Vet Recommended

We’ve Served Your Pets For Over 53 Years

~Trust Your Pet Needs to Us~

& Pet Grooming by Wendy

CoConveniently

Located In

Downtown

Woodville...Shop While You Wait!

Next Day

Appointments

Available

Wed. -Fri. 10am-5pm • Sat. 10-4Wed. -Fri. 10am-5pm • Sat. 10-4330 W. Main St., Woodville

419-350-0720

10% OFF Any One Item10% OFF Any One Itemwith this adwith this ad

A Unique Little Gift A Unique Little Gift Shop with Something Shop with Something

for Everyonefor EveryoneLocally Handcrafted Gifts

& Holiday Decor

Novelties & Novelties & Nostalgia Nostalgia

Fresh Baked Artisan Breads

by Healthy BakesEvery Wednesday in Jan. & Feb.20% OFF All Christmas

~Except Snowmen~

Novelties & Novelties & Nostalgia Nostalgia

PILLS ‘n’ PACKAGES100 E. Main St. • Woodville

419-849-2781

20% OFF Thru January 31st

Hand & Body LotionBar Soap

Pharmacy & Fine Gifts

305 W. Main St. Woodville, 419-849-3600 solomonelementary.com

Enrolling for 2016-17Pre K - 6th grade

Small Classes • Affordable Tuition • Individual AttentionSmall Classes • Affordable Tuition • Individual AttentionArt & Music • Strong Academics • Youth AthleticsArt & Music • Strong Academics • Youth Athletics

State Licensed TeachersState Licensed TeachersBefore & After School Extended CareBefore & After School Extended Care

Home School ProgramHome School Program

Attention!!

We are now

accepting

4 year olds

for tumbling,

tap & ballet.

We are now

accepting

4 year olds

for tumbling,

tap & ballet.

121 E. Main Street

Woodville, Ohio

419-704-4407

www.taylorstnt.com

Taylor’s Tae Kwon DoTumbling & Dance

Homeschoolers:

New Daytime

Tae Kwon Do Classes

850 Water Street, Woodville419-849-3561 • Mon.-Fri. 8-6, Sat. 8-5

JANUARYBARGAINSBARGAINSBARGAINS

Sale ends 1/31/16Find the right tools and supplies for your

projects and expert, local advice.

20-Gal. Storage Tote With snap-tight lid. Choose blue or green. W 205 477, 478 B8 While supplies last.

497SPECIAL PURCHASE

YOUR CHOICE

20-Gal. Black Storage Tote With snap-tight lid. W 205 479 B6 While supplies last.

397SPECIAL PURCHASE

66-Qt. Latch Storage Box Blue, pink or green tinted bases with matching lids and latches. Clear base with white lid and blue latches. W 138 463, 460, 464; 501 876 F4 While supplies last. Contents not included.

699YOUR CHOICE

®BARGAINS MONTHof the

011

7992-Gal. Plastic Gas Can H 715 573 B6 While supplies last.

HOT DEAL!

2-Pk. 6.3W or 9.8W LED Bulbs E 205 456, 457 B4 While supplies last.

599HOT DEAL!YOUR CHOICE

199947-Lb. Dry Dog Food H 161 096 1 While supplies last.

HOT DEAL!999YOUR CHOICE

20-Lb. Black Oil Sunflower Bird Seed L 106 363 1 While supplies last.

40-Lb. Wild Bird FoodL 129 284 1 While supplies last.

HOT DEAL!

844YOUR CHOICE

Allergen Defense Air Filters Choose from 16x20x1,16x25x1, 20x20x1 or 20x25x1. F 395 830, 913; 396 143, 291 F6While supplies last.

SAVE 30% or more

999YOUR CHOICE

16-Pk. AA or AAA Coppertop Alkaline Batteries E 137 963, 962 B12 While supplies last.

SAVE 20% or more

8-Pk. C, D or 4-Pk. 9V Coppertop Alkaline Batteries 10.99 Your choice E 850 633, 605, 674 B12 While supplies last.

Your auto is taken care of if something should happen to it

But what if something happened to you?Is your family protected?

All policies are underwritten by Grange Life Insurance Company, Columbus, OH. Not available in all states.

Call 419.849.2000 or visit wittkampinsurance.com.

THE PRESS JANUARY, 11, 2016 17


12551 Jefferson

(across from Levis Commons)

Perrysburg, Ohio 43551

Phone: 419-873-0433

artisticmemorials.net

[email protected]

“Wood County’s only Full Service Monument Company”

��

Monuments • Markers • Bronze • Cemetery Lettering

Jeff Pettit 1-866-TOMBSTONE (866-2786)

Stop out early for best selection

Must be paid in full at time of order

Expires 1/30/2016

20% off all stones in stock

5552 Woodville Rd.

Northwood, Ohio 43619

Phone: 419-693-0433

525 SR 635, Helena, OH ~ 419-638-5411Located 7 miles West of Fremont on St. Rte. 6. Then 1 mile South on St. Rte. 635

Winter hours: Thurs., Fri., Sat. 2 pm-10 pm

Live Entertainment every Thurs., Fri. & Sat. 7pmVisit our website for details

www.chateautebeauwinery.com

Chateau Tebeau Winery~Tours~Tasting Room~Menu~Entertainment~

Award Winning Wines and Craft Beer

TacoBar

Every

Thurs.

Tues. 1/19 6-8pm4 wine glasses $40/pp

All materials supplied

Wine & Paint Parties

Call for your advance ticket • 419-572-0796 Menu & Cash Bar Available

Wed. 1/20 6-8pmPaint a Canvas $40/pp

Perfect for beginners

525 SR 635, Helena, OH ~ 419-638-5411525 SR 635, Helena, OH ~ 419-638-5411Located 7 miles West of Fremont on St. Rte. 6. Then 1 mile South on St. Rte. 6355

iWi tntntererer hhhououoursrsrs::: ThThThurururss.s.,, FrFrFrii.i.,, SaSaSatt.t. 222 pmpmpmp -1-11000 pmpmpmp

e Entertainment every Thurs., Fri. & Sat. 7pmVisit our website for details

y ,y ,

www.chateautebeauwinery.comwww.chateautebeauwinery.com

Tours Tasting Room Menu EntertainmentTours Tasting Room Menu EntertainmentAward Winning Wines and Craft BeerAward Winning Wines and Craft Beer

WiWiWintn e

LiLiLLiLLiLLLLiLLiLiLiLLiLLLiLLiivevvvTacoBarBarBarBar

Every

Thurs.

Tues. 1/19 6-8pm4 wine glasses $404

p/pp

All materials supplied

Wine & Paint Parties

Call for your advance ticket • 419-572-0796 Menu & Cash Bar Available

Wed. 1/20 6-8pmPaint a Canvas $40

pp/ppp

Perfect for beginners

By Mark Griffi nPress Contributing [email protected]

Carly Gose is living proof that looks can be deceiving.

If you saw her at the mall or the movie theater, for instance, you’d fi gure the 5-foot-4 blonde, blue-eyed Gose was just another teenage girl. Something happens, however, once the Genoa senior guard steps on the basketball court. That’s when she turns into a Tasmanian devil.

Genoa coach Mike DeStazio said coaching Gose is like having an assistant coach on the fl oor.

“She’s not only fast, but she’s quick,” DeStazio said. “Another factor is her bas-ketball IQ. She just knows so much about basketball that she even helps the other players get in position defensively to stop something, probably as much as I do.”

Gose set a single-season school record for steals last season, with 146, and earned honorable mention all-district honors. She has 322 steals for her career, second all-time in school history behind senior team-mate Haley Pickard (402).

“My anticipation is really good,” Gose said. “I kind of watch the players’ eyes and read where they’re throwing the ball.”

The veteran Comets improved to 10-2 and 7-0 in the Northern Buckeye Conference following Tuesday’s 48-42 win over Lake, Genoa’s ninth straight victory. Gose does not fi ll up a stat sheet offensively – she’s averaging fi ve points a game — but her effort shows up in other areas.

Gose had fi ve steals against Lake and is averaging 7.7 steals a game. She had 14 steals against Fostoria and 12 steals in a 32-point rout of Hopewell-Loudon.

“I want to play good defense, get a lot of steals and help my team in any way I can,” said Gose, who averages 5.4 re-bounds. “I think I’ve always been that way. I don’t keep track of my steals during a game. I look at it on the stat sheet after a

Looks can be deceiving when sizing up 5-foot-4 Gose

Genoa guard Carly Gose puts up a three-point shot as Oak Harbor sophomore guard Abby Dornbusch defends. (Press photo by Russ Lytle/Facebook.com/RussLytle/RHP)

game. I just try to play the best defense as I can. I stay low and use my feet a lot and try to use my hands.”

DeStazio recalled one play this season

that best described Gose’s basketball savvy.“After we score, she was running back

down the court and she saw that there was only one girl who could take the in-bounds

pass,” DeStazio said. “She goes into total (ball) denial, on her own, and stole the ball and got a layup. She read that because she looks down the court. She got the (oppo-nent) in a denial position, stole the ball and got the layup. Even I can’t coach that quick.

“She’s the only kid I’ve ever coached who can go pick up man-to-man anytime she wants. She can play full-court man and drop back into a zone. She anticipates and reads the other team’s offense so well that she defl ects a lot of passes and also defl ects a lot of balls from behind. She almost puts you to sleep and then goes to steal the ball.”

Gose, who also excels in the classroom (3.8 GPA), said she gets her competitive-ness from her father, Mike.

“He played football, basketball and baseball at Genoa,” she said. “He always helps me whenever I need it. He coached me when I was younger (in grade school). He taught me everything I need to know. Coach DeStazio has helped me a lot over the years to become a better basketball player.”

Genoa starts four seniors and one ju-nior, but DeStazio calls out the defensive signals to Gose, who passes them along to her teammates. That doesn’t necessarily mean Gose has to play the defense that is called.

“I kind of decide what defense we run,” Gose said. “I can press on my own if I want to. He pretty much gives me free reign to do what I want. Sometimes me and the other girl up top, Emily Edwards, will press on our own and it kind of causes havoc up top.”

Gose plans to run cross country and track at Tiffi n University, where she will study criminology. Her brother, Casey, was an all-conference baseball player at Owens Community College last fall as a freshman.

“Carly is a great student, a great lead-er,” DeStazio said. “I’d call her a role-mod-el person. You would never see her in any bad situation or making bad choices. She’s a well-rounded student-athlete who has been raised by very good parents.”

The Press

Box

BOYS BASKETBALL

Team (League) Overall Cardinal Stritch (5-1, TAAC) 8 3 Waite (2-2, TCL) 6 5 Eastwood (3-2, NBC) 5 5 Gibsonburg (2-3, TAAC) 3 4 Genoa (1-3, NBC) 3 4 Oak Harbor (0-4, SBC) 4 6 Woodmore (0-4, NBC) 2 7 Clay (0-6, TRAC) 2 7 Lake (1-4, NBC) 2 9 Northwood (0-5, TAAC) 0 8

GIRLS BASKETBALL Oak Harbor (5-0, SBC) 12 0 Genoa (7-0, NBC) 10 2 Clay (4-2, TRAC) 7 3 Cardinal Stritch (5-2, TAAC) 8 4 Lake (5-2, NBC) 9 5 Northwood (3-3, TAAC) 5 4 Woodmore (3-3, NBC) 6 5 Gibsonburg (5-2, TAAC) 6 6 Eastwood (1-6, NBC) 3 9 Waite (0-5, TCL) 0 10

(Records updated to January 7)

Former Cardinal Stritch football player Bryan Gasser, who spent fi ve sea-sons on Matt Campbell’s coaching staff at the University of Toledo, has moved with Campbell to Iowa State, where he is in his fi rst season as wide receivers and special teams coach.

In Gasser’s fi ve-year tenure as an assis-tant at Toledo, the Rockets played in four bowl games and had four nine-win seasons.

Gasser was the tight ends coach and special teams coordinator in his last two seasons at UT. He previously served as the Rockets’ director of high school relations in 2013 where he helped the recruiting staff assemble the No. 1 ranked recruiting class in the MAC, according to Rivals.com and Scout.com. He also worked as a graduate assistant at UT in 2010 and 2012, primarily working with the tight ends.

In 2015, tight end Michael Roberts caught 18 passes for 188 yards and four TDs in the 12-game regular-season. The Rocket special teams play was also outstanding, ranking ninth nationally with two blocked punts and second in the MAC in punt re-turns (11.27). Punt return specialist Corey Jones was a fi rst-team All-MAC recipient, ranking 29th nationally in punt returns at 10.5.

In 2014, Gasser guided Rocket tight ends that were an integral part of Toledo’s offense, which ranked No. 1 in the MAC. Alex Zmolik caught 16 passes, including a career-best six in the GoDaddy Bowl. Roberts grabbed two TD passes in limited playing time, while Zac Rosenbauer was a key blocker in short yardage situations.

The Rockets ranked No. 1 in kickoff

coverage and No. 2 in punt return yards in the MAC in 2014 under Gasser’s guidance. UT also earned MAC West Special Teams Player of the Week honors fi ve times, three by placekicker Jeremiah Detmer and two by kick re-turner Jones. Detmer earned second-team All-MAC honors and fi nished his career as the most accurate fi eld-goal kicker in conference history (84.4 percent).

Also in 2014, four players under Gasser’s tutelage earned Academic All-MAC honors: long snapper Brad Spelman, Detmer, Zmolik and Rosenbauer.

In 2011, Gasser coached the wide re-ceivers and was co-offensive coordinator at Notre Dame College, a Division II school in South Euclid, Ohio. Gasser helped the Falcons set records in scoring, yards per game and passing yards per game.

Gasser played football at Ohio

Northern University from 2003-05, earning All-OAC and Academic All-OAC honors at tight end in 2005. He then served as an as-sistant coach at his alma mater from 2006-08, working with tight ends and running backs. He coached three All-OAC players in his three seasons at ONU.

In 2009, Gasser served as the offensive line/special teams coach at Otsego High School while completing his master’s de-gree in education from Bowling Green State University. Gasser is from Northwood and at Stritch he also played basketball and ran track. (— from Press fi le contributions by Mark Griffi n and Iowa State media reports)

Sports announcementsThe Oak Harbor High School cheer-

leading squads are hosting a mini-cheer clinic open to anyone in grades K-4. It will be 9-11 a.m. on Jan. 23 with doors opening at 8:30 a.m. at the OHHS auxiliary gymna-sium. Cost is $20 with checks payable to Oak Harbor Cheerleading Boosters. Bring two canned goods (not expired), which will be donated to the B-C-S Food Bank, and be entered for a free gift. Participants will get to cheer with varsity cheerleaders at the Jan. 29 boys home basketball game against Clyde. Registration includes snack, drink and t-shirt. Contact Melissa Neiderhouse at 419-898-6216.

**********High school softball umpiring classes

will begin later this month. To register, visit www.OHSAA.org and click on “becoming an offi cial.” Contact Bob Perrine at 419-351-1960, email [email protected] or John Meyers at [email protected].

Stritch’s Bryan Gasser joins Campbell’s staff at Iowa State

Bryan Gasser


Bulletin Board

Police BeatsPolice Beats

103 Years of Automotive ExperienceSee Rob Beaudion - Libby Lochotzki - Stacy Davis

Dunn’s Auto Body

Repair Center

• Free Estimates• All Work Guaranteed• Repair All Makes and Models• Rental Cars Available on Site• We Work with ALL Insurance Companies• Laser Frame Measuring System• Computerized Paint Matching System

55

Peter Nyktas aka Papou

Happy 87 Years Young on

January 27, 2016!

Love, your family

Your message runs in The Press for $20.00 with

color photo. Tues., February 9th at

5pm. Picture of your children, grand children, etc)

The Press 1550 Woodville Rd., Millbury

419-836-2221 Mon. - Thurs. 9am-5pm

Deadline

Jeffery,

I Loved you yesterday, I Love you still,

I Always have.... I Always will.

Happy Valentines Day! Love, Angel

Miranda is cooking up

something sweet!

Love you....

Grandpa Clay & Grandma Julie

Little Sweethearts

In Memory

Travis Lee Brown

6-25-1970 ~ 1-13-2015

After Glow

I’d like the memory of me to

be a happy one.

I’d like to leave an after glow

of smiles when life is done.

I’d like to leave an echo

whispering softly down the ways.

Of happy times and laughing times

and bright and sunny days.

I’d like the tears of those who grieve,

to dry before the sun.

Of happy memories that I leave when

life is done.

Love always,

Mom, Ray, Beth & Family

Our is

the perfect environment if

you have announcements

that deserve special

mention. Call The Press at

419-836-2221 and speak

to the Classified Dept.

about placing an ad.

Deadline is Wednesday at

4:00 p.m.

Transitions Page

Join us for a Great Meal!

419-833-3400 • 240 Main St., Luckey, OH 43443Open Tuesday - Sunday

SammieZ Restaurant

Sunday • 10am - 2pmAll You Can Eat Buffet

Friday • 11am - 8pmLake Erie PerchInnovations

Portrait Studiowww.visualimpact.com

Lake Twp.Crime log – A resident of Lakeland Drive on Dec. 26 reported the theft of personal items from his vehicle.• Darus T. Wright, 21, Taylor, Mich. was charged Jan. 2 with obstructing offi cial business and domestic violence after a disturbance at the Super 8 Motel, Latcha Road.• Shane R. Hutchinson, 21, was charged with disrupting public service Jan. 3 at a residence in

the 3700 block of Laketon Terrace.• Recreational vehicles and trailers were broken into Dec. 29 while parked at Mini Max Storage, Moline Martin Road.• Jessica Barnes, 36, was charged Jan. 4 with three misdemeanor counts of drug possession, one fi fth-degree felony count of drug possession and a misdemeanor count of assault after a disturbance at the Super 8 Motel, Latcha Road.

Bulletin Board policyAs a service to our community, Bulletin Board items are published at no cost, as space permits. The Press makes no guarantee that items submitted will be published. To ensure publication of events/news items, please speak to one of our advertising representatives at 419-836-2221. A complete listing of events is available at www.presspublications.com.

ElmoreBoard of Trustees of the Harris-Elmore Public Library Organizational Meeting will have an organizational meeting on Monday, January 11 at the Elmore facility, immediately following the meeting of the library records commission, which will be held at 7:00 p.m.Elmore Book Discussion Group meets the 4th Thurs. of the month at 10 a.m. at the Elmore Library. Storytime for Preschool-Age Children Wed. at 11 a.m. Call the library at 419-862-2482 for more info.

GenoaSnowman Craft & Wine Class, Jan. 15 and 18, 6:30-8:30 p.m., Brunner Campus, 1224 West St. Cost is $33. For info and registration, visit www.brunnercampus.com.Genoa Senior Center 514 Main St., serves lunch Mon., Wed. & Fri., 11:30 a.m. (call 419-855-4491 for reservations). Card playing Mon. & Wed. at 12:30 p.m.; blood sugar checks offered the 2nd Wed. of the month; bingo Mon. at 9:30 a.m. Trinity Thrift Shop, 105 4th St., Fri. 9:30 a.m.-4 p.m. & Sat. 9 a.m.-1 p.m. Clothes & small household items available at reasonable prices. Proceeds benefi t mission projects.Genoa Community Food Pantry Open monthly on the 3rd Saturday of the month 10 a.m.-1 p.m., Christ Community Church, 303 W. 4th St. Serving those who are in Genoa School District. Proper ID and billing address within the district required. For more info, call 419-341-0913.

GibsonburgGibsonburg Public Library, 100 N. Webster St., programs include: Preschool Storytime Thursdays at 11 a.m.; Cookbook Club, Jan. 11, 6:30 p.m. – bring treasured recipes and a dish to share; Book Bears: Early Readers, Jan. 14, 11:45 a.m. – “Henry and Mudge and the Snowman Plan,” by Cynthia Rylant; Transportation and the “Lay of the Land,” Jan 20, 6:30 p.m. – learn the relationship between Northwest Ohio’s geographic location and its growth as presented by Donna Christian; LEGO Club (K-6) the 4th Sat. of the month at 10 a.m.; Adult Book Discussion, Jan. 25, 6:30 p.m. – “Reluctant Hero,” by Michael Benfante; “Book and Munch Bunch: Chapter Books, Jan. 27, 4:30 p.m. – “The Wright Brothers: How They Invented the Airplane,” by Russell Freedman”Active Seniors invited to Meet & Eat at Gibsonburg Senior Center, 100 Meadow Lane. Lunches every weekday, educational and social programs, health assessments and more. Transportation and home-delivered meals available. 419-637-7947.

Lake Twp.Ageless Wonders will meet at The Skillet, 101 S. Main St., Walbridge, on Jan. 14 at 12:30 p.m.Bluegrass Music Night, Jan. 15, 6:30 p.m., Lake Twp. Administration Building, 27975 Cummings Rd. Featuring music by Ottawa Co. Bluegrass. Sponsored by Friends of Lake Twp. Parks. Freewill offering will be taken. Hot dogs, sloppy joes, coffee

and pop available for purchase. Contact Ron Hanely at 419-392-3235 or email [email protected] for info.Mobile Food Pantry sponsored by the fi re department auxiliary every 3rd Mon. of the month, 5-7 p.m., Fire Station 1, 4505 Walbridge Rd.

LuckeyLuckey Food Pantry is open the last Wed. of each month from 1-3 p.m. and the last Thurs. of the month from 6-8 p.m. in the old Town Hall building, corner of Krotzer & Main Street. Open to families residing in the Eastwood School District.Luckey Library Storytime for ages 3-7 every Wed. at 6:30 p.m. Includes stories, fi nger plays, music & crafts. Lego Club (K-5th grade) Mondays 4:30-5:30 p.m. Men’s Shoot-the-Bull gatherings Mondays at 9:30 a.m. Coffee provided. No registration required for any of the programs. Home delivery of library materials to home-bound Luckey residents is available by calling the library during regular hours at 419-833-6040.

Oak HarborOak Harbor Conservation Club 19th Annual Gun Show/Swap Meet, Jan. 17, 975 S. Gordon Rd. Chili lunch available. $3 admission. Call 419-862-2335 for table reservations.Ottawa Co. Board of Developmental Disabilities Monthly Board Meeting Jan. 25, 5 p.m. at the board offi ce, 235 N. Toussaint South Rd. Open to the public. Call 419-898-0400 for info.

PembervillePublic Dinner, Jan. 16, 4:30-6:30 p.m., at Pemberville United Methodist Church, 205 Perry St. Featuring a choice of ham or meatloaf, potato, vegetable, salad bar, homemade dessert, roll and beverage. Carry-outs available.Pemberville Area Senior Center at Bethlehem Lutheran Church provides programs & activities for adults 60 & over. Open 10 a.m.-2 p.m. M-F. Lunch served at noon.Community Food Pantry at Bethlehem Lutheran Church, 220 Cedar St. open M-Th, 11 a.m.-2 p.m. (excluding holidays). Open to Eastwood School District residents. ID & proof of residency required. Info available at Pemberville churches.

WalbridgeCabbage Roll Dinner, Jan. 16, 5-7 p.m., Walbridge VFW Post 9963, 109 N. Main St. Includes potato, salad bar, roll & butter and dessert. Cost $10. Food Bank open the 2nd Wed. of each month from 4-5 p.m., Athens Baptist Church, 101 W. Breckman (behind the bank).Walbridge Branch Library, 108 N. Main St., offers the following programs; Family Storytime – Tues. at 11 a.m.; play pinochle (16 and older) every Thurs. at 11 a.m. All programs are free. Call 419-666-9900 or visit cdpl.org.

Woodville Woodville Public Lib rary, 101 E. Main St., offers Storytime, Mon. at 7 p.m.; Lego Club (K-6), 1st Sat. of the month, 10-11:30 a.m.. Download 5 free songs each week at birchard.freegalmusic.com/users/sndlogin. For info, call 419-849-2744.WSOS Woodville Senior Center, located in the Woodville Twp. Fire Hall, is open Monday-Friday, 10 a.m.-1 p.m. Lunch is served at 11:30 a.m. and is open to ages 60 years and older. Reservations are required and can be made by calling 419-849-3636. Home-delivered meals are also available for homebound seniors.

PRESSThe


P.O. Box 169 • 1550 Woodville, Millbury, OH 43447

Since

1972

Looking for a way to complement your weight loss program, but

lack the incentive to start walking? Try a Press walk route.

Call Jordan (ext. 32) at 419-836-2221 or 1-800-300-6158.

(Wages earned and calories burned will vary according to route size).

MOVE IT AND LOSE IT

WITH A PRESS ROUTE

BradSutphin

[email protected]

419-345-5566

BUYING - SELLING - ESTATES - AUCTIONS

Search thousands of locations at: RealtyValueOhio.comLISTING & SALES

LEADERS 201526 YEARS NEGOTIATING

EXPERIENCE

Real Estate419-836-2221 or 1-800-300-6158

www.presspublications.com

Homes for SaleInvestment PropertyFor RentAuctionsLots and Acreage

Commercial For RentCommercial PropertyOffice Space For RentShare House/Apartment

Deadline: Thursdays at 1:00 p.m.CLASSIFIED DEPT. CLOSED FRIDAYS

Real Estate

419-836-2221 or 1-800-300-6158 www.presspublications.com

The Press Newspaper reserves the right to reject any advertising material

we deem unacceptable. Please check your ad upon first insertion for

accuracy. The newspaper will assume responsibility for the first

publication only. Compensation will be in the form of ad space or credit,

not to exceed original cost of the ad. NO REFUNDS.

Bob McIntosh“Pick the Best”

419-260-9350Em: [email protected]

Website: Bobmcintosh.info

Over One Thousand closed transactions

“Put my people pleasing experience to work for you”

23205WE - NEW LISTING. 3 bed 1 bath. Quiet countryroad. 4 lots!! IL#59074. Christie Wolf 419-345-3597.20865O - NEW LISTING. Large Brick ranch 3 Bed 1½ BathAttached Garage + barn! IL#56964. Christie Wolf 419-345-3597.1961SF - NEW LISTING. New Const 4 Bed 2½ Bath,Master w Tile, Open floor plan, Lg Kitchen & Great Rm. .62acres. IL#55464 Tom Smith 419-343-8553.5146H - NEW LISTING. Come see this 3 bed 1½ StoryWest Toledo Gem. Motivated seller. IL#55444 Rick Howell419-461-1187.409S - 125x150 building lot with public water, sewer & Natgas avail. IL#54414 Terry Floro 419-270-9667.INFOLINE 419-539-1020 24 HOURS A DAY! If there is aproperty you are interested in, call and enter the 5 digitInfoline number (IL) above.

Thousands of Homes . . .

One Address

419-691-2800

www.danberry.com

BATDORFF REAL ESTATE, INC.

149 Church St., Oak Harbor, OH(419) 898-9503

www.batdorff.com

Trust the oldest and most experienced

real estate company in town with your

sale or purchase - over 170 combined years

of real estate sales in our area!

1790 N Walker Street, GRAYTOWN - $334,000NEW PRICE!

COUNTRY KEG! Chanceof a lifetime to be your ownboss! Great investment orlivelihood. This local restau-rant / bar is a fully equippedturnkey facility! Beautifullyrenovated inside & outside in 2006. Call Jerry Schultz 419-261-0158 or Cherie Salazar 419-707-1088.

www.batdorff.com

GO TO www.nwohomes.com

To view all our listings and more!!

Tim McCrory Realtor®

419-343-7798

[email protected]

2300

Navarre Ave #150

Oregon, Ohio

43616

639 N Stadium. . . . . . . . . . . . .

Brick ranch, 3 beds, basement

1714 Mahala. . . . . . . . . . . . . .

3 beds, 2 car garage, Large lot

21875 Middlesex. . . . . . . . . . .

Brick Ranch, over sized garage

11059 Riverbend Ct. . . . . . . . .

Condo, 2 bed, 1.5 bath

202 S Main St . . . . . . . . . . . . .

1.5 sty, 3 bed, 1/3 acre lot

3060 N Leutz . . . . . . . . . . . . .

4 bed, 1984 sq ft, 1.43 acres

875 Kingston . . . . . . . . . . . . .

3 bed, some updates

Oregon

Oregon

Genoa

Perrysburg

Walbridge

Oak

Harbor

East

Toledo

$129,900

$89,900

$75,000

$124,900

$35,000

Pending

Pending

— OPEN HOUSE 1/10/16 1:00 TO 3:00 —324 Mary St, Northwood Ohio – Asking $49,000

3 bedrooms home with some updates. Features include large eat in kitchen, 2 car garage, deck, and more.

VISIT www.nwohomes.com

For photos and more info on these homes

Andrew McCrory Realtor®

567-868-3942

[email protected]

��

��

19140 CurticeEW,Curtice

Over 2.5 acres, ranch, full

basement, pole barn, open

floor plan. Rural living

Mary Ann Coleman

419-343-5348

Featured Property!

Excellent Properties!

792 Elk Ridge, Northwood

$319,900

1105 S. Coy, Oregon

$229,900

100 Birchdale, Perrysburg

$161,900

703 Highland, Rossford

$139,900

461 Winter, Elmore

$114,900

630 Donovan, Curtice

$99,900

416 Superior, Genoa

$84,000 (Duplex)

642 Penn, Woodville

$20,000

0 Woodville, Millbury

$200,000 (Vacant Land)

Huron Street, Elmore

$59,900 (Building Lots)

PENDING! PENDING!

2121 Alvin, Toledo

7039 Curtice, Curtice

8083 Titus, Oak Harbor

2643 Eastmoreland, Oregon

5517 Brook Point, Toledo

29678 Carnoustie, Perrysb

4430 Williston, Northwood

4756 N. Teal, Oregon

352 Lincoln, Elmore

2735 119th, Toledo

SOLD, SOLD, SOLD

127 Springwood E., Oregon

29747 Gleneagles, Perrysburg

517 Indian Valley, Rossford

6380 Harris Harbor, Oak Har

3500 Bayberry, Oregon

1602 Norcross, Oregon

2707 Arthur, Oregon

1929 Garner, Oregon

18600 SR 105, Elmore

1763 Genoa-Clay, Genoa

3143 Starr, Oregon

8946 Canada Goose, Oak H

419 High, Woodville

��

��

Move-In Special!6 months free lot rent on

select homes (for a limited time)

2 & 3 bedroom, singles & doublesBank financing available.

Lot rent b/t $200-$220/mo.Contact Walnut Hills/Deluxe

Mobile Home Park419-666-3993

��

��

Woodville, Ohio condo, 1486 sq.ft.Ranch on crawl. 2-bedroom, 2 fullbaths, fireplace, 2-car garage, on culde sac. Maintenance-free deck. 419-973-5612.

800 Challenger, Woodville 3-4 Bedroom, 2 full, & 2 half

bath, w/full basement! Only $193,000 !!

101 E. First, Woodville 4 Bedroom, 2 1/2 bath,

Historic one of kind home on a corner lot!

Must See! $135,000

306 Depot St., Woodville 3 Bedroom, 2 full baths,

remodeled, central A/C, new floors & huge deck

Only $84,000

518 S. TOLEDO ST., ELMORE 3 Bedroom 1 1/2 bath, re-modeled, new windows,

central A/C & fresh paint Only $72,000

20320 Dunbridge, Perrysburg County Life! 3 Bedroom, 2

bath ranch on over an acre! $147,500

731 Gawil, Toledo 3 Bedroom, 2 bath ranch on over 1/2 acre with 2 garages,

Completely remodeled! Only $49,900

339 N. Buchanan, Fremont 1 1/2 Story, 3 Bedroom, 2 bath, with bonus room

Only $66,000

5553 301st St., Toledo 3 Bedroom, remodeled 2

Story in Point Place $53,000

Thousands of Homes

...One Address…

We Make It Worry Free!

��

��

*** PUBLISHER'S NOTICE ***

All real estate or rental advertis-ing in this newspaper is subject tothe Fair Housing Act. As amend-ed, prohibits discrimination in thesale, rental, and financing ofdwellings, and in other housingrelated transactions, based onrace, color, national origin, reli-gion, sex, familial status (includ-ing children under the age of 18living with parents or legal custo-dians, pregnant women, and peo-ple securing custody of childrenunder the age of 18), and handi-cap (disability).To complain of discrimination callHUD toll-free telephone number1-800-669-9777, for the hearing

impaired is TTY 1-800-927-9275. *Equal Housing Opportunity*

North Toledo-2 bedroom bungalowwith garage, excellent rental propertyor starter home, long term tenants.$15,000 OBO. 419-360-4120

Waterville Historical duplex for sale. Spacious 2-3 bedrooms,

appliances, storage, separateyards, additional storage

available in barn. 419-261-3949

Dawn Betz-

Peiffer

41 years of Full-Time Experience

THANKS TO MY CLIENTS FORANOTHER GREAT YEAR!!— SOLD in 2015 —180 N. Goodyear - Oregon1308 Oaktree Ct. - Oregon2508 Hollydale - Oregon619 Brynhaven - Oregon

2306 Taft - Oregon610 Parkway W. - Oregon

3302 Eastmoreland S. - Oregon4121 Brown Rd. - Oregon4253 Pickle Rd. - Oregon557 Parkway W. - Oregon1442 Eastland - Oregon1705 Coy Rd. - Oregon

3932 McArthur - Northwood4880 Applewood - Northwood

1932 Lear - Northwood21330 W. Toledo St. - Williston

28526 Main St. - Millbury28998 Main St. - Millbury

25316 Pemberville Rd. - Lake Twp.30246 Bradner - Lake Twp.29000 Greystone - Millbury28306 Brookside - Millbury

22811 Cedar - Curtice24383 W. Curtice E & W - Curtice

101 Cedar Ct. - Walbridge21640 Hellwig - Genoa

502 West - Genoa24815 Young Rd. - Genoa14878 SR 163 - Elmore

17729 Ravine Dr. - Elmore761 Nottingham - Genoa

8310 Sycamore Woods - Holland6741 Prov-Neap-Swan Rd - Swanton

3617 Bellevue - ToledoThinking about Selling this year?Call Me! 419-346-7411

� ��

��

OPEN 24 HOURS

EVERYDAY!

3 easy steps to place

your ad...

1) go to our website at

2) click on classifieds

3) click on classifieds form


The Press Classifieds

��

��

Real Estate for Sale

For Sale

27967 Southpoint Dr.

Millbury, OH. 43447

6661 N. Thistledown

Curtice, OH. 43412

23700 Pemberville Rd.

Perrysburg, OH. 43551

1706 Idaho St.

Toledo, OH. 43605

204 Second St.

Genoa, OH. 43430

0 W. Walbridge East

Curtice, OH. 43412

9033 Jerusalem Rd.

Curtice, OH. 43412

2.88 acres

10050 Corduroy

Curtice, OH. 43412

418 Beachview

Reno Beach

Townhouse 2 units

$159,900.00

$259,000.00

$229,900.00

$24,500.00

$109,000.00

1.03 acres $23,900

40 acres $389,000.00

$32,000.00

10 - Lots $6,000.00

Lots & Land

Ohio Real Estate

Auctions LLC

Ken Belkofer

419-277-3635

20 THE PRESS, JANUARY 11, 2016


Dishwasher - Bartender - Hostess - Line CooksApply in Person

Smokey’s BBQ Roadhouse2080 Woodville Rd Oregon

HELP WANTEDALL POSITIONS

RETAIL - Family Farm and Home, a family owned

and operated retail company, committed to

supplying the rural lifestyle will be conducting open

interviews for a new Northwood, OH location.

For more information and applications please

visit familyfarmandhome.com.

All other applications can be mailed to

Family Farm and Home

1392 S. Main Street, Adrian, MI 49221

You can also email applications to

[email protected]

We are an EOE with cashiering, sales and

receiving positions available.

Open Interviews will be:

Jan. 11 and Jan. 12

9am-5pm

Sleep Inn

1761 Meijer Circle

Oregon, OH 43616

Food for Thought lives and breathes by its volunteers. Here are a

few opportunities for you to join the team:

All of our food pantries are choice pantries, which create a

grocery store atmosphere, and we need volunteers to keep it

running effectively!

Food Pantry

Locations:

1st Tuesday of month - 1020 VarlandAve. - 2pm-4pm

2nd Tuesday of month- 798 S. Coy, Oregon - 4pm-6pm

2nd Thursday of month-2960 Pickle Rd, Oregon - 1pm-3pm

3rd Monday of month - 4505 E Union St, Walbridge - 5pm-7pm

3rd Tuesday - 2350 StarrAve, Oregon OH - 4pm-6pm

Last Wednesday of month - 11805 W. St. Rt. 105, Oak Harbor -

5pm-7pm

Every Friday night from 6pm-7:30pm we pack 350 brown bag

lunches for our Saturday morning picnics and we need your help!

There is no age requirement!

Every Saturday morning, we have a picnic with the unhoused of

Toledo. We meet across from the Main Library downtown (Adams

& Michigan) at 10am. This was and still is the heart of Food for

thought. Come join us! For more information, visit feedtoledo.org/

volunteer or email [email protected]

Friday Night Lunch Packing

Saturday Morning Picnic

Classifieds

Deadline: Thursdays at 1:00 p.m. 419-836-2221 or 1-800-300-6158

[email protected] (CLOSED FRIDAYS)

Delivered to 33,977 Homes, businesses and newsstands in Lucas, Ottawa, Sandusky & Wood Counties

The Press Newspaper reserves the right to reject any advertising material we deem unacceptable. Please check

your ad upon first insertion for accuracy. The newspaper will assume responsibility for the first publication only.

Compensation will be in the form of ad space or credit, not to exceed original cost of the ad. NO REFUNDS.

��

CREW WORKER II – GREEN SPRINGSPerforms home weatherization and

construction duties such as diagnostictesting and material installation.

$15.15/hr. Requirements, job description& application online at wsos.org.

Apply by 1/24/16. EOE

Intake Specialist – Green SpringsPerforms client intake for all programs,

completion of paperwork, data entry, andpreparation of client files. $12.70/hr.

Requirements, job description & application online at wsos.org.

Apply by 01/24/16. EOE

TRAVELER’SEXPRESS

Applicants will be considered for all conceptsApply @ Hardees.com/jobs

WyandotPlaza

419-855-7239

Hiring for All Shiftsand Shift Managers

Part time Positions Available

• Up to $9.00 per hour

to start

• Meal Discounts

• Flexible Hours

Turnpike Service Plazasare hiring for:

Blue HeronPlaza

419-855-3478

��

SALES OPPORTUNITYNABF College World Series mediapublications/sponsorship. Commis-sion only. Call 419-936-3887, leavename and phone number.

Visiting Angels is in need of care-givers for in-home care. Must haveflexibility and compassion. Validdriver's license and insured vehiclerequired. Stop by Monday – Friday,9am-4pm or visit :

visitingangels.com/toledo to apply. No certification required.

7110 W. Central Ave., Suite AToledo, Ohio 43617

419-517-7000

Walbridge AutomotiveI have an opening for a technicianexperienced in driveability. Give mea call at 419-666-3809 or stop in at30769, Drouillard Road.

Windsor Lane Health Care is seek-ing caring STNA's to come join ourteam, a 93 bed skilled facility thatcares for bariatric and geriatricclients. We offer competitive wagesand shift differentials, and willing topay for STNA classes. Come join ourteam. All interested parties applywithin @ 355 Windsor Lane, Gibson-burg, Ohio 43431. 419-637-2104(phone) or 419-637-2555 (fax).

TRAINCOTruck Driving SchoolsDay - Eve - Weekend Class

LOCAL JOBS - HOME DAILYPerrysburg 419-837-5730Norwalk 419-499-2222

��

NOW HIRING! We are having an Open Interview

Day on Monday (1/11) and Tuesday (1/12)

We will be looking for Full-Timeand Part-time Customer Service

Reps and Delivery Drivers2261 S. Reynolds Rd.

Toledo, OH 43614

Now taking applications for linecooks. Please apply within RayzCafe, 608 Main Street, Genoa.

Mon Ami Restaurant & Historic

Winery

JOB FAIRTues. January 191-3 and 5-7 PM

Join our Team!

Interviewing for

reliable, hard

working, positive

Kitchen staff,

bussers, servers,

bartenders, banquet

and

housekeeping.

Full Time/ Part Time

and Summer

positions.

Immediate

Interviews and

Hiring on the spot.

One day only ~

Apply in person

3845 East Wine

Cellar Rd

Port Clinton, OH

43452

or apply online:

monamiwinery.com/

employment/employ

ment-form.php

EOE

��

��

Mike's Hauling We buy junk cars, trucks and vans

Scrap metal hauled free. 419-666-1443

��

Cool Sports Company growing fast! Looking for hard

working, self-motivated, like to travel,make great money, franchising

opportunites as well, give us a call toset up an interview, ask for Eric.

Thanks, you're awesome.419.855.6218

Data Entry Specialist30-40 hours per week through taxseason. Previous experience helpful.Call 419-698-5185

Drivers: $3,000.00 OrientationCompletion Bonus!

Dedicated, Regional, OTR, Flatbed& Point to Point Lanes. Great Pay,

(New hires min $800.00/wk)! CDL-A1 yr. Exp.: 1-855-314-1138

Drivers: $4000 Sign-On Bonus!Excellent Pay, Comprehensive Ben-efits! Monthly Performance Bonus!Regional & OTR Openings. Class-ACDL 2yrs exp. Call Penske Logistics:1-855-206-6361

Drivers: CDL-A 1yr. GuaranteedHome Time. Excellent Pay Package.Monthly Bonus Program. 100% No-Touch. BCBS/Dental/Vision. Plentyof miles. 877-704-3773

Fast growing company needs production associates eager to

prove how good they are!! FreshProducts is moving to PerrysburgTownship in early 2016. Must have

a solid manufacturing work history, with a HS diploma or

GED. Applications being taken at4010 South Ave. Toledo between

9am-3pm Monday-Friday.

Goodwill has an immediate open-ing for a full-time Material Handler atits Transportation Hub in Perrysburg.Good attendance & punctuality, abili-ty to lift 50 lbs.+ on a consistent ba-sis, and ability to pass a drug testare necessary. Please mail resumewith cover letter to: 626 N. Huron,Toledo, OH. 43604, Attn: Sarah Se-mer.

Janitors Needed at Turnpike Plazain Genoa, Part-time shifts includingweekends. Starting rate $8.10 per/hr.must have clean background and re-liable transportation. Call 419-309-8664 Mon.-Fri. between 8am-5pm.

Laundry AttendantDependable part-time / hours vary

Apply in person between8am-7pm

The Laundry30600 Drouillard Rd.Walbridge, OH 43465

Mechanic- FTClear MVR

Experience preferredKnowledge of industry is a plus

Own tools is a plusPlease email resumes to

[email protected] Or Fax to: 419-837-9189Phone: 419-837-9126

NORTH TOLEDO FORKLIFT JOBS

OPEN INTERVIEWING

We are looking for 2nd shift forkliftpositions. Must be able to work up

to 10-12 hour shifts.

Starting Pay Rate is $10.00 per hour.Positions offer possibility of full time

hire with pay increase. Will need recent experience.

Come in and apply anytime Mon-Frifrom 9am-3pm. Bring 2 forms of ID

MANPOWER - 316 W. DUSSEL DR.MAUMEE, OH Call with any

questions 419-893-4413

��

TanglewoodLandings

Apartmentsin Woodville

UNIT AVAILABLE

For People 62 or Older

or Handicapped

Our Apartments are one

story and one bedroom

Rental Assistance Available

Pets

Are Welcome

Please call 419-849-3730 or our

TTY/TTD@ 1-800-750-0750“This institution is an equal

opportunity provider and employer.”

• Oregon Schools• No Deposit• No Gas Bill• Small Pets OK!• Storage Units On Site

Mon.-Fri. 9am-6pm, Sat. 11am-4pm2750 Pickle Rd., Oregon

Visa & MasterCard Accepted

419-693-9391

• 1 BED $400 • 2 BED $500

Starting At

Experience countryliving in the city.

Apartments

Piccadilly East

419-698-17173101 Navarre Ave., Oregon

A PLACE TO CALLHOME

• Swimming Pool• Basketball/Tennis Courts• Playground• 24 hour emergency

maintenance• Laundry facilities• Ask about our new

tenant specials— Featuring —1 bedroom $4052 bedroom $495

2 & 3 bedroom Townhomesstarting at $599

• Pool

• Oregon Schools

• Intercom entry

• Cat Friendly

• Washer/Dryer Hookups

1 bedroom apt. $4252 bedroom apt. $4952 bed. Townhouse $625

“ Make your fi rst Big Move!”

EASTWYCK APTS.3148 Corduroy Rd.

Oregon, OH419-691-2944

Your New Home for 2016

Ask about our specials!

featuringfeaturing

��

3200 sq. ft. storage building forrent, heated, insulated, $650/month,Walbridge Road near Bradner. 419-878-2426

��

��

Newly Remodeled!28 x 48 Schult

3 bdrm, 2 bath, Large lotAwning, deck, carport, shed

Lot Rent $220/mo.Bank Financing Available

Call Walnut Hills Mobile Home Park419-666-3993

��

*** PUBLISHER'S NOTICE ***

All real estate or rental advertis-ing in this newspaper is subject tothe Fair Housing Act. As amend-ed, prohibits discrimination in thesale, rental, and financing ofdwellings, and in other housingrelated transactions, based onrace, color, national origin, reli-gion, sex, familial status (includ-ing children under the age of 18living with parents or legal custo-dians, pregnant women, and peo-ple securing custody of childrenunder the age of 18), and handi-cap (disability).To complain of discrimination callHUD toll-free telephone number1-800-669-9777, for the hearingimpaired is 1-800-927-9275. *Equal Housing Opportunity*

2 Bedroom Townhouse, Wal-bridge, No Pets, $600./mo., + utili-ties. 419-508-1402

APARTMENTS IN OREGONOwner Operated

Quality at low prices!

Mountainbrook 2 bedroom, all electric,

appliances includedStarting at $495/mo. +utilities

Visit us on our website at:www.oregonarms.net

Call 419-972-7291 419-277-2545

East 3 bed Ranch style home,hardwood floors throughout, fullbasement, off street parking, fencedyard, central air, Raymer School. Nopets, $650/mo +deposit & Utilities.419-367-3561

East Side- 2 or 3 bedroom house,privacy fence, fridge included, W/Dhook-up, $550/month, 419-932-0503

EAST TOLEDO1-bedroom Upper $325/month

Big 2-bedroom upper $425/month3-bedroom lower $435/month

plus deposit and utilitiesFresh paint, new floors & carpet

appliances, no pets419-691-3074

East Toledo, Forsythe nearNavarre, 2 bedroom, living room,dining room, kitchen, W/D hookup,fenced in yard, $475./mo., + $475.deposit. 567-395-9300

Eastside 4 bedroom house, offstreet parking, no pets, $640/mo. +deposit. 419-350-0064

ELMORE- 2 Bedroom UpstairsApartment, W/D Hook-up, Stove,Refrigerator, C/A, Very clean, Nopets, $500/mo., 419-849-2449

GENOA Townhouse apartment, nopets allowed. $525/mo +Security de-posit. 419-862-3299

OREGON, 4 beds, 2 bath, air, base-ment, 2240 sq. ft., very nice!$1,225/mo. 419-691-3049

OREGON- 3 Bedroom Home, 31North Edwards, 2 Baths, 2 CarGarage, Full Basement, FencedYard, Appliances Included, No Pets,$1,095/Month +Deposit, 419-266-5793

ROSSFORD-Lewis Street, 2 bed-room apt., all electric, laundry roomin building, close to expressways,$520/mo. +deposit. 419-461-1427

Waterville Historical duplex for sale. Spacious 2-3 bedrooms,

appliances, storage, separateyards, additional storage

available in barn. 419-261-3949

WILLISTON2 Bedroom Apt.Genoa Schools

Electric, heat, water & garbage pickup included.$750.00 Security Deposit

$175.00 per week419-836-7461

Yorktown Village1 & 2 Bedroom

Townhouses & ApartmentsJoin Oregon’s Finest Community

★Laundry ★Swimming Pool★Spacious Floor Plans

★Private Patios★ 24 hr. Emergency Maintenance

419-693-9443

$99 Move In Special!

Spacious

1 & 2 Bdrm. Apts.

419-693-6682

(Next to I-280, close to

shopping & restaurants)

Call for new tenant rate

1105 S. Wheeling

COPPER COVE APTS.

THE PRESS, JANUARY 11, 2016 21

Thank Youfor ReadingThe Press!

Sell Your Items

FAST in the

Classifieds!

NOTICE FOR EARLY PUBLIC REVIEW

OF A PROPOSAL TO SUPPORT ACTIVITY

IN A 100-YEAR FLOODPLAIN

Date of Publication: January 11, 2016

To All Interested Agencies, Groups, and Individuals:

The City of Oregon is in the process of conducting an environ-

mental review for the PY2015 CDBG Community Development

Allocation Program for the Arkansas/Autokee Streets

Improvements Project: Flood & Drainage Facilities, Street

Improvements, and Water & Sewer Facilities. Federal funds

will be used for multiple improvements along Arkansas and

Autokee Streets between Bayshore Road and Lakeview

Avenue, including 100 LF of storm sewer, 4,216 LF of waterline,

12 hydrants, 7 water valves, 2 manholes, 3,720 LF of roadway,

20 LF of concrete driveway replacement and 100 LF of asphalt

driveway replacement. Project will occur in existing public

ROW.

This notice is required by Section 2(a)(4) of Executive Order

11988 for Floodplain Management and is implemented by

HUD Regulations found at 24 CFR 55.20(b) for any action that

is within and/or affects a floodplain. As currently proposed,

the project site will include areas designated as floodplain.

The City of Oregon’s alternatives regarding sponsorship of the

action would be:

1. Approval as proposed;

2. Disapproval;

3. Approval only if all improvements are located outside

of the floodplain;

4. Approval of an equivalent project site located outside

of the floodplain; and

5. Approval only if no fill is added in floodplain areas.

Additional information regarding the proposed action may be

obtained by contacting Ms. DarLynn Huntermark, Deputy

Finance Director, at 419-698-7012; via email at

[email protected]; or at the City of Oregon, 5330

Seaman Road, Oregon, OH 43616. Any interested person,

agency, or group wishing to comment on the project may sub-

mit written comments for consideration to the City of Oregon

at the above listed address by 4:00 p.m. on January 26, 2016.

Part-Time Positions,

Competive Wages & Benefits.

Candidates should

apply online.

Current openings:

EOE

We are hiring friendly faces!

• Bakers

• Cashiers

• Custodians

Are You Needing

to Pay Holiday Bills?

and

mypetrojob.com

Hiring Code 101

26416 Baker Rd.

Perrysburg

419-837-9772 ext. 31709

mytajob.com

Hiring Code 101

3483 Libbey Rd.

Perrysburg

419-837-5017

or call 1-(888)-673-8765

��

Cycleman We repair Chinese Pocket Bikes and Scooters,

and Mopeds, many parts available,

also repair motorcycles, Call Wed. - Sat. (11-5pm)

419-244-2525.

��

��

1994 Silverado, good condition,185k, $3,000 OBO. 419-345-7461

1995 Ram- Black, 2WD, 5.2, 5Speed, 105K, Needs water pump &front pad, Runs great, $1,200,Text/Call: 419-215-6728.

2013 Blue Toyota Tacoma- Extend-ed Cab, Back Cover, Excellent Con-dition, 25K Miles, $23,000, 419-862-2918

��

Burkin Self Storage

• Camper Storage

Inside & Outside

• Inside Auto Storage

• Personal Storage

St. Rt. 51, South of Elmore

419-862-2127

��

��

Tiger Kittens and Gray Kitten,need a loving home. Very loving kit-tens. Found in the wood pile. 3 - 9months old. They have been fixed.Donate $20 for Save a Pet. If inter-ested please call. Home: 419-698-5479 419-344-4803419-344-4109

��

��

FOUND- Large Solid Grey CatWith White Chest, Seen betweenWoodville and Brown Roads onGlenross Blvd. Oregon for the lastthree weeks. 419-691-4748

��

COLLECTOR CONDITION

1988 Plymouth Reliant

K Car

60,000 original miles

419-855-7038

��

� � ��

Cadillac Head Gasket RepairIs your Northstar engine losingcoolant? Have it tested free at TMZAutomotive. 419-837-9700.

��

� ��

2001 Buick LeSabre, tan, V-6, auto,154k, runs strong, too many cars,must sell, $2900 OBO. (567)277-4758

2002 Chevy Blazer, 4-door, 4-wheeldrive, A/C, PW, PL, good condition,runs great, $1,900. 419-836-8826

2006 Chevy Silverado, Reg. Cab, 8'bed, V-8, automatic and positraction,54,000 miles, $10,500/OBO. 419-270-0484

��

��

RYDER

Ryder is pleased to meet you! He was

transferred to Maumee Valley Save-

A-Pet from Lucas County Canine

Care and Control when he was two

years old. He was adopted quickly and

lived a wonderful life with his "dad" for

almost four years until financial

challenges forced his family to move

to a place that didn't allow pets and he

found himself back at Maumee Valley

Save-A-Pet. This big dog knows

commands like sit, down and shake

and he loves his crate. He is great with

kids but can not be around other dogs

or cats. Ryder would love to celebrate

his upcoming sixth birthday in a new

home with a family of his very own!

Stop by Maumee Valley Save-A-Pet at

5250 Hill Avenue (at Reynolds)

Wednesday through Saturday to meet

this handsome fellow!

��

� � ��

Get fast results!$5.00/week per item under

$2000. (15 words)

Reach over 34,308 homes & businesses

in our 2 publications, plus our website.

5 Finger

Call or Stop In to our Classifi ed

Department for more info on

The Five Finger Discount!

PRESSThe


Since

1972

419-836-2221 fax: 419-836-1319419-836-2221 fax: 419-836-1319

[email protected]@presspublications.com

Deadline

1pm Thurs.

Open M-Th. 9 to 5

��

Mag, 17” Flat Square Tube Moni-tor (15.9”VS) Still in Box, Neverused. $20.00. 419-836-9754

��

��

AKC Imperial Shih Tzu, Champion bloodline, vet checked,shots, wormed, paper trained. 1-Female (12 weeks old) $975 419-483-9404

CORAL

Miss Coral is ready to celebrate 2016

with a new family! This 1-2 year old is

super lovable, playful and acts like a

big puppy! She was brought into the

shelter as a stray, and she along with

many other lovable canines are all

looking to share their love with a new

family. Come meet them today at 410

S Erie St Toledo, 419-213-2800, open

Mon-Fri 11-7, Sat & Sun 11-5. If you

are missing a dog please come and

walk through the kennels. Stay up to

date with all the exciting happenings

and events at LCCC&C on Facebook,

and lucascountydogs.com. Share the

love and adopt a shelter dog today!

��

��

Rauworth Baby Grand Piano-$300.419-466-3330.

��

E35 Sole Elliptical, like new, 3years old. Very heavy, $1,000 419-261-1536

I BUY USED GOLF CARTS

CALL ANYTIME

SANDUSKY419-626-5053

Oak Harbor Conservation Club

19th AnnualGun Show/Swap Meet

Sunday, January 17, 2016

975 South Gordon Rd.

Oak Harbor, OH

Chili Lunch Available

$3 admission

Call for table reservations:

419-862-2335

��

Single bed with headboard, cleanmattress and box spring. Good con-dition. $50/OBO. 419-862-2640

��

9 quart Aroma Roaster Oven with 2pans for keeping food warm. $25.00419-836-4525

Hand cart, all heavy duty steel,1,000 lb capacity, large foot plate$10. 419-693-6840

��

� � ��

**TAMALES**Hand rolled, gluten free

no msg, all natural.$10/dozen

Nacho Danny 419-260-4107

Food Truck on SR 51 @ Reiman RdMonday-Sunday (3-5pm)

10 x 10 EZ Up Canopy- $50.00 419-836-4525

MAPLE TREES 4'-6' high, $5.00/ea.

Call 419-836-9754

��

��

I provide child care in my Millburyhome, I have references, non-smok-ing, free meals, CPR Certified, lotsof TLC. 419-836-7672.

��

A Mechanic looks at vehicles,pays accordingly, anythingw/wheels 419-870-0163

A Mechanic looks at vehicles,pays accordingly, anythingw/wheels 419-870-0163

We buy most anything fromyour garage! 419-870-0163

We buy most anything fromyour garage! 419-870-0163

��

Thanks St. Jude, Blessed VirginMary, St. Anne and all for prayersanswered. JAH

��

� ��

Do you need to speak with confi-dence or better clarity? Be our guestat the next Toastmasters ClubMeeting. No Classes - No PressureJust an inviting, supportive environ-ment. We all have similar goals. Come to Bay Park CommunityHospital the first and third Tuesdayof each month at 6:30 P.M. LakeMichigan Room. Visitors always wel-come. Call Ken for more info 419-266-8183 or check our local website:www.d28toastmasters.org and clickon Great Eastern Club.

��

��

*Plumbing *Painting*Cupboard Refinishing

*Window's *Doors *Siding*Masonry Repairs *Concrete.

419-307-0548

ATS PC, phone/tablet, electronicsrepair/service. Free Quote. I come toyou. 419-438-9095 bg-ats.com

HANDYMANElectrical Service Upgrades,

Plumbing, Woodwork, Painting,Member of BBB

Call 567-277-5333 (local)

Hardwood Flooring, Refinishing,Installation, and Repair Work.

20-yrs experience.Call Kyle 419-343-3719

RAY'S HANDYMAN SERVICES

Carpentry, Drywall Repairs, Painting, Siding,

Electrical Problems, Help for the Do-It-Yourselfer.

Small Jobs Welcome, 35+ Years Experience

419-836-4574/419-304-0583

��

KNIERIEMPAINTING & WALLPAPERING

EXTERIOR-INTERIORPainting & wall papering; Interiorwood refinishing; airless spray;power wash & blasting; silicone

seal; refinishing aluminum siding; residential; church, farm. 50+ YEARS EXPERIENCE

FREE ESTIMATES *SENIOR & WINTER RATES*

419-697-1230NORTHWOOD

��

��

Firewood for sale. Organic Elm.Fill your 6ft pickup for $50. No cut-ting on property. You pick up. 419-836-9754.

��

Charter Bus ToursI'm in my planning season.

Lots of day and multi-day tourswill be ready for my

March 13th travel party.6 seats left on the June 19-29

Alaska tourCall for detailed flier.

Evelyn's Excursions419-737-2055877-771-4401

We are now on Facebook& Web page

evelynsexcursions.com

22 THE PRESS, JANUARY 11, 2016

VILLAGE OF HARBOR VIEWOn November 9, 2015 Council of the Village of HarborView passed

Resolution #02-2015REQUEST FOR ADVANCE OF TAXES COLLECTED.

On November 9, 2015 Council of the Village of HarborView passedResolution #03-2015

RESOLUTION ACCEPTING THE AMOUNTS AND RATES AS DETERMINEDBY THE BUDGET COMMISSION AND AUTHORIZING THE NECESSARY

TAX LEVIES AND CERTIFYING THEM TO THE COUNTY AUDITOR

On December 21st, 2015 Council of the Village of HarborView passedResolution # 04-2015 AMENDING THE LEASE WITH THE UNITED STATESPOSTAL SERVICE and passed as an emergency.

On December 14th, 2015. Council passed the 2016 TEMPORARYAPPROPRIATIONS BUDGET Resolution 05-2015

The Annual Financial Report for 2015 has been filed with the StateAuditior. A copy of the report is available for review at the office of the clerk /treasurer and can be seen during regular business hours or by appointment.

The full text of the resolutions can be seen at the office of the clerk during regular business hours or by appointment.

Lorraine Crapsey, Clerk/Treasuer

PUBLIC NOTICEThe Village of Clay Center is accepting letters of interest and resumefor the position of Village Tax Commissioner. This is a part time posi-tion. Any questions or concerns you can call 419-855-7444 or 419-855-8457. Village Town Hall: 420 Main St. P.O. Box 52, Clay Center, OH43408. Email: [email protected].

CLAY TOWNSHIPZoning Variance Board Meeting request/notice

Fred Drummond, 20725 W. Main St Martin Ohio has requested a vari-ance to allow placement of an existing storage shed. The proposedplacement of the shed on this property does not meet area set backrequirements. The shed is 14 feet wide x 36 feet long and is proposedto sit on the west side of the lot.

Meeting date, January 20th, 2016 at 6:30pm Location, Clay Township Administration office

21774 Holts EastGenoa Ohio 43430.

Public Invited for input reference this matter. Questions or Commentsfeel free to call Robert Louy, Zoning Inspector, Clay Township Zoning,419-855-2079

NOTICE TO BIDDERSThe sale of real estate belonging to the Village of Clay Center.

Legal Description

(A Portion Of Parcel ID#0021909925900000)

Known as and being a parcel in Lot 9, Southeast Quarter of the

Section 16, T7N, R13E, Allen Township, Ottawa County, Ohio which

lies within the corporate limits of the Village of Clay Center, Ohio.

This property is located on Susan St. south of the village park in

Clay Center. The size of this parcel is 94 feet x 350.62 feet. Site Area

is 0.76 Acres. The said property is in an “R-1” Rural Residential

District. The proposed property split is not useable as a residential

building site. The said property shall abide by the Deed/Lot

Restrictions that are posted and in Ordinance #4-2015, passed on

June 8th, 2015. The minimum bid for said property will start at

$6,400.00. If the high bid is less than the minimum acceptable to

the Village of Clay Center, there would be no sale. The right is

reserved to reject any and all bids. A check for 10% of the bid

should be included with the bid. All bids will be accepted until

Sunday, February 7th, 2016, no later than 4:00 P.M. All bids will be

opened on Monday, February 8th, 2016 at the village town hall.

Sealed bids will be addressed to and received at the village town

hall, 420 Main Street, P.O. Box 52, Clay Center, Ohio 43408. Anyone

interested in viewing the full Legal Description of said property or

any other questions or concerns contact the Clerk-Treasurer at the

town hall address or call 419-855-7444.

NOTICE OF PETITION

VILLAGE OF GENOA

TRANSFER OF FUNDS

OTTAWA COUNTY COURT OF COMMON PLEAS315 MADISON STREETPORT CLINTON, OHIO 43452

CASE NO. 15-MI-016HEARING DATE: January 28, 2016

Notice is hereby given that the Village of Genoa, Ohio has madepetition in the above action to the Ottawa County Court ofCommon Pleas pursuant to §5705.14(C)(I) of the Ohio RevisedCode for approval of the transfer of funds from the Water Fund(601) and Electric Fund (603) as follows: One Hundred (100%)Percent to the General Fund (101) of the Village of Genoa, Ohio;and on the basis that with respect to the foregoing Water Fund(601) and Electric Fund (603) and that the surplus amountspresently are on hand after payment of all current obligations andanticipated future obligations are as follows:

a. Water Fund (601), $95,000.00.b. Electric Fund (603), $55,000.00.Objections may be made by any interested party to

such petition and transfer by filing the same in writing in theOttawa County Court of Common Pleas in the above-captionedcase on or before January 27, 2016.

In Home Service

APPLIANCE WORKS INC.Washers, Dryer, Ranges, Microwaves,

Refrig., Air Conditioners,

Dishwashers, Disposers, Freezers

Operated By Mark Wells

419-836-FIXX (3499)

CORNERSTONECleaning & Restoration LLC

Over 26 years experienceCarpeting & Upholstery Cleaning

Emergency Water Removal

General House Cleaning

— Certified By I.I.C.R.C. —

419-836-8942

21270 SR 579Williston

419-836-7461

Hauling

If it’s heavy ... and you

want it hauled in or out ...

Call Us!

•Dirt •Stone •Debris •Cars

•Equipment •Trucks

BOBCAT SERVICES

We can work directly with

your Insurance Company

SCHNEIDER SONS’ ELECTRIC CORP.

WholeHouse

Generators

1556 Oak St/At Oakdale Toledo, OH 43605 (419) 691-8284

Family Owned & Operated Since 1942

Licensed &Insured

New & Old HomewiringSpecialists

Appliance Repair

Carpet Cleaning

Automotive

Electrical Contractor

Excavating

MAUMEE BAYSELF STORAGE

7640 Jerusalem Road (Rt 2)(419)836-4000Multi-sized Units - Outside storage

Security fence - 7 day access“We make every effort to accommodate YOU.”

KELLER CONCRETE INC.Tear Out & Replace Concrete, Driveways,

Patios, Porches, Pads, Sidewalks &Stamped/Colored Concrete

** Quality & Affordable Work **Insured & Bonded — FREE ESTIMATES —

BOBCAT SERVICES AVAILABLE

419-697-9398

Storage

Gray Plumbing25 Years Experience

**** 24 HR. SERVICE ****D.O.T. Certified. Insured/Bonded

All Major Credit Cards Accepted— Senior Discount —

LICENSED MASTER PLUMBERJim Gray

419-691-7958

BELKOFEREXCAVATING• Septic Systems • Sewer Taps

• Snow Removal • Lawn Care

Backhoe/Bobcat/Dozer Work

Stone and Dirt Hauling

Demolition

Home Improvement

THE PRESS EXPERTS

•Stone & Dirt Hauling

•Bobcat Service•Demolition & Hauling•Concrete Removal•Clean Ups/Clean Outs

419-340-0857419-862-8031

B & G HAULING

Driveway Stone andSpreading

We accept all Major Credit Cards

Hauling

Freddy’s Home Improvement

419-276-0608Electrical, Paneling, Concrete, Roofing, Drywall, Kitchens, Bathrooms, Floors, Decks, Tile, Porch, Additions, Dormers

Free

Estimates

COLLINS ROOFING•Repairs •Small Jobs•Big Jobs•Seamless

Gutters •Free Estimates419-322-5891

A.A. COLLINS CONSTRUCTION

Concrete • Roofing

Basement Waterproofing

Interior • Exterior

Lawncare • Stone & Dirt HaulingBobcat Service • Español

Rob 419-322-5891

Roofing

419-836-1946 419-470-7699

- FREE ESTIMATES -Senior Discounts

Veteran DiscountsRoofs/Gutters

Siding/Windows

RECENTLY CHOSEN TO INSTALLROOFS FOR OWENS CORNING

PRESIDENT & COMMUNICATIONSDIVISION PRESIDENT BECAUSE OF

OUR EXCELLENT REPUTATION

PREFERRED CONTRACTOR

ACEROOFING

ACEROOF.net

INSURED/Lifetime Warranty

A+ BBB rated contractor. We have a clean record. Call BBB at 419-531-3116. Check on all contractors.

419-836-8663 419-392-1488

GL HHENNINGSEN

WATER SSYSTEMSWell Pumps

Sewage PumpsSump Pumps

419-836-9650/419-466-6432

Water Pumps

If You’re an Expert and want to get involved...

CALL 836-2221. Deadline: 11 a.m. Thursday

DON GAMBYEXTERIOR

DECORATORSVinyl & Aluminum Siding

Windows, Shutters,Custom Design Decks

419-862-235948 Years Experience

Remodeling

www.bluelineroofers.com

Since 1964

BLUE-LINEREMODELING &ROOFING LLC

• Replace or Repair• New Roof • Flat Roof • Rubber Roof

419-242-4222419-691-3008

Free Estimates

Licensed & Insured

Tree Service

Plumbing

“No job too Big or Small”

Call George 419-704-4002Se habla Español

•Drywall & Finish •Texture Finish

•Trim Work & Floors •Roofs

•Siding •Plumbing •Remodels

•Gutters •Doors •Windows

“We’re LLocal”

•Tree/Stump RRemoval

•Trimming-PPruning

•Crane SService

•Land CClearing

•Firewood/ MMulch

– 224 HHour EEmergency SService ––

FREE QQuotes FFully IInsured

(419) 707-2481LakeErieTree.com

LAKE ERIE TREE SERVICE

Call 419-836-2221 to be

included in the Experts

AMAZON ROOFING419-691-2524WWW.AMAZONROOF.COM

21270 SR 579Williston

836-7461

We will inspect...•Anti-freeze

•Belts•Hoses

•Spark Plugs•Spark Plug Wires

•Distributor Cap & Rotor•Wiper Blades

•Load Test Battery•Tires

•Brakes•Exhaust

•Suspension•Shocks

ABSOLUTELY FREEValid only with this ad

✷✴

✵

✺

✷✴

WINTER SPECIAL

Concrete

• Tax Preparation • Payroll Services• Business Accounting

Call for Appointment 419-698-5185

CITIZEN TAX SERVICE

Accounting/Tax Preparation

People Who Care4330 Navarre, Suite 102

Oregon, Oh 43616

Your Ad Could Be

Here!

Call 419-836-2221 to be included

in the Experts

Read & Use

the

Classifieds

Your Ad Could Be

Here

Since 1944WILLISTON, OH

419-836-2561

•SALES•RENTALS•PARTS•SERVICE

Mon-Fri 8-5, Sat 8-12

BLOW IN TODAY

Outdoor Power Equipment

Hauling

Call The Press to be

anExpert!

THE PRESS, JANUARY 11, 2016 23


Call for appointment 419-698-5185

Citizen Tax ServiceCitizen Tax Service4330 Navarre Ave, Suite 102,

Oregon, Ohio 43616(Right across from Pearson Park)

[email protected]

People People Who CareWho CareWe’re We’re Here All Here All Year!Year!

$25 OFF $25 OFF Any TAX PreparationAny TAX Preparation

Not valid with any other offers or discounts.OFFER ends 4/15/16

Do you know what exemptions you Do you know what exemptions you qualify for this year? qualify for this year? We did our Homework...WE KNOW!We did our Homework...WE KNOW!

Open 7 days

Since 1965, Penta Career Center has shaped the careers of 30,000 professionals. One of them is Sue Reamsnyder, the Vice President of Program Operations for Volunteers of America. “I oversee the development and operations of affordable housing across the entire state of Ohio. At Penta, I learned core principles and ethical standards that you need to run a business.”Sue ReamsnyderPenta (Rossford), Class of ‘75

1 OF30,000

©2015 Penta Career Center

Penta Career Center9301 Buck Road

Perrysburg, OH 43551419.666.1120

Apply Online TodayFor Fall 2016!pentacareercenter.org

Little Sweethearts

JUST IN TIME FOR VALENTINE’S DAY!

Your message runs in The Press for $20.00 with color

photo. Tues., February 9th at 5pm.Deadline

Picture of your children, grand children, etc.)

The Press 1550 Woodville Rd., Millbury

419-836-2221 Mon. - Thurs. 9 a.m. - 5 p.m.

Jeffery,

I Loved you yesterday, I Love you still,

I Always have.... I Always will.

Happy Valentines Day! Love, Angel

Miranda is cooking up

something sweet!

Love you....

Grandpa Clay & Grandma Julie

Suburban Edition 01/11/16

Documents

Transcript of Suburban Edition 01/11/16