Substance P promotes diabetic corneal epithelial wound ... · Substance P promotes diabetic corneal...
Transcript of Substance P promotes diabetic corneal epithelial wound ... · Substance P promotes diabetic corneal...
Substance P promotes diabetic corneal epithelial wound healing through
molecular mechanisms mediated via the neurokinin-1 receptor
Running title: Mechanisms of SP on diabetic corneal wound healing
Lingling Yang1﹟
, Guohu Di1﹟
, Xia Qi1, Mingli Qu
1, Yao Wang
1, Haoyun Duan
1, Patrik Danielson
2,
Lixin Xie1*, Qingjun Zhou
1*
1 State Key Laboratory Cultivation Base, Shandong Provincial Key Laboratory of Ophthalmology,
Shandong Eye Institute, Shandong Academy of Medical Sciences, Qingdao, China.
2 Department of Integrative Medical Biology, Anatomy, Umeå University, Umeå, Sweden
# Contribute equally to this study
* Correspondence: Qingjun Zhou & Lixin Xie
Address: Shandong Eye Institute, 5 Yan’erdao Road, Qingdao, 266071, China.
Email: [email protected] (Zhou Q); [email protected] (Xie L).
Tel: 86-532-8589-9270;
Fax: 86-532-8589-1110
Word count: 3993; number of Figures: 7; supplement Figures/Tables: 5/2
Page 1 of 34 Diabetes
Diabetes Publish Ahead of Print, published online July 9, 2014
Abstract
Substance P (SP) is a neuropeptide, predominantly released from sensory nerve fibers, with a
potentially protective role in diabetic corneal epithelial wound healing. However, the molecular
mechanism remains unclear. We investigated the protective mechanism of SP against
hyperglycemia-induced corneal epithelial wound healing defects, using type 1 diabetic mice and high
glucose-treated corneal epithelial cells. Hyperglycemia induced delayed corneal epithelial wound
healing, accompanied with attenuated corneal sensation, mitochondrial dysfunction, and impairments
of Akt-, EGFR-, and Sirt1-activation, as well as decreased reactive oxygen species (ROS) scavenging
capacity. However, SP application promoted the epithelial wound healing, the recovery of corneal
sensation, the improvement of mitochondrial function, and the reactivation of Akt, EGFR and Sirt1, as
well as increased ROS scavenging capacity, in both diabetic mouse corneal epithelium and high
glucose-treated corneal epithelial cells. The promotion of SP on diabetic corneal epithelial healing was
completely abolished by a NK-1 receptor antagonist. Moreover, the subconjunctival injection of NK-1
receptor antagonist also caused diabetic corneal pathological changes in normal mice. In conclusion,
the results suggest that SP-NK-1 receptor signaling plays a critical role in the maintenance of corneal
epithelium homeostasis, and that SP signaling through the NK-1 receptor contributes to the promotion
of diabetic corneal epithelial wound healing by rescued activation of Akt, EGFR, and Sirt1,
improvement of mitochondrial function, and increased ROS scavenging capacity.
Keywords: Corneal epithelium; Diabetes; Substance P; Neurokinin-1 receptor
Page 2 of 34Diabetes
INTRODUCTION
Among various pathological conditions by diabetes mellitus, ocular complications have been a
leading cause of blindness in the world, including diabetic retinopathy, cataract, and various ocular
surface disorders (1). The most recognized diabetic changes in the cornea, i.e. clinical diabetic
keratopathy, include impaired corneal sensation, superficial punctate keratitis, and persistent corneal
epithelium defects (2). The uncontrolled impairment of corneal wound healing increases the
susceptibility of corneal ulcer, microbial keratitis, and even perforation. Diabetic corneal pathology
always exhibits epithelial basement membrane abnormalities, reduced hemidesmosome density, and
delayed wound healing (3; 4). However, hyperglycemia also directly impairs the cellular metabolism
and causes abnormal changes of corneal epithelium, such as Akt-, epidermal growth factor receptor
(EGFR)- and Sirt1-mediated cell responses to environmental challenges (5-7). Moreover, excess
oxidative stress, resulting from enhanced accumulation of reactive oxygen species (ROS) and impaired
antioxidant capabilities in response to hyperglycemia, has been postulated as an important pathological
mechanism, while the reduction of ROS attenuated the progression of various diabetic complications
(8-13), including in the cornea (5; 14).
Substance P (SP), released predominantly by peripheral terminal, is an 11-amnio acid
neuropeptide which acts as a neurotransmitter mediating nociceptive transmission. It mainly functions
through the interaction with neurokinin receptors, members of the tachykinin subfamily of
G-protein-coupled receptors, among which the neurokinin-1 (NK-1) receptor shows a preferential
affinity for SP. SP is currently known as a neuro-immunomodulatory regulator of the immune system
(15). In the cornea, SP has been detected in the nerve fibers of naïve cornea (16; 17) and in
antigen-presenting cells in herpetic stromal keratitis (18). Moreover, SP causes the mobilization of
bone marrow-derived stem cells to participate in corneal wound healing (19; 20). Interestingly, recent
evidences have shown that SP activates the EGFR, mitogen-activated protein kinases (MAPK),
extracellular signal regulated kinases (ERK), and phosphoinositide 3-kinase-Akt (PI3K-Akt) signaling
pathways, as well as promotes the healing of inflamed colonic epithelium (21) and possesses
anti-apoptotic effects in colonocytes (22), dendritic cells (23), tenocytes (24), neutrophils (25), and
bone marrow-derived stem cells (26).
The cornea is one of the most densely innervated tissues in the body, containing nerve fibers
derived from the trigeminal ganglion. Corneal nerve fibers exert important trophic influences and
Page 3 of 34 Diabetes
contribute to the maintenance of corneal epithelium homeostasis, whereas the dysfunction of corneal
innervation produces an impairment of corneal epithelial wound healing, known as neurotrophic
keratitis, as caused by for instance herpetic viral infections, trigeminal nerve damage, or diabetes
mellitus (27-29). Although tear fluid impairment is also involved (30), the neurotrophic deficits may
play a major role in the pathogenesis of diabetic keratopathy, as the density of corneal nerve fibers and
corneal sensation decreased in diabetic patients (31-33). However, although being the major sensory
neurotransmitter and neuropeptide released from corneal nerve fibers, SP was shown not to be
significantly decreased in diabetic cornea (34). Nevertheless, paradoxically, topical SP application
promoted corneal epithelial wound healing in diabetic animals and human when combined with
insulin-like growth factor (IGF)-1 or epidermal growth factor (EGF) per group. The promoting
mechanisms of SP on diabetic corneal epithelial wound healing remain elusive. In this study, we sought
to demonstrate the protective mechanism of SP against diabetic corneal epithelial wound healing using
streptozotocin-induced type 1 diabetic mice and high glucose-treated corneal epithelial cells.
RESEARCH DESIGN AND METHODS
Animals
Adult male C57BL/6 mice were purchased from the Beijing Pharmacology Institute (Beijing,
China). All animal experiments were carried out in accordance with the Association for Research in
Vision and Ophthalmology (ARVO) Statement for the Use of Animals in Ophthalmic and Vision
Research. The mice underwent induction of type 1 diabetes mellitus with an intraperitoneal injection of
50 mg/kg streptozotocin (STZ, Sigma, St. Louis, MO) in ice-cold citrate-citric acid buffer (pH 4.5) for
5 days, while control mice received equal amount of buffer. Blood glucose levels were monitored with
an OneTouch Basic glucometer (LifeScan, Johnson & Johnson, Milpitas, CA). In the present study,
diabetic mice were used after 12 weeks of final STZ injection, at which point the HbA1c values were
10.83±0.74% ( 94.75±7.93 mmol/mol), whereas normal mice had HbA1c values of 4.25±0.1% (22.5±1
mmol/mol). For topical SP application, 5 µl SP (1mM, Calbiochem, San Diego, CA) in distilled water
were dropped on the corneal surface by a 10 µl tip, 6 times daily per eye for 4 days (for the
measurement of corneal sensitivity) or 4 days pre-scrape and 3 days post-scrape (for the measurement
of corneal epithelial wound healing). For NK-1 receptor inhibition, NK-1 receptor antagonist
L-733,060 (6.6 µg in 5 µl distilled water, Sigma) was injected subconjunctivally 3 days before corneal
Page 4 of 34Diabetes
sensitivity measurement and corneal epithelium scrape in normal mice, or 24 h before corneal
epithelium scrape in diabetic mice according to our preliminary experiments. Control mice were treated
with distilled water vehicle.
Corneal sensitivity
Corneal sensation was measured bilaterally by using a Cochet-Bonnet esthesiometer (Luneau
Ophtalmologie, Chartres Cedex, France) in unanesthetized control, diabetic, SP-treated diabetic mice,
and the NK-1 receptor antagonist-injected mice before the scrape of corneal epithelium. The testing
began with the maximal length (6 cm) nylon filament, and shortened by 0.5 cm each time until the
corneal touch threshold was found. The longest filament length resulting in a positive response was
considered as the corneal sensitivity threshold, which was verified 4 times.
Corneal epithelial wound healing
Normal, diabetic and SP-treated diabetic mice were anesthetized by an intraperitoneal injection of
xylazine and ketamine followed by topical application of 2% xylocaine. The entire corneal epithelium
including limbal region (marked with 3 mm trephine) was scraped with algerbrush II corneal rust ring
remover (Alger Co, Lago Vista, TX) and subsequently applied with ofoxacin eye drops to avoid
infection. Usually, one eye was wounded at a time in each animal. The defects of corneal epithelium
were visualized at 24, 48 and 72 h by instilling 0.25% fluorescein sodium and photographed under slit
lamp (BQ900, Haag-Streit, Bern, Switzerland). The staining area was analyzed by using Image J
software and calculated as the percentage of residual epithelial defect.
Corneal epithelial cell culture and treatment
Mouse corneal epithelial cell line (TKE2) was presented from Dr. Tetsuya Kawakita of Keio
University (Tokyo, Japan) (35). Human corneal tissues were handled according to the tenets of the
Declaration of Helsinki. Primary human corneal epithelial cells (HCECs) were established from limbal
explants of donor corneas according to a previous report (36). For the analysis of Akt-, EGFR- and
Sirt1-signaling activation, and the staining of ROS, glutathione and mitochondria, both cells were
starved overnight in bovine pituitary extract (BPE)-free keratinocyte serum-free medium (KSFM,
Invitrogen, Carlsbad, CA) and subsequently incubated in 30 mM glucose or mannose (osmotic control)
for 3 days with or without 1 µM SP.
Cell proliferation and migration analysis
For the proliferation analysis, the TKE2 cells were starved overnight in BPE-free KSFM, treated
Page 5 of 34 Diabetes
with high glucose for 3 days in the absence or presence of 1 µM SP, and measured using MTT assay.
For the migration analysis, the cells were cultured in high glucose until confluence, subsequently
wounded with a micropipette tip, and incubated with or without SP for 24 h. Digital images of wound
closure were used for quantitative assessment of migration by using Image J software. Each assay was
conducted at least triplicate.
Immunofluorescence staining
Eyeballs were snap-frozen in Tissue-Tek optimum cutting temperature compound (Sakura
Finetechnical, Tokyo, Japan). Frozen corneal sections were fixed in 4% paraformaldehyde for 15 min,
permeabilized with 0.1% Triton X-100 for 10 min and blocked with normal serum for 1 h at room
temperature. The samples were stained with primary antibodies overnight at 4°C, washed, and
incubated with fluorescein-conjugated secondary antibodies at 37°C for 1 h (antibody information as
listed in Table S1). All staining was observed under a confocal microscope or an Eclipse TE2000-U
microscope (Nikon, Japan) after counterstained with 4’,6-diamidino-2-phenylindole (DAPI).
Reverse transcription quantitative-polymerase chain reaction
Total RNA was extracted from mouse corneal epithelium using NucleospinRNA Kits (BD
Biosciences, Palo Alto, CA). cDNAs were synthesized using the Primescript™ First-Strand cDNA
Synthesis kit (TaKaRa, Dalian, China). Real time-PCR was carried out using SYBR® Green reagents
and the Applied Biosystems 7500 Real Time PCR System (Applied Biosystems, Foster City, CA). The
specific primers used are listed in Table S2. The cycling conditions were 10 sec at 95°C followed by 45
two-step cycles (15 sec at 95°C and 1 min at 60°C). The quantification data were analyzed with the
Sequence Detection System software (Applied Biosystems) using GAPDH as an internal control.
Western blot analysis
Total protein was extracted from the lyzed samples of mouse corneal epithelium, cultured TKE2
cells and HCECs in RIPA buffer. Samples (total protein concentration: 40 µg for mouse corneal
epithelium, 45 µg for cultured cells) were run on 12% SDS-PAGE gels and then transferred to a PVDF
membrane (Millipore, Billerica, MA). The blots were blocked by non-fat dry milk for at least 1 h, and
incubated with primary antibodies (Table S1) in TBST for 1 h at room temperature. The blots were
washed three times and incubated with a HRP-conjugated secondary antibody (Amersham Biosciences,
Piscataway, NJ). Finally, the blots were visualized via enzyme-linked chemiluminescence using the
ECL kit (Chemicon, Temecula, CA).
Page 6 of 34Diabetes
Mitochondria superoxide and membrane potential staining
For the observation of mitochondrial structure, superoxide generation, and membrane potential,
the cells were preloaded with 100 nM Mitotracker green (Beyotime, China) for 30 min, 5 µM
MitoSOXTM red reagent (Beyotime), and 5 µg/ml 5,5’,6,6’-tetrachloro-1,1’,3,3’-tetraethyl-
benzimidazole-carbocyanide iodine (JC-1; Beyotime), respectively, for 15 min at 37°C. The
fluorescence was observed and captured using a Nikon confocal microscopy.
Measurement of intracellular ROS generation and glutathione content
For the observation of intracellular ROS and glutathione staining, fresh corneal cryostat sections
and cultured cells were loaded with 10 µM fluorescence probe 2,7-dichlorodihydrofluorescein diacetate,
acetyl ester (DCHF-DA; Molecular Probes, Eugene, OR) and 50 µM monochlorobimane (MCB,
Sigma), respectively, for 30 min at 37°C. The staining was observed and captured using a Nikon
confocal microscopy. For the measurement of ROS generation, 50,000 cells were harvested and
incubated with 5 µM DCHF-DA for 20 min at 37°C. For the measurement of glutathione (GSH)
content, 50,000 cells were harvested and freeze-thawed with liquid nitrogen and a 37°C water bath for
3 times. The supernatant was collected and mixed with the provided working buffer and NADPH. The
total glutathione content was quantified by comparison with known glutathione standards according to
the manufacturer instructions (Beyotime). The ROS and glutathione fluorescence intensity was
measured using a MultiMode Microplate Reader (SpectraMax M2, Molecular Devices, Menlo Park,
CA).
Statistical analysis
Data in this study were representative of at least three different experiments and presented as the
means±SD. Statistical analysis was performed using SPSS 17.0 software (SPSS, Chicago, IL, USA)
and one-way ANOVA (analysis of variance). Differences were considered statistically significant at
p<0.05.
RESULTS
Substance P promotes corneal epithelial wound healing and sensitivity recovery in diabetic mice
To assess the effects of SP on diabetic corneal epithelial wound healing, entire corneal epithelium
was scraped in age-matched normal mice and diabetic mice with or without topical SP application for 7
days. Punctate fluorescence staining showed that SP was detected in corneal epithelium after topical
Page 7 of 34 Diabetes
application, which suggests the applied SP penetrated the apical tight junction barrier in diabetic mice
(Fig. S1). The corneal epithelial healing rate exhibited a significant difference from 48 h after corneal
epithelium scrape (Fig. 1A). The defect size of corneal epithelium in SP-treated diabetic mice (48 h:
28.78±11.78%; 72 h: 4.44±2.29%, n=6) was significantly improved from that of diabetic mice (48 h:
63.59±7.85%; 72 h: 22.73±9.85%, n=6), and reached the equal level of normal mice (48 h:
19.59±5.67%; 72 h: 3.08±2.17%, n=6) (Fig. 1B). Moreover, the attenuated corneal sensitivity in
diabetic mice was also restored by topical SP application, although still being lower than that of normal
mice (Fig. 1C, n=8 per group). In addition, compared with diabetic mice, more inflammatory cell
infiltration was found underneath the corneal epithelium margin of SP-treated diabetic mice at 48 h,
while reduced at 72 h after corneal epithelium scrape (Fig. S2). The results suggest that topical-applied
SP penetrates into corneal epithelium and promotes corneal epithelial wound healing in diabetic mice,
accompanied with recovery of corneal sensitivity, and an early inflammatory and resolution response.
Substance P promotes corneal epithelial cell migration and proliferation in vitro
To assess the effect of SP on corneal epithelial wound healing in vitro, mouse corneal epithelial
cells were treated with high glucose with equal concentration of mannose as osmotic control.
Subsequently, the confluent cells were wounded and treated with or without SP for another 24 h to
analyze the migration rate. The results showed that high-glucose treatment caused significant delay of
corneal epithelial cell migration, while SP addition improved the migration capacity of high
glucose-treated cells to the same level of normal cells (Fig. 2A, B, n=3 per group). In addition, SP
promoted the proliferation rate of corneal epithelial cells that was impaired by high-glucose treatment
for 3 days (Fig. 2C, n=3 per group). The experiments were performed three times with similar results.
Substance P reactivates Akt, EGFR and Sirt1 altered by hyperglycemia
To elucidate the mechanism underlying the promotion of SP on corneal epithelial wound healing,
we investigated the effects of SP on the activation of Akt, EGFR and Sirt1 that altered in diabetic
corneal epithelium. Representative phosphorylated (p)-Akt, p-EGFR and Sirt1 staining is shown in
Figure 3A. The expression levels of p-Akt, p-EGFR and Sirt1 were significantly up-regulated in
diabetic corneal epithelium after topical SP application for 4 days (Fig. 3B, n=3 per group).
Furthermore, SP also up-regulated the expression levels of p-Akt, p-EGFR and Sirt1 in both mouse
TKE2 cells and human primary corneal epithelial cells that was impaired by high-glucose treatment
(Fig. S3). The results suggest that SP application in both diabetic mice and cultured corneal epithelial
Page 8 of 34Diabetes
cells reactivates Akt, EGFR and Sirt1 that are altered by hyperglycemia, which may in part explain the
promoting mechanisms of SP in diabetic corneal epithelial wound healing.
Substance P attenuates oxidative stress of corneal epithelium by hyperglycemia
To evaluate the effect of SP on the regulation of hyperglycemia-induced oxidative stress in corneal
epithelium, corneal sections were loaded with fluorescence probe DCHF-DA and MCB for the
detection of intracellular ROS and glutathione. Representative results showed that a significant
increased ROS and reduced glutathione staining were detected in diabetic mouse corneal epithelium
than in that of normal mice. However, a weak ROS and strong glutathione staining of corneal
epithelium was found after topical SP application in diabetic mice (Fig. 4A). Moreover, the expression
of major intracellular free radical scavengers in corneal epithelium, including manganese superoxide
dismutase (MnSOD), catalase, NAD(P)H: quinone oxidoreductase 1 (NQO1), thioredoxin (TXN) and
heme oxygenase 1 (Hmox1) in mRNA transcription level, were recovered from the diabetes mellitus
after topical SP application (Fig. 4B, n=4 per group). In addition, immunofluorescence staining and
Western blot revealed that the protein levels of NQO1, Catalase and MnSOD in diabetic corneal
epithelium partially recovered after topical SP application (Fig. 4C, D, n=4 per group). The results
suggest that topical SP application attenuates hyperglycemia-induced oxidative stress in diabetic
corneal epithelium, at least via the mechanism of reducing ROS accumulation, and increasing
intracellular glutathione content and antioxidant gene expression.
Substance P attenuates mitochondrial dysfunction induced by high glucose
Mitochondrial dysfunction plays an important role in the progress of various diabetic
complications. To evaluate the effects of SP on the mitochondrial dysfunction in corneal epithelium
induced by hyperglycemia, cultured corneal epithelial cells were treated with high glucose in the
presence or absence of SP for 3 days. Exposure to elevated glucose caused increased ROS
accumulation and reduced glutathione content of corneal epithelial cells in vitro (Fig. 5A, B), similar to
the diabetic corneal epithelium in vivo. However, SP treatment significantly reduced the oxidative
stress caused by high glucose in corneal epithelial cells, as showed by decreased ROS accumulation
and increased glutathione content (Fig. 5A, B, n=3 per group). The results were also repeated by using
the primary human corneal epithelial cells (Fig. S4). Furthermore, compared with normal or
mannose-treated cells, high glucose-treated cells assumed apparent mitochondrial superoxide staining
(MitoSox staining in Fig. 5C), accompanied with significant change of mitochondrial structure
Page 9 of 34 Diabetes
(Mitotracker staining in Fig. 5C), and loss of mitochondrial membrane potential (red to green
fluorescence of JC-1 staining in Fig. 5C). However, the addition of SP attenuated the generation of
mitochondrial superoxide, and promoted the recovery of mitochondrial structure and membrane
potential that were impaired by high-glucose treatment in corneal epithelial cells (Fig. 5C).
The NK-1 receptor mediates the promotion of substance P on diabetic corneal epithelial wound
healing
To assess if the NK-1 receptor mediates the improvements of SP on diabetic corneal epithelial
wound healing, the NK-1 receptor specific antagonist L-733,060 was injected before topical SP
application in diabetic mice. In unwounded mouse corneal epithelium, the staining density of p-Akt,
p-EGFR and Sirt1 were attenuated in antagonist-injected SP-treated diabetic mice, as compared to in
the diabetic mice treated with SP alone (Fig. 6A). In corneal epithelium-scraped mice, the antagonist
injection before SP application fully reversed the promotion of SP on diabetic corneal epithelial wound
healing, with 28.95±3.89% epithelial defect in antagonist-injected SP-treated mice as compared to only
4.44±2.29% defect in mice treated with SP alone, and to 22.73±9.85% defect in untreated diabetic mice
at 72 h (Fig. 6B, n=5 per group). Moreover, at 72 h post scrape, a stronger staining intensity of p-Akt
and proliferation marker Ki-67 was found in the migrating area of SP-treated diabetic corneal
epithelium than in that of either untreated or antagonist-injected diabetic corneal epithelium (Fig. 6C).
The results suggest that the NK-1 receptor mediates the reactivation of Akt, EGFR, and Sirt1 by SP,
and that the promotion of SP on diabetic corneal epithelial wound healing is also NK-1 receptor
mediated.
Local injection of NK-1 receptor antagonist causes diabetic pathological changes in normal mice
To assess the effects of SP-NK-1 receptor signaling inhibition on corneal epithelium, L-733,060
was injected subconjunctivally in normal mice. After 3 days of antagonist injection, the unwounded
corneal epithelium assumed a similar attenuation of p-Akt, p-EGFR, Sirt1 staining to that in diabetic
mice (Fig.7A), accompanied with decreased corneal sensitivity (Fig. 7B, n=5 per group). After 72 h of
corneal epithelium scrape, the antagonist-injected mice showed a significant delay of corneal epithelial
wound healing, with 31.77±5.07% epithelial defect in antagonist-injected mice as compared to only
3.08±2.17% defect in control mice (Fig. 7C, n=5 per group), and an attenuated p-Akt and Ki-67
staining in the migrating area of corneal epithelium as compared to that in normal mice (Fig. 7D),
which were similar to the pathological changes in diabetic corneal epithelium (Fig. 7C, D). Similar
Page 10 of 34Diabetes
results were also obtained with the injection of another NK-1 receptor antagonist Spantide I (data not
shown). The results show that local injection of NK-1 receptor antagonist in normal mice causes
similar pathological changes in corneal epithelial wound healing and corneal sensitivity as that seen in
diabetic mice, suggesting normal activation of SP-NK-1 receptor signaling plays a critical role in the
homeostasis of corneal epithelium and corneal sensation.
DISCUSSION
The cornea is one of the most densely innervated parts of the human body, and as such its sensory
nerves play not only a prominent role in nociception, but also in providing trophism to the corneal
tissue. In diabetic mellitus, corneal sensitivity, nerve fiber density and epithelial wound healing is
reduced significantly (27; 31; 32). However, the mechanisms are not completely understood. In the
present study, we found that SP promoted epithelial wound healing, stimulated the reactivation of Akt,
EGFR, and Sirt1, as well as attenuated oxidative stress in diabetic corneal epithelium. Furthermore, the
study shows that the impairment of SP-NK-1 receptor signaling causes changes of normal corneal
epithelium similar to those of diabetic mice. The results suggest that SP-NK-1 receptor signaling
regulates the activation of multiple signaling pathways that are needed for the corneal epithelial wound
healing, whereas this regulation is impaired in diabetic corneal epithelium and rescued by SP via an
auto-regulatory mechanism (37; 38). Moreover, SP restored the corneal sensitivity of diabetic mice
close to the same level of normal mice, whereas local inhibition of SP-NK-1 receptor signaling caused
decreased corneal sensitivity in normal mice similar to that in diabetic mice. The results suggest that
the impairment of SP-NK-1 receptor signaling may also be involved in the attenuation of corneal
sensitivity in diabetes mellitus, which is supported by the fact that the NK-1 receptor exists in
peripheral nerve (39). Taken together, SP, secreted by corneal sensory nerve fibers, may be the key
neurotransmitter and neuropeptide that mediates corneal nociception transmission and provides
trophism to the corneal epithelium. Furthermore, as for the treatment of diabetic keratopathy, many
growth factors, cytokines and various agents have been evaluated as their capacity of accelerating
corneal wound healing (40). However, SP and its functional derivative (FGLM-amide), with the
advantages of smaller molecules and higher efficiency, have been shown to be effective for the
treatment of persistent corneal epithelial defects in clinical studies (40-42). In addition, we found that
SP promoted the regeneration of nerve fibers in diabetic corneal epithelium and accelerated trigeminal
Page 11 of 34 Diabetes
neuronal growth in vitro that impaired by high glucose (Fig. S5).
The NK-1 receptor, the preferred receptor of SP, mediates a variety of physiological and
pathophysiological responses (22; 23; 43). Although previous studies have confirmed that SP enhances
corneal epithelial migration when combined with IGF-1 or EGF (41; 44; 45), the exact mechanism
remains unclear. Here we show that SP reactivates the Akt, EGFR and Sirt1, and promotes ROS
scavenging capacity that is impaired by hyperglycemia. The results suggest a molecular basis for the
synergistic effects of SP and IGF-1 or EGF on the enhancement of diabetic corneal epithelial wound
healing (46; 47). Even more interestingly, we found that the local inhibition of the SP-NK-1 receptor
signaling in normal mice causes pathological changes of the corneal epithelium similar to those of
diabetic corneal epithelium. These results suggest that SP-NK-1 receptor signaling may be involved in
the maintenance of corneal epithelium homeostasis, and also in the protection from hyperglycemia
stress, whereas the impairment of SP-NK-1 receptor signaling may explain the fragility of diabetic
corneal epithelium in vivo.
Prolonged hyperglycemia always causes the perturbation of catabolic pathways and the
over-production of ROS in the mitochondria, which in turn plays a critical role in the development of
diabetic complications (48), including diabetic keratopathy (5). In the present study, we confirmed that
the mitochondrial superoxide level was up-regulated in high glucose-treated corneal epithelial cells,
accompanied by changes of mitochondria structure and loss of mitochondrial membrane potential.
Interestingly, we found that SP attenuates the dysfunction of the mitochondria by high glucose.
Moreover, SP also elevates the intracellular glutathione level, the main antioxidant in the cells. In
addition, although increased Nrf2 expression was detected in diabetic corneal epithelium (data not
shown), the expressions of Nrf2 downstream antioxidant genes, including MnSOD, catalase, NQO1,
TXN and Hmox1, were down-regulated in diabetic corneal epithelium, while up-regulated after SP
application, which suggests that additional regulatory mechanisms may exist between Nrf2 and its
downstream antioxidant gene expressions in diabetes mellitus (49; 50). All things considered, the
improvement of oxidative stress by SP via the improved mitochondrial function, elevated GSH level
and up-regulated expression of antioxidant genes may also plays an important role in the protection of
corneal epithelium in diabetes mellitus.
In conclusion, our study demonstrates, for the first time, that SP promotes diabetic corneal
epithelial wound healing while simultaneously triggering the reactivation of the Akt-, EGFR- and
Page 12 of 34Diabetes
Sirt1-signaling of importance for that healing, as well as rescuing corneal sensation, improving
mitochondrial function, and decreasing ROS accumulation impaired by hyperglycemia. We
furthermore show that local inhibition of SP-NK-1 receptor signaling abolishes the promotion of SP on
corneal epithelial healing in diabetic mice, and causes diabetic corneal pathological changes in normal
mice. Thus, the SP-NK-1 receptor signaling may play a critical role in the maintenance of corneal
epithelium homeostasis, and SP signaling may, through the NK-1 receptor, contribute to the promotion
of diabetic corneal epithelial wound healing by the rescued activation of Akt, EGFR and Sirt1, the
improvement of mitochondrial function, and the increased ROS scavenging capacity of corneal
epithelium.
ACKNOWLEDGMENTS
This work was partially supported by the National Basic Research Program of China
(2012CB722409) and the National Natural Science Foundation of China (81170816, 81200665).
Qingjun Zhou is partially supported by the Shandong Provincial Excellent Innovation Team Program
and Taishan Scholar Program (20081148). Patrik Danielson is partially supported by the J.C. Kempe
and Seth M. Kempe Memorial Foundations, the Swedish Society of Medicine, the Cronqvist and KMA
foundations, and the National Swedish Research Council (521-2013-2612; Q. Zhou co-applicant). The
authors thank Yangyang Zhang, Wenjie Sui, Qian Wang, Hua Gao, Suxia Li and Zhaoli Chen of
Shandong Eye Institute for their help with the animal experiments, statistical analysis, and human
tissue collection.
No potential conflicts of interest relevant to this article were reported.
L.Y and G. D contributed to sample testing, data analysis and study design; X. Q, M. Q, Y. W, and
H. D contributed to samples testing and data analysis; P. D , L. X and Q. Z contributed to study design,
data analysis and manuscript preparation. L. X and Q. Z are the guarantors of this work and, as such,
have full access to all the data in the study and take responsibility for the integrity of the data and the
accuracy of the data analysis.
Page 13 of 34 Diabetes
REFERENCES
1. Clark CM, Jr., Lee DA: Prevention and treatment of the complications of diabetes mellitus. N Engl J
Med 332:1210-1217, 1995
2. Schultz RO, Van Horn DL, Peters MA, Klewin KM, Schutten WH: Diabetic keratopathy. Trans Am
Ophthalmol Soc 79:180-199, 1981
3. Ljubimov AV, Huang ZS, Huang GH, Burgeson RE, Gullberg D, Miner JH, Ninomiya Y, Sado Y,
Kenney MC: Human corneal epithelial basement membrane and integrin alterations in diabetes and
diabetic retinopathy. J Histochem Cytochem 46:1033-1041, 1998
4. Rehany U, Ishii Y, Lahav M, Rumelt S: Ultrastructural changes in corneas of diabetic patients: an
electron-microscopy study. Cornea 19:534-538, 2000
5. Xu KP, Li Y, Ljubimov AV, Yu FS: High glucose suppresses epidermal growth factor
receptor/phosphatidylinositol 3-kinase/Akt signaling pathway and attenuates corneal epithelial wound
healing. Diabetes 58:1077-1085, 2009
6. Xu K, Yu FS: Impaired epithelial wound healing and EGFR signaling pathways in the corneas of
diabetic rats. Invest Ophthalmol Vis Sci 52:3301-3308, 2011
7. Wang Y, Zhao X, Shi D, Chen P, Yu Y, Yang L, Xie L: Overexpression of SIRT1 promotes high
glucose-attenuated corneal epithelial wound healing via p53 regulation of the IGFBP3/IGF-1R/AKT
pathway. Invest Ophthalmol Vis Sci 54:3806-3814, 2013
8. Forbes JM, Cooper ME: Mechanisms of diabetic complications. Physiol Rev 93:137-188, 2013
9. Gorin Y, Block K: Nox as a target for diabetic complications. Clin Sci (Lond) 125:361-382, 2013
10. Anderson EJ, Kypson AP, Rodriguez E, Anderson CA, Lehr EJ, Neufer PD: Substrate-specific
derangements in mitochondrial metabolism and redox balance in the atrium of the type 2 diabetic
human heart. J Am Coll Cardiol 54:1891-1898, 2009
11. Song B, Scheuner D, Ron D, Pennathur S, Kaufman RJ: Chop deletion reduces oxidative stress,
improves beta cell function, and promotes cell survival in multiple mouse models of diabetes. J Clin
Invest 118:3378-3389, 2008
12. Bhatt MP, Lim YC, Hwang J, Na S, Kim YM, Ha KS: C-peptide prevents hyperglycemia-induced
endothelial apoptosis through inhibition of reactive oxygen species-mediated transglutaminase 2
activation. Diabetes 62:243-253, 2013
13. Uruno A, Furusawa Y, Yagishita Y, Fukutomi T, Muramatsu H, Negishi T, Sugawara A, Kensler TW,
Yamamoto M: The Keap1-Nrf2 system prevents onset of diabetes mellitus. Mol Cell Biol
33:2996-3010, 2013
14. Kim J, Kim CS, Kim H, Jeong IH, Sohn E, Kim JS: Protection against advanced glycation end
products and oxidative stress during the development of diabetic keratopathy by KIOM-79. J Pharm
Pharmacol 63:524-530, 2011
15. Mantelli F, Micera A, Sacchetti M, Bonini S: Neurogenic inflammation of the ocular surface. Curr
Opin Allergy Clin Immunol 10:498-504, 2010
16. Tervo K, Tervo T, Eranko L, Eranko O: Substance P immunoreactive nerves in the rodent cornea.
Neurosci Lett 25:95-97, 1981
17. Miller A, Costa M, Furness JB, Chubb IW: Substance P immunoreactive sensory nerves supply the
rat iris and cornea. Neurosci Lett 23:243-249, 1981
18. Twardy BS, Channappanavar R, Suvas S: Substance P in the corneal stroma regulates the severity
of herpetic stromal keratitis lesions. Invest Ophthalmol Vis Sci 52:8604-8613, 2011
19. Hong HS, Lee J, Lee E, Kwon YS, Ahn W, Jiang MH, Kim JC, Son Y: A new role of substance P as
Page 14 of 34Diabetes
an injury-inducible messenger for mobilization of CD29(+) stromal-like cells. Nat Med 15:425-435,
2009
20. Lan Y, Kodati S, Lee HS, Omoto M, Jin Y, Chauhan SK: Kinetics and function of mesenchymal
stem cells in corneal injury. Invest Ophthalmol Vis Sci 53:3638-3644, 2012
21. Castagliuolo I, Morteau O, Keates AC, Valenick L, Wang CC, Zacks J, Lu B, Gerard NP,
Pothoulakis C: Protective effects of neurokinin-1 receptor during colitis in mice: role of the epidermal
growth factor receptor. Br J Pharmacol 136:271-279, 2002
22. Koon HW, Zhao D, Zhan Y, Moyer MP, Pothoulakis C: Substance P mediates antiapoptotic
responses in human colonocytes by Akt activation. Proc Natl Acad Sci U S A 104:2013-2018, 2007
23. Janelsins BM, Mathers AR, Tkacheva OA, Erdos G, Shufesky WJ, Morelli AE, Larregina AT:
Proinflammatory tachykinins that signal through the neurokinin 1 receptor promote survival of
dendritic cells and potent cellular immunity. Blood 113:3017-3026, 2009
24. Backman LJ, Danielson P: Akt-mediated anti-apoptotic effects of substance P in Anti-Fas-induced
apoptosis of human tenocytes. J Cell Mol Med 17:723-733, 2013
25. Zhou Z, Barrett RP, McClellan SA, Zhang Y, Szliter EA, van Rooijen N, Hazlett LD: Substance P
delays apoptosis, enhancing keratitis after Pseudomonas aeruginosa infection. Invest Ophthalmol Vis
Sci 49:4458-4467, 2008
26. An YS, Lee E, Kang MH, Hong HS, Kim MR, Jang WS, Son Y, Yi JY: Substance P stimulates the
recovery of bone marrow after the irradiation. J Cell Physiol 226:1204-1213, 2011
27. Muller LJ, Marfurt CF, Kruse F, Tervo TM: Corneal nerves: structure, contents and function. Exp
Eye Res 76:521-542, 2003
28. Wang F, Gao N, Yin J, Yu FS: Reduced innervation and delayed re-innervation after epithelial
wounding in type 2 diabetic Goto-Kakizaki rats. Am J Pathol 181:2058-2066, 2012
29. Okada Y, Reinach PS, Kitano A, Shirai K, Kao WW, Saika S: Neurotrophic keratopathy; its
pathophysiology and treatment. Histol Histopathol 25:771-780
30. Dogru M, Katakami C, Inoue M: Tear function and ocular surface changes in noninsulin-dependent
diabetes mellitus. Ophthalmology 108:586-592, 2001
31. He J, Bazan HE: Mapping the nerve architecture of diabetic human corneas. Ophthalmology
119:956-964, 2012
32. Tavakoli M, Kallinikos PA, Efron N, Boulton AJ, Malik RA: Corneal sensitivity is reduced and
relates to the severity of neuropathy in patients with diabetes. Diabetes Care 30:1895-1897, 2007
33. Hossain P, Sachdev A, Malik RA: Early detection of diabetic peripheral neuropathy with corneal
confocal microscopy. Lancet 366:1340-1343, 2005
34. Marfurt CF, Echtenkamp SF: The effect of diabetes on neuropeptide content in the rat cornea and
iris. Invest Ophthalmol Vis Sci 36:1100-1106, 1995
35. Kawakita T, Shimmura S, Hornia A, Higa K, Tseng SC: Stratified epithelial sheets engineered from
a single adult murine corneal/limbal progenitor cell. J Cell Mol Med 12:1303-1316, 2008
36. Kim HS, Jun Song X, de Paiva CS, Chen Z, Pflugfelder SC, Li DQ: Phenotypic characterization of
human corneal epithelial cells expanded ex vivo from limbal explant and single cell cultures. Exp Eye
Res 79:41-49, 2004
37. Koh YH, Moochhala S, Bhatia M: Activation of neurokinin-1 receptors up-regulates substance P
and neurokinin-1 receptor expression in murine pancreatic acinar cells. J Cell Mol Med 16:1582-1592
38. Goode T, O'Connor T, Hopkins A, Moriarty D, O'Sullivan GC, Collins JK, O'Donoghue D, Baird
AW, O'Connell J, Shanahan F: Neurokinin-1 receptor (NK-1R) expression is induced in human colonic
Page 15 of 34 Diabetes
epithelial cells by proinflammatory cytokines and mediates proliferation in response to substance P. J
Cell Physiol 197:30-41, 2003
39. Steinhoff MS, von Mentzer B, Geppetti P, Pothoulakis C, Bunnett NW: Tachykinins and their
receptors: contributions to physiological control and the mechanisms of disease. Physiol Rev
94:265-301
40. Abdelkader H, Patel DV, McGhee C, Alany RG: New therapeutic approaches in the treatment of
diabetic keratopathy: a review. Clin Experiment Ophthalmol 39:259-270, 2011
41. Yamada N, Matsuda R, Morishige N, Yanai R, Chikama TI, Nishida T, Ishimitsu T, Kamiya A:
Open clinical study of eye-drops containing tetrapeptides derived from substance P and insulin-like
growth factor-1 for treatment of persistent corneal epithelial defects associated with neurotrophic
keratopathy. Br J Ophthalmol 92:896-900, 2008
42. Chikama T, Fukuda K, Morishige N, Nishida T: Treatment of neurotrophic keratopathy with
substance-P-derived peptide (FGLM) and insulin-like growth factor I. Lancet 351:1783-1784, 1998
43. Quartara L, Maggi CA: The tachykinin NK1 receptor. Part II: Distribution and pathophysiological
roles. Neuropeptides 32:1-49, 1998
44. Nakamura M, Chikama T, Nishida T: Synergistic effect with Phe-Gly-Leu-Met-NH2 of the
C-terminal of substance P and insulin-like growth factor-1 on epithelial wound healing of rabbit cornea.
Br J Pharmacol 127:489-497, 1999
45. Nakamura M, Nishida T, Ofuji K, Reid TW, Mannis MJ, Murphy CJ: Synergistic effect of
substance P with epidermal growth factor on epithelial migration in rabbit cornea. Exp Eye Res
65:321-329, 1997
46. Yamada N, Yanai R, Inui M, Nishida T: Sensitizing effect of substance P on corneal epithelial
migration induced by IGF-1, fibronectin, or interleukin-6. Invest Ophthalmol Vis Sci 46:833-839, 2005
47. Nakamura M, Ofuji K, Chikama T, Nishida T: The NK1 receptor and its participation in the
synergistic enhancement of corneal epithelial migration by substance P and insulin-like growth factor-1.
Br J Pharmacol 120:547-552, 1997
48. Blake R, Trounce IA: Mitochondrial dysfunction and complications associated with diabetes.
Biochim Biophys Acta, 2013
49. Cheng X, Chapple SJ, Patel B, Puszyk W, Sugden D, Yin X, Mayr M, Siow RC, Mann GE:
Gestational diabetes mellitus impairs nrf2-mediated adaptive antioxidant defenses and redox signaling
in fetal endothelial cells in utero. Diabetes 62:4088-4097, 2013
50. He X, Ma Q: Redox regulation by nuclear factor erythroid 2-related factor 2: gatekeeping for the
basal and diabetes-induced expression of thioredoxin-interacting protein. Mol Pharmacol 82:887-897
Page 16 of 34Diabetes
FIGURE LEGENDS
Figure 1. Substance P promotes corneal epithelial wound healing and restores corneal
sensitivity in diabetic mice. Topical SP application for 7 days was used to examine the wound
healing rate in diabetic corneal epithelium. The corneal epithelial wound was inflicted after 4 days
of SP application and then stained with fluorescein sodium at 24, 48 and 72 h after the corneal
epithelium scrape, with continuous daily SP administration in the ‘Diabetic+SP’-group (A).
Histogram of residual epithelial defect is presented as the percentage of the original wound (B,
n=6 per group). Corneal sensitivity was measured in unanesthetized control, diabetic and
SP-treated diabetic mice after 4 days’ topical application (C, n=8 per group). * p < 0.05, ns: no
significance.
Figure 2. Substance P promotes the migration and proliferation of corneal epithelial cells
impaired by high glucose. Confluent mouse corneal epithelial cells were wounded after the
treatment with 30 mM glucose or mannose for 3 days. Cell migration was observed with or
without SP treatment for another 24 h (A), and the migration area was analyzed by Image J
software (B, n=3 per group). Cell proliferation was measured using MTT assay after the treatment
for 3 days with glucose or mannose in the absence or presence of SP (C, n=3 per group). * p <
0.05, ns: no significance.
Figure 3. Substance P reactivates Akt, EGFR and Sirt1 in diabetic corneal epithelium.
Topical SP application for 4 days was used to examine the reactivation of Akt, EGFR and Sirt1 in
diabetic corneal epithelium. SP recovered the positive staining (A) and up-regulated the protein
levels of phosphorylated (p)-Akt, p-EGFR and Sirt1 in diabetic corneal epithelium, as compared
to that of untreated diabetic mice (B, n=3 per group). * p < 0.05, ns: no significance.
Figure 4. Substance P attenuates oxidative stress of diabetic corneal epithelium. Topical SP
application for 4 days was used to examine the attenuation of oxidative stress in diabetic corneal
epithelium. SP restored the ROS and glutathione (GSH) staining in diabetic corneal epithelium to
similar levels as those in normal corneal epithelium (A). SP elevated the mRNA transcript levels
of antioxidant genes MnSOD, Catalase, NQO1, GCLC, TXN and Hmox1 (B, n=4 per group), as
Page 17 of 34 Diabetes
well as the staining density and protein levels of NQO1, Catalase and MnSOD in diabetic corneal
epithelium, as compared to that in untreated diabetic corneal epithelium (C, D, n=4 per group). * p
< 0.05, ns: no significance.
Figure 5. Substance P improves mitochondrial functions of corneal epithelial cells triggered
by high glucose. Mouse corneal epithelial cells were treated with 30 mM glucose or mannose for
3 days in the presence or absence of SP. SP recovered the staining density and levels of
intracellular ROS and glutathione (GSH) (A, B, n=3 per group). SP improved the impaired
mitochondrial functions by high glucose (C), including the mitochondrial superoxide (MitoSox
staining), mitochondrial structure (Mitotacker staining) and mitochondrial membrane potential
(JC-1 staining). * p < 0.05.
Figure 6. NK-1 receptor antagonist blocks the promotion of substance P on diabetic corneal
epithelial wound healing. NK-1 receptor antagonist L-733,060 was injected subconjunctivally at
24 h before topical SP application in diabetic mice. In the unwounded corneal epithelium, the
elevation of p-Akt, p-EGFR and Sirt1 staining density by SP application was attenuated in
antagonist-injected SP-treated diabetic mice (A). In the corneal epithelium 72 h after scrape, the
antagonist injection reversed the promotion of SP on diabetic corneal epithelial wound healing (B,
n=5 per group) and the staining intensity of p-Akt and the proliferation marker Ki-67 in the
regenerated corneal epithelium (C). * p < 0.05, ns: no significance.
Figure 7. Local inhibition of SP-NK-1 receptor signaling causes diabetic-like pathological
changes in the cornea of normal mice. NK-1 receptor antagonist L-733,060 was injected
subconjunctivally in normal mice. In the unwounded corneal epithelium of 3 days after antagonist
injection, the staining density of p-Akt, p-EGFR and Sirt1 (A) and corneal sensitivity (B, n=5 per
group) was attenuated similarly to that in diabetic mice. In the corneal epithelium of 72 h after
scrape, the local antagonist injection caused a significant delay of corneal epithelial wound healing
(C, n=5 per group) as well as attenuated p-Akt and Ki-67 staining density in the regenerated
corneal epithelium (D). * p < 0.05, ns: no significance.
Page 18 of 34Diabetes
ONLINE SUPPLEMENTAL MATERIALS
Figure S1. Topically applied substance P penetrates into the corneal epithelium in diabetic
mice. SP was detected in the cytoplasm of corneal epithelial cells by immunofluorescence staining,
which suggests that topically applied SP can penetrate into the corneal epithelium in diabetic mice.
Figure S2. Substance P promotes the early inflammatory and resolution response in diabetic
cornea. At 48 h after corneal epithelium scrape, more inflammatory cell infiltration was found
underneath the corneal epithelium margin of SP-treated diabetic mice as compared to untreated
diabetic mice, whereas this response was reduced at 72 h when compared with diabetic mice
(black lines represent the basal of regenerating corneal epithelium).
Figure S3. Substance P recovers p-Akt, p-EGFR and Sirt1 levels impaired by high glucose in
cultured corneal epithelial cells. Mouse TKE2 (A) cells or human primary corneal epithelial
cells (B) were treated with high glucose in the absence or presence of SP for 3 days, with mannose
as osmotic control. SP recovered the expression levels of p-Akt, p-EGFR and Sirt1 that was
impaired by high-glucose treatment in both mouse TKE2 cells (A, n=4 per group) and primary
human corneal epithelial cells (B, n=3 per group). * p < 0.05, ns: no significance.
Figure S4. Substance P attenuates oxidative stress of primary human corneal epithelial cells
induced by high glucose. Human primary corneal epithelial cells were treated with 30 mM
glucose or mannose for 3 days in the presence or absence of SP. SP recovered the staining density
of intracellular ROS and glutathione (GSH).
Figure S5. Substance P promotes the regeneration of diabetic corneal nerve fibers in vivo
and the growth of high glucose-treated trigeminal ganglion cells in vitro. To explore the
promotion of SP on corneal nerve fiber regeneration in diabetic mice, central corneal epithelium
(marked with 2 mm trephine) was scraped after 6 times of topical SP application per day for 4 days.
The SP application was continued with 6 times per day for another 3-4 days until the completion of
corneal epithelial wound healing, subsequently with 1-2 times per day for 2 weeks until sample
collection. The whole-mounted corneal staining with β3-tubulin antibody demonstrated that SP
Page 19 of 34 Diabetes
application significantly promoted the regeneration of nerve fibers in diabetic corneal epithelium (A, C,
n=3 per group). In vitro, mouse trigeminal nerves were isolated and incubated in Neurobasal A medium
as previous descriptions [1]. The fresh-isolated trigeminal neuronal cells were treated with 30 mM
glucose for 3 days with or without 1 µM SP. The results demonstrated that SP accelerated neuronal
growth that was impaired by high glucose, as showed by the immunofluorescence staining with
β3-tubulin antibody (B) and the counting of total nerve fiber length (D, n=6 per group). * p < 0.05, ns:
no significance.
References
[1] Malin SA, Davis BM, Molliver DC. Production of dissociated sensory neuron cultures and
considerations for their use in studying neuronal function and plasticity. Nat Protoc. 2007;2:152–160.
Page 20 of 34Diabetes
Figure 1. Substance P promotes corneal epithelial wound healing and restores corneal sensitivity in diabetic mice. Topical SP application for 7 days was used to examine the wound healing rate in diabetic corneal
epithelium. The corneal epithelial wound was inflicted after 4 days of SP application and then stained with
fluorescein sodium at 24, 48 and 72 h after the corneal epithelium scrape, with continuous daily SP administration in the ‘Diabetic+SP’-group (A). Histogram of residual epithelial defect is presented as the percentage of the original wound (B, n=6 per group). Corneal sensitivity was measured in unanesthetized control, diabetic and SP-treated diabetic mice after 4 days’ topical application (C, n=8 per group). * p <
0.05, ns: no significance. 88x165mm (300 x 300 DPI)
Page 21 of 34 Diabetes
Figure 2. Substance P promotes the migration and proliferation of corneal epithelial cells impaired by high glucose. Confluent mouse corneal epithelial cells were wounded after the treatment with 30 mM glucose or mannose for 3 days. Cell migration was observed with or without SP treatment for another 24 h (A), and the migration area was analyzed by Image J software (B, n=3 per group). Cell proliferation was measured using MTT assay after the treatment for 3 days with glucose or mannose in the absence or presence of SP (C, n=3
per group). * p < 0.05, ns: no significance. 88x92mm (300 x 300 DPI)
Page 22 of 34Diabetes
Figure 3. Substance P reactivates Akt, EGFR and Sirt1 in diabetic corneal epithelium. Topical SP application for 4 days was used to examine the reactivation of Akt, EGFR and Sirt1 in diabetic corneal epithelium. SP recovered the positive staining (A) and up-regulated the protein levels of phosphorylated (p)-Akt, p-EGFR
and Sirt1 in diabetic corneal epithelium, as compared to that of untreated diabetic mice (B, n=3 per group). * p < 0.05, ns: no significance. 88x75mm (300 x 300 DPI)
Page 23 of 34 Diabetes
Figure 4. Substance P attenuates oxidative stress of diabetic corneal epithelium. Topical SP application for 4 days was used to examine the attenuation of oxidative stress in diabetic corneal epithelium. SP restored the
ROS and glutathione (GSH) staining in diabetic corneal epithelium to similar levels as those in normal
corneal epithelium (A). SP elevated the mRNA transcript levels of antioxidant genes MnSOD, Catalase, NQO1, GCLC, TXN and Hmox1 (B, n=4 per group), as well as the staining density and protein levels of
NQO1, Catalase and MnSOD in diabetic corneal epithelium, as compared to that in untreated diabetic corneal epithelium (C, D, n=4 per group). * p < 0.05, ns: no significance.
88x119mm (300 x 300 DPI)
Page 24 of 34Diabetes
Figure 5. Substance P improves mitochondrial functions of corneal epithelial cells triggered by high glucose. Mouse corneal epithelial cells were treated with 30 mM glucose or mannose for 3 days in the presence or absence of SP. SP recovered the staining density and levels of intracellular ROS and glutathione (GSH) (A,
B, n=3 per group). SP improved the impaired mitochondrial functions by high glucose (C), including the mitochondrial superoxide (MitoSox staining), mitochondrial structure (Mitotacker staining) and mitochondrial
membrane potential (JC-1 staining). * p < 0.05. 88x155mm (300 x 300 DPI)
Page 25 of 34 Diabetes
Figure 6. NK-1 receptor antagonist blocks the promotion of substance P on diabetic corneal epithelial wound healing. NK-1 receptor antagonist L-733,060 was injected subconjunctivally at 24 h before topical SP
application in diabetic mice. In the unwounded corneal epithelium, the elevation of p-Akt, p-EGFR and Sirt1
staining density by SP application was attenuated in antagonist-injected SP-treated diabetic mice (A). In the corneal epithelium 72 h after scrape, the antagonist injection reversed the promotion of SP on diabetic
corneal epithelial wound healing (B, n=5 per group) and the staining intensity of p-Akt and the proliferation marker Ki-67 in the regenerated corneal epithelium (C). * p < 0.05, ns: no significance.
88x177mm (300 x 300 DPI)
Page 26 of 34Diabetes
Figure 7. Local inhibition of SP-NK-1 receptor signaling causes diabetic-like pathological changes in the cornea of normal mice. NK-1 receptor antagonist L-733,060 was injected subconjunctivally in normal mice. In the unwounded corneal epithelium of 3 days after antagonist injection, the staining density of p-Akt, p-
EGFR and Sirt1 (A) and corneal sensitivity (B, n=5 per group) was attenuated similarly to that in diabetic mice. In the corneal epithelium of 72 h after scrape, the local antagonist injection caused a significant delay
of corneal epithelial wound healing (C, n=5 per group) as well as attenuated p-Akt and Ki-67 staining density in the regenerated corneal epithelium (D). * p < 0.05, ns: no significance.
177x118mm (300 x 300 DPI)
Page 27 of 34 Diabetes
Figure S1. Topically applied substance P penetrates into the corneal epithelium in diabetic mice. SP was detected in the cytoplasm of corneal epithelial cells by immunofluorescence staining, which suggests that
topically applied SP can penetrate into the corneal epithelium in diabetic mice. 21x17mm (300 x 300 DPI)
Page 28 of 34Diabetes
Figure S2. Substance P promotes the early inflammatory and resolution response in diabetic cornea. At 48 h after corneal epithelium scrape, more inflammatory cell infiltration was found underneath the corneal epithelium margin of SP-treated diabetic mice as compared to untreated diabetic mice, whereas this response was reduced at 72 h when compared with diabetic mice (black lines represent the basal of
regenerating corneal epithelium). 88x42mm (300 x 300 DPI)
Page 29 of 34 Diabetes
Figure S3. Substance P recovers p-Akt, p-EGFR and Sirt1 levels impaired by high glucose in cultured corneal epithelial cells. Mouse TKE2 (A) cells or human primary corneal epithelial cells (B) were treated with high glucose in the absence or presence of SP for 3 days, with mannose as osmotic control. SP recovered the
expression levels of p-Akt, p-EGFR and Sirt1 that was impaired by high-glucose treatment in both mouse TKE2 cells (A, n=4 per group) and primary human corneal epithelial cells (B, n=3 per group). * p < 0.05,
ns: no significance. 88x104mm (300 x 300 DPI)
Page 30 of 34Diabetes
Figure S4. Substance P attenuates oxidative stress of primary human corneal epithelial cells induced by high glucose. Human primary corneal epithelial cells were treated with 30 mM glucose or mannose for 3 days in the presence or absence of SP. SP recovered the staining density of intracellular ROS and glutathione (GSH).
88x49mm (300 x 300 DPI)
Page 31 of 34 Diabetes
Figure S5. Substance P promotes the regeneration of diabetic corneal nerve fibers in vivo and the growth of high glucose-treated trigeminal ganglion cells in vitro. To explore the promotion of SP on corneal nerve fiber regeneration in diabetic mice, central corneal epithelium (marked with 2 mm trephine) was scraped after 6
times of topical SP application per day for 4 days. The SP application was continued with 6 times per day for another 3-4 days until the completion of corneal epithelial wound healing, subsequently with 1-2 times per
day for 2 weeks until sample collection. The whole-mounted corneal staining with β3-tubulin antibody demonstrated that SP application significantly promoted the regeneration of nerve fibers in diabetic corneal
epithelium (A, C, n=3 per group). In vitro, mouse trigeminal nerves were isolated and incubated in Neurobasal A medium as previous descriptions [1]. The fresh-isolated trigeminal neuronal cells were treated
with 30 mM glucose for 3 days with or without 1 µM SP. The results demonstrated that SP accelerated neuronal growth that was impaired by high glucose, as showed by the immunofluorescence staining with β3-
tubulin antibody (B) and the counting of total nerve fiber length (D, n=6 per group). * p < 0.05, ns: no significance.
References [1] Malin SA, Davis BM, Molliver DC. Production of dissociated sensory neuron cultures and considerations
for their use in studying neuronal function and plasticity. Nat Protoc. 2007;2:152–160. 88x95mm (300 x 300 DPI)
Page 32 of 34Diabetes
Page 33 of 34 Diabetes
Supplementary Table 1: Primary antibodies for immunofluorescent staining and Western blots
Primary antibody Residue Supplier Code
Substance P Santa cruz sc9758
p-AKT pS473 Epitomics 2118-1
AKT - Epitomics 1085-1
p-EGFR pY1068 Epitomics 1727-1
EGFR - Epitomics 1902-1
Sirt1 - AbCam Ab12193
NQO1 C-terminus AbCam Ab34173
Catalase - AbCam Ab16731
MnSOD - AbCam Ab13533
Ki-67 Abcam Ab15580
β3-tubulin R&D NL1195R
Alexa Fluor 488 donkey anti-rabbit IgG Life technologies A21206
Alexa Fluor 594 donkey anti-rabbit IgG Life technologies A21207
Donkey anti-goat IgG-CFL 488 Santa cruz sc362255
Page 34 of 34Diabetes
Supplementary Table 2: Primer sequences for qRT-PCR
Gene Accession
number Forward primer Reverse primer
MnSOD NM_013671.3 GTGGAGAACCCAAAGGAGAG AACCTTGGACTCCCACAGAC
Catalase NM_009804.2 GTCTTCGTCCCGAGTCTCTC CTGCCTCTCCATCTGCATTA
NQO1 NM_008706.5 GGCCCATTCAGAGAAGACAT TTCGAGTACCTCCCATCCTC
GCLC NM_010295.2 CAGCACGTTGCTCATCTCTT TTTGGAGGAGGAGGCTTAAA
TXN NM_011660.3 TGGTGGACTTCTCTGCTACG CTTCACAGTCTGCAGCAACA
Hmox1 NM_010442.2 GCACTAGCTCATCCCAGACA CATGGCATAAATTCCCACTG
GLRX NM_053108.4 CCTCAGTCAACTGCCTTTCA CTCCGGTGAGCTGTTGTAAA
Page 35 of 34 Diabetes