Structure and non-essential function of glycerol kinase in...

Schnick, C. and (2009) Structure and non-essential function of glycerol kinase in Plasmodium falciparum blood stages. Molecular Microbiology, 71 (2). pp. 533-545. ISSN 0950-382X

http://eprints.gla.ac.uk/4842/ Deposited on: 20 January 2009

Enlighten – Research publications by members of the University of Glasgow http://eprints.gla.ac.uk

Structure and non-essential function of glycerol kinase inPlasmodium falciparum blood stages

Claudia Schnick,1† Spencer D. Polley,2†

Quinton L. Fivelman,2† Lisa C. Ranford-Cartwright,3

Shane R. Wilkinson,2‡ James A. Brannigan,1*Anthony J. Wilkinson1** and David A. Baker2

1Structural Biology Laboratory, Department of Chemistry,University of York, York YO10 5YW, UK.2Department of Infectious and Tropical Diseases,London School of Hygiene and Tropical Medicine,London, WC1E 7HT, UK.3Institute of Biomedical and Life Sciences, Division ofInfection and Immunity, University of Glasgow, Glasgow,G12 8TA, UK.

Summary

Malaria pathology is caused by multiplication ofasexual parasites within erythrocytes, whereas mos-quito transmission of malaria is mediated by sexualprecursor cells (gametocytes). Microarray analysisidentified glycerol kinase (GK) as the second mosthighly upregulated gene in Plasmodium falciparumgametocytes with no expression detectable inasexual blood stage parasites. Phosphorylation ofglycerol by GK is the rate-limiting step in glycerolutilization. Deletion of this gene from P. falciparumhad no effect on asexual parasite growth, but sur-prisingly also had no effect on gametocyte develop-ment or exflagellation, suggesting that these life cyclestages do not utilize host-derived glycerol as acarbon source. Kinetic studies of purified PfGKshowed that the enzyme is not regulated by fructose1,6 bisphosphate. The high-resolution crystal struc-ture of P. falciparum GK, the first of a eukaryotic GK,reveals two domains embracing a capacious ligand-binding groove. In the complexes of PfGK with gly-cerol and ADP, we observed closed and open forms ofthe active site respectively. The 27° domain opening

is larger than in orthologous systems and exposes anextensive surface with potential for exploitation inselective inhibitor design should the enzyme prove tobe essential in vivo either in the human or in themosquito.

Introduction

Malaria remains a major challenge to global health with40% of the world population at risk. The burden of diseasefalls mainly on tropical Africa, accounting for more than90% of the estimated 500 million annual cases (Green-wood et al., 2005). The disease is caused by the proto-zoan parasite Plasmodium, which is transmitted by thebite of a mosquito; the vast majority of deaths are due toinfection with Plasmodium falciparum. The rapid spread ofdrug-resistant malaria parasites has led to an urgent needfor new drugs. The life cycle of the parasite is complex.When an infectious mosquito takes a human blood meal,sporozoites released from its salivary glands enter thebloodstream and invade liver cells. Subsequently, thou-sands of merozoites are released which invade red bloodcells where they replicate asexually and cause diseasepathology. A small proportion of these merozoites differ-entiate into male and female gametocytes that formextracellular gametes on entering the mosquito midgut.Following fertilization, motile zygotes (ookinetes) developinto oocysts that contain thousands of sporozoites, whichthen migrate to the mosquito salivary glands. These arethen passed on to another individual when the mosquitotakes its next blood meal.

To better understand the biology of the sexual stageof the malaria parasite, we used P. falciparum wholegenome microarrays to define a set of 246 genes in whichtranscription was gametocyte-specific (Young et al.,2005). One of the most highly upregulated transcriptsencodes a putative glycerol kinase (GK; ATP:glycerol-3-phosphotransferase, EC 2.7.1.30). GK catalyses the rate-limiting step of glycerol utilization, with phosphorylationserving to sequester the sugar in the cell. The GK reactionis situated at a junction in metabolism. Following itsphosphorylation, glycerol can be converted to dihydro-xyacetone phosphate by glycerol-3-phosphate (G3P)dehydrogenase and fed into the glycolysis or gluconeo-genesis pathways according to the metabolic status of the

Accepted 9 November, 2008. For correspondence. *E-mail [email protected]; Tel. (+44) 1904 328 271; **E-mail: [email protected];Tel. (+44) 1904 328 261. †These authors contributed equally to thiswork. ‡Present address: School of Biological and Chemical Sciences,Queen Mary, University of London, Mile End Road, London E1 4NS,UK.Re-use of this article is permitted in accordance with the CreativeCommons Deed, Attribution 2.5, which does not permit commercialexploitation.

Molecular Microbiology (2009) 71(2), 533–545 � doi:10.1111/j.1365-2958.2008.06544.xFirst published online 1 December 2008

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd

mailto:[email protected]

cell. Alternatively, it can serve as a precursor of glycero-lipid biosynthesis by becoming fatty acid acylated toproduce 1-acylglycerol 3 phosphate in a reaction cataly-sed by glycerol phosphate acyl transferase (Santiagoet al., 2004). The latter role is likely to be especially impor-tant following infection of red blood cells by P. falciparumwhen the parasite grows prolifically and divides toproduce up to 32 daughter cells over a 2 day period. Thisrapid growth is associated with active membrane biogen-esis requiring de novo biosynthesis of the glycerolipids,phosphotidyl-ethanolamine and phosphatidyl-choline.

Glucose is the main source of energy for the parasiteduring malaria infection. Although glycerol phosphate canbe derived from glucose, it would seem more efficient toutilize glycerol from the host serum for lipid biosynthesis toavoid utilization of the limiting substrate for growth.Indeed, glycerol from the host serum is incorporated intothe membranes in some Plasmodium species (Holz,1977; Vial and Ancelin, 1992). Red blood cells can take upthis triose efficiently through the aquaglyceroporin AQP3(Roudier et al., 1998) and it is presumed that a similarfacilitator exists to allow passage of the substrate fromthe red cell cytoplasm into the parasitophorous vacuole.The P. falciparum genome (http://plasmodb.org/plasmo/)encodes a single aquaglyceroporin-like polypeptide thatpresumably facilitates entry of glycerol into the parasite.

Here we have characterized P. falciparum GK activityboth in vivo and in vitro and present evidence that bloodstage malaria parasites (asexual or sexual) do not utilizehost-derived glycerol. To provide a platform for under-standing substrate binding, catalysis and regulation inPfGK, we also determined its three-dimensional structureto reveal a dimer in which extensive domain motionsaccompany ligand binding.

Results

PfGK mRNA expression is upregulated in sexual bloodstage parasites

A P. falciparum full-genome high-density oligonucleotidemicroarray was hybridized with cDNA derived fromcultures of highly synchronous asexual and sexualblood stage parasites. A potential GK orthologue, PfGK(PlasmoDB identifier: PF13_0269) was one of the mosthighly upregulated genes in gametocytes, but expressionlevels were barely detectable in asexual stage parasites(Fig. 1A). Northern blot analysis confirmed these findings;PfGK transcripts were detectable from early (stage II) tomature (stage V) gametocytes, but were not detectable inasexual ring or trophozoite stage parasites (Fig. 1B). APfGK antipeptide antibody reacted strongly with a band of~56 kDa in Western blots containing mature gametocyteproteins. Little or no signal could be detected in asexual

5.5

3.0

1.5

RESA

Glycerol

Kinase

Pfs16

kb

0

5

10

15

20

25

RBC S V V

7

V

RC T V RBC

56 kDa

ER ET ES M II III IV V SP

Absolu

te e

xpre

ssio

n levels

(n

orm

alis

ed x

10

)

0

2

4

6

8

10

12 RESA

Pfs16

Glycerol kinase

A

B

Life cycle stage

Parasite lysate (10 cells)

G3P

pro

duction

(10 cpm

)3

3

C

(-XA) (+XA) (no ATP)

D

R T II III V

Fig. 1. Sexual stage-specific expression of PfGK.A. Reanalysis of data obtained from screening of a P. falciparumfull-genome high-density oligonucleotide array with cDNA derivedfrom P. falciparum life cycle stage-specific mRNA (Young et al.,2005). The normalized absolute expression levels are presentedfor PfGK (PF13_0269), Pfs16 (a gametocyte-specific control,PFD0310w) and RESA (an asexual ring stage control, PFA0110w).ER, early rings; ET, early trophozoites; ES, early schizonts; M,merozoites; SP, sprozoites; II, III, IV and V are the individualgametocyte stages.B. Northern analysis using a probe derived from the PfGK codingregion (upper panel). The blot was re-hybridized with Pfs16 (middlepanel) and RESA (bottom panel) probes. Lanes contain equivalentamounts of mRNA from asexual ring (R) and trophozoite (T) stageparasites and from gametocyte stages II, III and V. Transcript sizes(kb) are indicated to the left.C. Western blot using a rabbit antipeptide antibody. RecombinantPfGK (RC) expressed as a 6-His fusion protein was used as apositive control. Lanes containing proteins from trophozoites (T)and stage V gametocytes (V) are shown. Proteins extracted fromhuman red blood cells (RBC) were used as a negative control.Lanes separated by vertical lines indicate individual samples thatwere not adjacent to each other on the blot. The size of nativePfGK is indicated to the left.D. Native GK enzyme activity presented as counts per minute(cpm). Lysates from gametocytes before (-Xa) and after (+Xa)stimulation of gametogenesis with xanthurenic acid; schizonts (S);human RBC and a negative control in which no ATP was added tothe gametocyte GK activity assay.

534 C. Schnick et al. �

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd, Molecular Microbiology, 71, 533–545

http://plasmodb.org/plasmo

blood stage protein preparations, adding to the evidencethat GK expression is either largely or exclusively sexualstage-specific (Fig. 1C). Measurement of GK activity incell lysates from either stage V gametocytes or purifiedschizonts demonstrated that enzyme activity was con-fined to sexual stage parasites (Fig. 1D). To deter-mine whether stimulation of gametogenesis caused anincrease in GK activity, we added xanthurenic acid tomature gametocytes, but no significant increase wasobserved. The expression profile of PfGK was confirmedby utilizing the 5′ upstream sequence of PfGK to driveexpression of green fluorescent protein (GFP) in episo-mally transformed parasites. The resulting transfectantsshowed evidence of GK promoter activity in both maleand female gametocytes, but not in asexual blood stageparasites (Fig. S1).

PfGK is a functional GK

To characterize PfGK biochemically, the deduced 501-amino-acid-residue coding sequence was expressed asa fusion protein with maltose-binding protein (MBP) inE. coli. GK-deficient E. coli mutants were transformedwith a plasmid expressing the PfGK–MBP fusion proteinand plated on McConkey agar plates containing glycerol.Mutants transformed with empty vector plasmid producedyellow colonies, indicating that they were unable to utilizeglycerol as a carbon source, whereas transformation withthe plasmid containing the PfGK–MBP gene producedbright pink/purple colonies. Thus PfGK can functionallycomplement the E. coli GK-deficient mutants (Fig. S2).

The PfGK fusion protein was purified before removal ofthe MBP portion and determination of KM and Vmax for both

glycerol and ATP. For each substrate, the kinetic analysiswas performed at a constant and saturating concentrationof the partner substrate, this being 5 mM glycerol and2.5 mM ATP (Fig. S3). The Vmax values (U mg-1) were15.5 � 0.4 for glycerol and 18.3 � 0.35 for ATP. The KM

values of 21 � 1 mM (ATP) and 18 � 2 mM (glycerol) aresimilar for both substrates and comparable to those deter-mined for E. coli GK (EcGK) (Feese et al., 1998). Theglycolytic intermediate fructose-1,6-bisphosphate (FBP)is an allosteric effector of EcGK that traps the enzyme inan inactive tetrameric state with a Ki of 0.25 mM (Ormoet al., 1998). At the highest concentrations of FBP tested(100 mM) the decrease of the rate of glycerol phosphory-lation by PfGK was only twofold, suggesting that FBP isnot a physiological regulator of PfGK (Fig. S4).

GK is not required for asexual blood stage replication,gametocyte development or exflagellation

To investigate the role of GK in P. falciparum develop-ment, we disrupted the PfGK gene (Fig. 2) which is theonly GK orthologue in the genome. Clones were obtainedthat had undergone double-crossover homologousrecombination events, resulting in the deletion of theC-terminal 338 residues of PfGK. This region encom-passes the majority of the ATP-binding motifs (see below),and therefore the truncated gene arising from the integra-tion event is expected to be inactive. The genotype wasverified by a combination of PCR and Southern blot analy-sis (Fig. 2). Northern blot analysis confirmed that themutant no longer expressed PfGK mRNA (representativeclone shown in Fig. 3A). Gametocytes from both PfGK-

and wild-type (Wt) parasites were tested for GK enzyme

Wt A2 AP Wt A2 AP3' probe deletion probe

Wt A2 AP Wt A2 AP3' probe deletion probe

SpeI

EcoRI

A

E

E E

E

S

S

SE

S E

S

ORF

Integration

5'

5'

3'

3'

B

double crossover

13.011.6 11.6

17.6 17.6

6.1

17.6 kb

11.6 kb

13.0 Kb

6.1 kb

Fig. 2. Schematic of the Wt and PfGK- disrupted loci with restriction fragment sizes predicted and confirmed by Southern blotting.A. Southern blot analysis of P. falciparum PfGK- clones and a Wt 3D7 clone. A2 and AP are independent PfGK- clones (double-crossoverrecombination). Band sizes are indicated by arrows. Restriction digests with SpeI (above) and EcoRI (below) are shown. Blots were probedwith two 32P-labelled probes. The first (3′ probe, indicated by a white circle) corresponds to the PfGK coding region immediately downstreamof the deleted sequence and the second (deletion probe, indicated by a black circle) corresponds to the deleted sequence shown in black onthe Wt schematic (right panels).B. Schematic diagram showing the gene knockout strategy using the pHTK-GK vector (dotted). The expected band sizes of the Wt andrecombinant PfGK loci following integration are shown below. S and E denote SpeI and EcoRI sites respectively.

Glycerol kinase from P. falciparum 535


activity. GK enzyme activity was absent in the PfGK-

mutant (Fig. 3B), confirming functional disruption of thePfGK gene.

Disruption of the PfGK gene had no measurable effecton asexual blood stage growth (data not shown), consis-tent with the evidence that the gene is not expressed during

this phase of the life cycle. Somewhat surprisingly, disrup-tion of the gene had no detectable effect on gametocytedevelopment, even though the enzyme is active in Wtgametocytes. Furthermore, levels of ‘rounding-up’ (theinitial morphological change of gametogenesis) of maleand female gametocytes as well as exflagellation (emer-gence of motile male gametes from red blood cells)(Fig. 3C) were equivalent in control and mutant clones.

Structure solution and overall structure of PfGK

The crystal structure of PfGK in complex with glycerol wassolved by molecular replacement using EcGK (Feeseet al., 1998) as a search model. The structure was refinedagainst data extending to 1.5 Å spacing to give a finalmodel that agrees well with the X-ray terms (Table 1).

The 501-residue GK polypeptide is arranged as twodomains separated by a deep cleft (Fig. 4). Each domain isconstructed around a bbbababa core that is characteristicof the sugar kinase/Hsp70/actin superfamily of proteins(Bork et al., 1992; Hurley, 1996). Domain I (residues 1–262and 436–471) comprises b3b2b1a1b5a6b12a9 and domainII (residues 263–435 and 472–501) consists ofb16b14b13a12b19a13b20a14 (Fig. 5). Elaborations of this coreendow GK with distinct features. In domain I, large inser-tions before and after helix a6 produce a compact, largelya-helical subdomain. In domain II, strands b15 and b21 flankthe core b-sheet and extend it to seven strands. Theprincipal insertions are between b16 and a12, and at theC-terminus where the 50 residues following helix a14 forma strap around the periphery of domain II. In agreementwith gel filtration experiments (data not shown), PfGK is adimer in the crystal (Fig. 4B). The majority of the dimer-forming segments of the polypeptide are in domain II.At theheart of the interface, strands b17 from each chain align inan antiparallel manner so that an intermolecular four-stranded b-sheet is formed. In the dimer, 1750 Å2 of other-wise accessible surface area on each subunit is buried.

Ligand binding and domain movement

Glycerol is defined by electron density deep in the cavitybetween the domains (Figs 4 and 6). Its hydroxyl groupsfulfil their hydrogen bonding potential through charge–dipole interactions with Glu84, Arg83 and Asp246 anddipole–dipole interactions with Arg83, Tyr135 and Gln247(Fig. 4C). The C3-OH of the glycerol forms hydrogenbonds to two water molecules that occupy a narrowchannel to the protein surface. The apolar face of theglycerol moiety packs against the side-chains of Trp103and Phe271 (Fig. 4C), the latter representing the onlyglycerol-binding residue contributed by domain II. Thepattern of interactions is similar to that in glycerol com-plexes of bacterial GKs (Hurley et al., 1993; Yeh et al.,

A

Gametocyte Cytosol

Pro

du

ctio

n o

f G

-3-P

(10

cp

m)

Wt Wt

(-ATP)

PfGK-

B

Glycerol Kinase

Pfs16

Wild type Pf

R S III IV V VGK-

C

3

Experiment

3

20

16

12

8

4

0

even

ts p

er 1

0 c

ells

0

50

100

150

200

1 2 3

P=0.226

P<0.001

Exf

lag

ella

tio

n

Wt PfGK-

Fig. 3. Phenotype analysis of GK knockout clones.A. Northern analysis of P. falciparum WT and PfGK- (clone A22F)probed with the deleted portion (upper panel) and a Pfs16 probe.The blot contains Wt 3D7 mRNA samples from asexual ring (R)and schizont (S) stages and gametocyte stages III–V as well asmRNA from PfGK- stage V gametocytes.B. Native GK enzyme activity is presented as counts per minute(cpm) incorporated in lysates from Wt and PfGK- gametocytes.A negative control is included in which no ATP was added to theWt enzyme assay. The error bars represent the 95% confidenceinterval of the mean enzyme activity from multiple assays, whichranged in number from 9 (PfGK-) to 13 (Wt) utilizing at least twodifferent gametocyte preparations for both Wt and PfGK- parasites.The P-value shows the significance of the difference between theactivity levels of Wt and PfGK- as calculated by a Mann–WhitneyU-test in STATA.C. Levels of exflagellation in P. falciparum Wt and a PfGK- clone.The number of exflagellation events per 103 cells was counted. Theresults are from three separate experiments counted in duplicate.The error bars represent the 95% confidence interval of the meanof the two readings within a single experiment, while the P-valuewas calculated by a Poisson regression in STATA to look for asignificant difference in exflagellation rates while adjusting for theeffects of the different exflagellation rates in different experiments.



2004). The PfGK–ADP crystals have different cell param-eters (Table 1) and it is apparent that domains I and II havemoved apart and that the enzyme is in an ‘open’ confor-mation (Fig. 4B). The relative domain movement can bedescribed as a 27.5° rotation, substantially larger than the7° rotation deduced from crystal structures of orthologousenzymes (Bystrom et al., 1999; Yeh et al., 2004). In thedimer, the long axis increases in length from 97 Å to 117 Å(Movie S1), exposing a further 1500 Å2 of solvent acces-sible surface area around the active site. In the open(ADP-bound) structure, interdomain contacts such asGln12-Thr268 and the salt-bridges Arg83-Glu306 andGlu109-Arg363 are ruptured. The largest changes in dihe-dral angles occur at residues Phe271-Leu272 and Glu306-Ser308 near the glycerol-binding site and Ser470-Asp471.Aspects of the glycerol pocket are maintained, with a pair ofethylene glycol (cryoprotectant) molecules clearly mimick-ing protein interactions formed by glycerol (Fig. 4E).However, as a result of domain movement, Phe271 andTyr135 are significantly displaced (Fig. 4C and E). ResidueTyr354, whose hydrophobic nature is conserved amongeukaryotic GK sequences, occludes the alternate con-former of Tyr135 in the closed form of the enzyme.

In contrast to glycerol, which binds predominantly todomain I, ADP in the PfGK–ADP complex is bound exclu-sively to domain II (Fig. 4B).ADP is bound with the adeninebase tucked into a pocket and the ribose and phosphatemoieties more exposed on the enzyme surface extendingtowards the interdomain cleft. The adenine base formspolar interactions with Asn418 and Ser332. The rathermodest set of polar interactions with the ribose and phos-phate groups involving Thr268, Gly313, Gly414 andMet415 (Fig. 4D) are likely to be augmented in the ternaryclosed complex with ATP. The glycerol and adenine nucle-otide binding sites are sufficiently similar to that of EcGK toinfer a common phosphotransfer mechanism of action inwhich the binding of glycerol and ATP to domains I and IIrespectively, is followed by domain closure to sequesterthe phosphotransfer chemistry from the bulk solvent. Aplausible mechanism foresees the base catalysed activa-tion of the C3 hydroxyl of the glycerol by Asp246 for in-linenucleophilic attack on the g-phosphorus of the nucleotide(Hurley et al., 1993). The accumulating charge in thepentaco-ordinate phosphate intermediate would be stabi-lized by surrounding protein residues prior to its collapse toform the products G3P and ADP.

Table 1. Data collection and refinement statistics.

PfGK–glycerol PfGK–ADP

Data collectionSpace group P21 P21

Unit cell dimensionsa, b, c (Å) 101.9, 100.7, 107.8 82.5, 57.6, 123.9a, b, g (°) 90.0, 92.5, 90.0 90.0, 89.75, 90.0

Resolution (Å) 107.83–1.49 (1.53–1.49)a 124.03–2.41 (2.47–2.41)Rsym

b 0.084 (0.744) 0.104 (0.843)I/sI 11.99 (2.23) 10.95 (0.71)Completeness (%) 73.6 (18.4)c 91.4 (40.6)Redundancy 4.3 (3.4) 3.7 (1.9)Refinement

Resolution (Å) 37.85–1.49 49.45–2.41No. reflections 247 409 (4574) 39 658 (1280)R-factord/Rfree

e 0.15/0.20 0.19/0.25Asymmetric Unit 2 dimers 1 dimerNo. atoms

Protein 16 116 8032Ligand 72 glycerol 248 ethylene glycol 54 ADP 84 ethylene glycolWater 1929 307

B-factors (Å2)Protein 15.5 45.6Ligand 23.9 54.4Water 30.5 44.8

Root mean squared deviationf

Bond lengths (Å) 0.015 0.018Bond angles (°) 1.66 1.76

a. Values in parentheses are for highest-resolution shell.b. Rsym = ShklSi|Ii - <I> |/ShklSi <I> where Ii is the intensity of the ith measurement of a reflection with indexes hkl and <I> is the statistically weightedaverage reflection intensity.c. The completeness in the resolution shell 1.85–1.80 Å is 96% and in the resolution shell 1.72–1.67 Å it is 54%.d. R-factor = S||Fo| - |Fc||/S |Fo| where Fo and Fc are the observed and calculated structure factor amplitudes respectively.e. Rfree is the R-factor calculated with 5% of the reflections chosen at random and omitted from refinement.f. Root mean square deviation of bond lengths or bond angles from ideal geometry.



Discussion

Glycerol metabolism in P. falciparum

Glycerol kinase is a ubiquitous enzyme with importantroles in carbohydrate and lipid metabolism in plants and

animals. Interference in the function of GK can haveadverse consequences in many organisms, ranging fromreduced growth on glycerol in fungi (Witteveen et al.,1990) to debilitating disease in humans (McCabe, 2001).In this study, we have shown that disruption of the

A B

DC

E



Fig. 4. Protein structure.A. Ribbon tracing of PfGK–glycerol, colour ramped from the N-terminus (red) to the C-terminus (blue) and with the domains labelled I and II.The glycerol ligand is shown in space-filling representation coloured by atom.B. Ribbon tracing of the PfGK–glycerol and PfGK–ADP dimers with the chains coloured red and yellow. The glycerol and ADP ligands areshown in space-filling representation in closed (left) and open (right) forms of the structure respectively. The view is such that thedimer-forming domains (II) are in the same orientation in each structure.C. The glycerol-binding site in PfGK–glycerol with the glycerol ligand displayed with its associated electron density and with surroundingprotein residues labelled. For map calculation, the glycerol ligand was deleted from the final co-ordinate set and five cycles of refinement inREFMAC were carried out. The map was calculated with sigma A weighted coefficients Fobs - Fcalc and acalc and is contoured at 4s. Dashed linesindicate polar interactions and atoms are coloured according to type: C green (except for glycerol), O red and N blue. Two water moleculesthat bond to the C3-OH are shown as red spheres.D. The ADP binding site in the PfGK–ADP complex with the ADP ligand displayed with its associated electron density. An omit map wascalculated as in (C) and the electron density is displayed at the 3s level.E. Stereo-view of the glycerol-binding site in the PfGK–ADP complex. Residues that form polar interactions with the glycerol in thePfGK–glycerol complex are shown surrounding a pair of ethylene glycol molecules (EG1 and EG2). The phosphate groups of the ADP can beseen in the lower right hand corner of the image. The electron density displayed is an omit map calculated after deletion of the ADP, EG1 andEG2 species from the co-ordinate set and following five cycles of REFMAC refinement. The map is displayed at the 3s level. It is apparent thatalthough the glycerol-binding pocket is rearranged, the pair of ethylene glycol molecules together mimic many of the interactions formed bythe glycerol. It is also apparent that there are additional electron density features in the cavity of the open structure that we have been unableto account for in our model, including a flat section stacked between the aromatic rings of Trp103 and Phe271 in both subunits of the dimer.

Fig. 5. Protein sequence alignment of GK from P. falciparum, human, E. coli and En. casseliflavus. This figure was generated with ESPript(Gouet et al., 1999) and adjusted manually to optimize structure-based alignment. The secondary structure elements and turns (TT) of PfGKare shown. Strictly conserved residues are boxed and coloured red. Residues implicated in ligand binding are indicated with green triangles(glycerol) and blue circles (ADP). The phosphorylated histidine of EnGK is marked with a star. For clarity, the C-terminal 31 residues ofHuman GK are not shown.



malaria parasite GK gene has no effect on the bloodstages of the parasite life cycle even though thesestages are characterized by high-energy requirementsand prolific metabolic activity, including glycerolipidbiosynthesis. It is known that there is a functionalaquaglyceroporin in P. falciparum and it is possible thatglycerol is acquired by the parasite from the human hostserum via the erythrocyte cytoplasm. It has thereforebeen tempting to speculate that serum glycerol is asource of G3P for the parasite (Hansen et al., 2002).However, it is clear from our results that synthesis ofG3P by the parasite GK does not occur during thegrowth of P. falciparum asexual blood stages in vitro.This suggests that under these conditions, energy pro-duction and/or glycerolipid biosynthesis in these lifecycle stages occurs independently of the parasite GKand host-derived glycerol. It is therefore likely that gly-colytic processing of glucose is the source of G3P inasexual blood stage parasites.

It has been shown in Plasmodium berghei that manymRNA species are stored, and remain untranslated in

female gametocytes until the parasites are later taken upby a mosquito. Deletion of the gene encoding an RNAhelicase, Dozi (development of zygote inhibited) abro-gated this translational repression for more than 370 tran-scripts (Mair et al., 2006). In the absence of sex-specificdifferences in regulation, it is likely that the phenomenonof translational repression does not explain the lack ofphenotype in PfGK- gametocytes because GK proteinand enzyme activity were detectable in Wt (but not PfGK-)gametocytes. Even so, the mutant gametocytes devel-oped normally and male gametocytes exflagellated. Thissuggests that while GK can phosphorylate glycerol in Wtgametocytes, the resulting intracellular pool of G3P (or itssubsequent metabolic products) is not utilized until later indevelopment within the mosquito.

GK in vitro and in vivo

The non-essential nature of GK in P. falciparum asexualreplication is surprising as it is known that host glycerol istaken up by Plasmodium knowlesi and incorporated into

Fig. 6. Structure representation of proteinwith bound ligands. (Left) Surface renderingand (Right) ribbon diagram of a PfGK subunitwith bound ligands glycerol (top) and ADP(bottom) shown in space-filling representation(blue).



parasite phospholipids (Vial and Ancelin, 1992). In con-trast to P. falciparum, the GK gene from the rodent malariaparasite P. berghei is refractory to deletion (C. Janse, A.Waters, Leiden, Netherlands; D.A.B., unpubl. obs.), sug-gesting that PbGK may be essential for asexual bloodstage growth in this species. This finding is consistent withthe detection of PbGK mRNA in asexual blood stages(A. Waters, pers. comm.) and our measurements of GKactivity in P. berghei asexual blood stage parasite extracts(data not shown). Mutants of P. berghei in which the aqua-glyceroporin orthologue has been deleted are viable, butthese parasites are defective in glycerol transport andlower levels of asexual multiplication occur relative to Wtparasites (Promeneur et al., 2007). Transgenic micelacking the aquaglyceroporin AQP9 (defective in the rapiduptake of glycerol) can support growth of P. berghei, butthe lethal effects of infection are delayed (Liu et al., 2007),suggesting that uptake of glycerol plays a role in virulencein P. berghei infection. In contrast, our results show thatutilization of exogenous glycerol is not important inP. falciparum blood stage parasites in vitro, highlighting apossible difference in metabolism between these twoPlasmodium species. Alternatively this may reflect theplentiful supply of glucose available to P. falciparumgrown in vitro.

A recent paper has examined gene expression using afull-genome microarray with P. falciparum mRNA isolateddirectly from patients (Daily et al., 2007). By comparingthe patterns of expression with those of yeast grownunder different conditions, three distinct clusters ofmalaria parasites were defined. In terms of genes/pathways turned on and off, the clusters resembled:yeast grown under normal conditions, under starvationconditions and yeast exposed to environmental stress.Intriguingly in the context of the present study, GK(and other genes implicated in glycerol metabolism) isupregulated in the cluster corresponding to yeast grownunder starvation conditions. It seems therefore that incertain clinical situations, GK may be expressed inP. falciparum asexual blood stage parasites in vivo. Forexample, patients often become hypoglycaemic and, ifglucose became limiting, then exogenous glycerol mightbe utilized as previously suggested (Beitz, 2007). It isalso possible that host-derived glycerol is not utilized(and PfGK not expressed) by P. falciparum blood stagesin vivo and that the PfGK transcripts detected in malariapatient samples (Daily et al., 2007) reflect the presenceof circulating gametocytes and sexually committed ringstage parasites.

Implications for regulation of PfGK

As an enzyme that catalyses a reaction that sits at animportant junction in metabolism, GK is normally subject to

metabolic regulation. In contrast to the common catalyticmechanism suggested by crystal structures and sequencecomparisons, the regulatory mechanisms differ betweenspecies. GK from E. coli is allosterically regulated by theglycolytic intermediate fructose (1,6)-bisphosphate (FBP).FBP promotes the assembly of active enzyme dimers intoinactive tetramer forms. The crystal structure of theEcGK : FBP complex reveals a stoichiometry of two FBPmolecules per GK tetramer with each FBP species boundto a pair of symmetry related glycine-rich loops(I229GGKGGTR236) situated at the dimer–dimer interface inthe tetramer (Fig. S4), some 25 Å from the active site(Ormo et al., 1998). The glycine residues form polar inter-actions with the phosphate groups of the sugar, whichadditionally form ion-pairing interactions with the side-chains of the two Arg236 residues which are critical forregulation. The data presented here show that PfGK is notinhibited by FBP at concentrations that are likely to beencountered physiologically. Moreover, as is evident fromFig. 5 and Fig. S4, the FBP binding site in EcGK is alteredin PfGK. In PfGK, the b11-b12 loop (residues 227–238,Fig. 5) corresponding to the glycine-rich loop in EcGK iswell defined in the electron density maps. In contrast to theexposure of these loops in EcGK, in PfGK this loop isoriented towards the core of the dimer, an orientation thatwould sterically hinder tetramer formation. Moreover, theloop is devoid of the glycine and arginine residues (Fig. 5)that mediate FBP binding in EcGK, supporting the conclu-sion that PfGK is not regulated by FBP.

EcGK is also allosterically regulated by the phospho-enolpyruvate: phosphotransferase system (PTS) proteinIIAGlc which serves to ensure that glycerol is not utilizedwhen more rapidly metabolized sources of energy arepresent. IIAGlc, in its unphosphorylated state binds to andinhibits EcGK. The structure of the EcGK : IIAGlc complexreveals that the IIAGlc inhibitor binds to a helical segmentof domain II (residues 474–481), 30 Å from and distal tothe active site (Hurley et al., 1993). As the phosphorylat-able histidine is at the heart of the EcGK binding surface,it is clear why phosphorylation of IIAGlc, which occurs inthe absence of PTS substrates, prevents GK binding andinhibition. A BLAST search of the P. falciparum genome forproteins with similarity to IIAGlc identified no obvious can-didates, indicating that this form of regulation is not impor-tant in this organism. It is interesting, nevertheless, thatthe sequence of the amino terminus of helix a16 of PfGK,which corresponds to the IIAGlc binding site in EcGK, fea-tures a string of six consecutive basic residues (Fig. 5).

The PTS regulation of GK activity also occurs inGram-positive bacteria. In these organisms, the modifi-cation is covalent rather than allosteric, with phosphory-lation of a conserved histidine on GK by the PTScomponent HPr leading to enzyme activation (Darbonet al., 1999). This histidine is situated in the loop corre-



sponding to the glycine-rich loop of EcGK and thecrystal structure of GK from Enterococcus casseliflavusshows that this residue is exposed on the enzymesurface (Yeh et al., 2004). Surprisingly however, thestructure shows a quite different arrangement of thesubunits in the dimer such that the two phosphorylatablehistidines (His232) in the EnGK are adjacent. This his-tidine residue is conserved in PfGK (Fig. 5), although itremains to be determined whether PfGK is regulated byphosphorylation.

The common theme in bacterial regulation of GK activ-ity is long-range communication between the site of effec-tor binding/modification and the site of ligand binding andcatalysis. This suggests that regulatory sites in PfGK willnot be discernible in the crystal structure in the absence offurther experimental information.

Conclusions

The non-essential character of GK in the blood stages ofP. falciparum infection in vitro is surprising given theextent of upregulation of its gene, and the demonstrationof enzyme activity in the sexual red blood stages(gametocytes). The results may mask an essential func-tion in vivo, alternatively the upregulation in the sexualstages may anticipate an essential role in the mosquitostages which have not been investigated. The three-dimensional structure of PfGK which is the first, to ourknowledge, of a eukaryotic GK, suggests a common cata-lytic mechanism with the bacterial GKs and indicates thatthese enzymes can undergo very large conformationchanges in their reaction cycle. The extensive surface ofPfGK which embraces the ligand binding site could beexploited for the design of specific inhibitors should theenzyme prove to have an essential role in the parasite lifecycle in vivo.

Experimental procedures

Parasite cultivation

Gametocyte-producing P. falciparum clone 3D7 was main-tained in asexual form in A+ red blood cells in 10% serumunder standard conditions (Trager and Jensen, 1976).Stage V gametocytes were Nycodenz-purified as previouslydescribed (Fivelman et al., 2007) and gametogenesis wasinduced with 20 mM xanthurenic acid (Billker et al., 1998). Forexflagellation assays, cells were resuspended at a concen-tration of 5 ¥ 106 ml-1. Ten minutes after induction, cells wereobserved by light microscopy and counted for a further10 min, during which time up to 10 000 cells were observed.

Generation and genotyping of transgenic parasites andphenotype analysis

Genetic manipulation of 3D7 was achieved by transfectionwith pHTK-based plasmids (Duraisingh et al., 2002). Trans-

fection of P. falciparum 3D7 parasites was carried out accord-ing to standard procedures (Deitsch et al., 2001) and drugselection performed using WR99210 and ganciclovir (Durais-ingh et al., 2002). Parasite lines were cloned by limitingdilution. Genotyping was carried out by a combination of PCRusing primer pairs diagnostic for integration and hybridiza-tions with both genomic Southern blots and pulsed-field gelelectrophoresis blots according to standard procedures(Sambrook et al., 1989).

Northern and Western blotting

RNA was extracted from purified 10-day-old stage V game-tocytes using Trizol (Invitrogen) and analysed by Northernblot using BrightStar-Plus nylon membrane (Ambion). DNAprobes (Pfs16 and RESA) were amplified by PCR as previ-ously reported (Sharp et al., 2006; Fivelman et al., 2007).Schizont and gametocyte protein preparations were boiled inreducing sample buffer, run on a 10% polyacrylamide gel andtransferred to nitrocellulose membrane. Membranes wereblocked in 2% ECL Advance (GE/Amersham Biosciences).Polyclonal antipeptide antibodies against the PfGK peptideCAKYNNNDIQKKTGTY were raised in rabbits and purified(Eurogentech). Blots were probed with the anti-PfGK primaryantibody (1:500) and HRP-conjugated goat anti-rabbit sec-ondary antibody (Bio-Rad; 1:20 000). Signals were detectedusing ECL reagents (GE/Amersham Biosciences).

Microarray data

Normalized absolute expression values from P. falciparummicroarray data from our recent analysis (Young et al., 2005)were plotted for: early rings, early trophozoites, early sch-izonts, merozoites, gametocyte stages II, III, IV and V andsporozoites.

Construction of GK knockout plasmid

A 1342 bp 5′ flanking region of the PfGK gene and a 3′flanking region of 1506 bp were inserted into the pHTK vectorto mediate gene knockout. This vector contains the humandihydrofolate reductase (hdhfr) gene that confers resistanceto the antifolate WR99210 for positive selection and theHerpes simplex thymidine kinase gene for negative selection.The two flanking fragments were inserted into the vectorat either end of the hdhfr cassette to facilitate genereplacement. The fragments were amplified using the primerpairs 5′KOF-SpeI GGACTAGTCCTATATTATACACATCAATCATAC with 5′KOR-EcoRI GGGAATTCCTTAACATCGGATATGGGTA and 3′KOF-BglII GGAGATCTTTATCCTATAACTGCAGTACCATCATC with 3′KOR-ClaI GGATCGATTATTACACACAGTTCTTCAACC respectively (restriction sitesunderlined).

The primers used in diagnostic PCR for analysing thegenotype of GK knockout clones were the P. falciparum GKupstream and downstream primers GKupF GTTTTGATTGACACACTTATTGTA and GKdnR CAATATATGTTTTCCTCATAGCATG. A double cross-over was confirmed with theseprimers to show a change in the resultant product size



caused by replacement of the GK sequence with DHFR. Forthis PCR, an extended elongation time of 8 min was used.

GFP reporter analysis

A stable episomally transformed P. falciparum line wasproduced comprising the 5′ untranslated region of PfGKupstream of the green fluorescent protein (GFP). Fluores-cence microscopy was carried out in conjunction with sex-specific antisera to investigate GK expression in male andfemale gametocytes. Procedures are described in the legendto Fig. S1.

Expression and purification of PfGK

The coding sequence of PfGK was amplified by PCR andcloned into the pMALc2x vector (New England Biolabs) usingthe BamHI and HindIII restriction sites. Expression in E. coliBL21* (Stratagene) produced PfGK as an MBP fusion with aFactor Xa cleavage site at its N-terminus. Overnight culturesgrown in LB medium + 100 mg ml-1 ampicillin were used toinoculate autoinduction medium (Studier, 2005) at a ratio of1:1000. The cultures were incubated for 8 h at 37°C and then16°C overnight.

The cells were harvested by centrifugation and resus-pended in buffer A (50 mM Tris pH 8.0 containing 50 mMarginine and 50 mM glutamate). Cell extract was loaded ontoamylose resin high flow (New England Biolabs), equilibratedwith buffer A, and the fusion protein was eluted in bufferA containing 10 mM maltose. Fractions containing PfGK–MBP were pooled for anion exchange chromatography usingQ-Sepharose. Two distinct forms were eluted by a salt gra-dient that presumably reflect different oligomeric states, oneof which was prone to aggregation. Fractions containingsoluble PfGK–MBP were pooled for removal of MBP byproteolysis. Digestion with Factor Xa was incomplete evenafter prolonged incubation. Limited digestion with trypsin(1:100 ratio, 90 min at 20°C) revealed that this proteasepreferentially cleaves close to the Xa site. The Mr of cleavedPfGK was measured by mass spectrometry to be 57 289,which corresponds to the expected mass of the 501 PfGKresidues plus an additional six N-terminal residues from thelinker region (calculated Mr 57 273). The digestion productswere loaded onto a Superdex 200 gel filtration column equili-brated with 50 mM Tris pH 7.5 and 50 mM NaCl. PfGK elutedas a peak with a retention volume corresponding to a Mr of115 000 implying a dimer.

Native GK activity assays

Purified stage V gametocytes and mature asexual schizontswere assayed for cellular GK activity using [3H]-glycerol (TRA-118, GE/Amersham Biosciences) (Guan et al., 2002). Activitywas measured in the form of counts per minute incorporatedinto [3H]-G3P. Aliquots of 107 purified cells were re-suspendedto a final volume of 100 ml with lysis buffer (25 mM Tris HClpH 7.0, 15 mM MgCl2, 2 mM MnCl2, 1 mM DTT, 10 mM NaFand Mammalian Tissue protease inhibitors) before storage at-80°C. Parasites were lysed by three rounds of freeze–thaw ina dry ice/ethanol bath followed by incubation at 30°C before

being centrifuged at 12 000 g for 5 min to remove membranefractions. Five microlitres of the resulting cytoplasmic fractionswere incubated in a 50 ml reaction volume [25 mM Tris HCl(pH 7.0), 15 mM MgCl2, 2 mM MnCl2, 1 mM DTT, 45 mM ATP,10 mM b-glycerol-2-phosphate, 10 mM NaF and 160 mM[3H]-glycerol] at 30°C for 30 min. The reaction was halted bythe addition of 100 ml methanol. 30 ml volumes were spottedonto DE81 paper (Whatman, UK), washed in H2O and driedbefore addition of 3 ml of scintillation fluid (Optiphase ‘Super-mix’, PerkinElmer). Radioactivity was measured using aBeckman LS6000LL scintillation counter. Background activityof a control reaction with H2O added instead of parasite extractwas subtracted. For details of derivation of kinetic constants,see legend to Fig. S3.

Crystallization and structure solution

PfGK (3.5 mg ml-1 in 50 mM Tris pH 7.5, 50 mM NaCl) wascrystallized by vapour diffusion. Hanging drops consisting of1 ml protein and 1 ml of reservoir solution containing 50 mMpotassium formate, 20% PEG 3350, 25% ethylene glycol,10 mM lauryldimethylamine oxide and 20 mM glycerol(Solution A) were equilibrated against 0.5 ml reservoir solu-tion at 20°C. The resulting thin crystal plates were used asseeds to obtain larger crystals. For ADP complex formation,crystals were soaked for 4 days in solution A containing 5 mMADP and 10 mM MgCl2. Although the appearance of thePfGK–ADP and PfGK-glycerol crystals is similar, the celldimensions and molecular packing are different. It is there-fore likely that the crystals dissolved and regrew during theperiod of soaking although these experiments were not moni-tored closely.

Data were collected on synchrotron beamline ID14.2 at theESRF and analysed using programs in the CCP4 suite(CCP4, 1994). Data collection and refinement statistics aresummarized in Table 1. For the PfGK–glycerol data set, alldata were used in molecular replacement calculations in theprogram MOLREP (Vagin and Teplyakov, 2000) using EcGK(PDB code 1bu6) as a search model (41% sequenceidentity). Automated model building was carried out usingARP/wARP (Perrakis et al., 1999). After six cycles of auto-building, 1769 residues were found with sequence coverageof 92%. During this process the R-factor dropped from 0.543(Rfree 0.539) to 0.233 (0.277). The model was refined byiterative cycles of REFMAC (Murshudov et al., 1997) usinganisotropic temperature factors. Manual modelling of missingfragments and final adjustments were carried out in COOT(Emsley and Cowtan, 2004). Refinement was concluded withan R-factor of 0.15 (Rfree 0.20) for all data and a final modelcontaining all 501 residues of four chains from two dimers, 12glycerol molecues (four in the active sites), 62 ethylene glycolmolecules (present at 25% in the crystal cryoprotectant) and1929 water molecules. These protein chains can be super-imposed to give pairwise root mean squared deviations in Capositions in the range 0.2–0.3 Å. Superposition onto chains ofthe EcGK molecular replacement model gives root meansquared deviation values of ~1.5 Å. Interestingly, PfGK con-tains 12 cysteine residues, none of which are conserved inEcGK and none of which are involved in disulphide bondformation, although the sulphur atoms of Cys251 and Cys292are separated by only 4 Å.



The PfGK–glycerol dimer model was used to find amolecular replacement solution for the PfGK–ADP data set.The MOLREP solution was unsatisfactory, with only a singledomain of each monomer occupying electron density. Themodel was partitioned into separate domains. Domains I(residues 1–307 and 440–471) were fixed while a search wascarried out with domains II comprising the remainder of themodel. This produced a clear solution with the resultingdomains II shifted by symmetry operations and connected tothe corresponding domains I, revealing one dimer in theasymmetric unit. The model was refined by iterative cycles ofREFMAC and manual modelling in COOT. TLS parameteriza-tion and NCS restraints applied towards the end of refine-ment improved the statistics with a resulting R-factor of 0.19(Rfree 0.25). The final model contains two protein chains, twoADP ligands and 21 ethylene glycol species, four of which arelocated in the two glycerol binding pockets. Ethylene glycol ispresent at 200 times the concentration of glycerol after addi-tion of the cryoprotectant to the crystal. The reason whyethylene glycol displaces glycerol in the open PfGK–ADPcomplex but not the closed PfGK–glycerol complex is notclear, although it may be due to the longer time of incubationof the PfGK–ADP crystals in the cryoprotectant solution priorto freezing.

Ramachandran plots of the glycerol- and ADP-ligandedmodels according to PROCHECK show that 92.3% and 88%of the residues, respectively, lie in the most favoured region.Residues Ala312 and Tyr354 of both structures fall into thegenerously allowed region. Glu84, which is involved in glycerolbinding, is the only residue that lies in a disallowed region ofthe Ramachandran plot in all molecules, an observation that isnotable as steric strain in well-refined structures correlateswith functional significance (Herzberg and Moult, 1991).

Data deposition

The co-ordinates and structure factors for PfGK–glycerol(pdb code 2w40) and PfGK–ADP (pdb code 2w41) have beendeposited in the Protein Data Bank (http://www.pdb.org).

Acknowledgements

This work was funded by the Wellcome Trust (Malaria Func-tional Genomics Initiative, Grant No. 066742/F/01/Z) and theEuropean Commission (FP6 SIGMAL Grant, ref 073021/Z/03/Z). We are grateful to Edward McCabe for providing E. coliGK-deficient mutants; Andy Waters and Chris Janse forsharing unpublished data; Louisa McRobert, Cathy Taylor, LizPeat, Samana Schwank, Hans Dessens, Ludo LeChat, ClaireSalisbury, Rachel Gregory, Werner Leber and Sarah Sharpfor assistance with parasite work; Eleanor Dodson for help instructure refinement; the ESRF for X-ray data collection facili-ties; David Jacobus (Jacobus Pharmaceutical Company,Princeton, NJ) for providing WR99210 and MR4 for providinganti-alpha tubulin II antibody.

References

Beitz, E. (2007) Jammed traffic impedes parasite growth.Proc Natl Acad Sci USA 104: 13855–13856.

Billker, O., Lindo, V., Panico, M., Etienne, A.E., Paxton, T.,Dell, A., et al. (1998) Identification of xanthurenic acid asthe putative inducer of malaria development in themosquito. Nature 392: 289–292.

Bork, P., Sander, C., and Valencia, A. (1992) An ATPasedomain common to prokaryotic cell cycle proteins, sugarkinases, actin, and hsp70 heat shock proteins. Proc NatlAcad Sci USA 89: 7290–7294.

Bystrom, C.E., Pettigrew, D.W., Branchaud, B.P., O’Brien, P.,and Remington, S.J. (1999) Crystal structures of Escheri-chia coli glycerol kinase variant S58→W in complex withnonhydrolysable ATP analogues reveal a putative activeconformation of the enzyme as a result of domain motion.Biochem 38: 3508–3518.

CCP4 (1994) The CCP4 suite – programs for proteincrystallography. Acta Crystallogr D50: 760–763.

Daily, J.P., Scanfeld, D., Pochet, N., Le Roch, K., Plouffe, D.,Kamal, M., et al. (2007) Distinct physiological statesof Plasmodium falciparum in malaria-infected patients.Nature 450: 1091–1095.

Darbon, E., Ito, K., Huang, H.-S., Yoshimoto, T., Poncet, S.,and Deutscher, J. (1999) Glycerol transport andphosphoenolpyruvate-dependent enzyme I- and HPr-catalysed phosphorylation of glycerol kinase in Thermusflavus. Microbiology 145: 3205–3212.

Deitsch, K.W., Driskill, C.L., and Wellems, T.E. (2001) Trans-formation of malaria parasites by the spontaneous uptakeand expression of DNA from human erythrocytes. NucleicAcids Res 29: 850–853.

Duraisingh, M.T., Triglia, T., and Cowman, A.F. (2002) Nega-tive selection of Plasmodium falciparum reveals targetedgene deletion by double crossover recombination. Intl JParasitol 32: 81–89.

Emsley, P., and Cowtan, K. (2004) Coot: model-buildingtools for molecular graphics. Acta Crystallogr D60: 2126–2132.

Feese, M.D., Faber, H.R., Bystrom, C.E., Pettigrew, D.W.,and Remington, S.J. (1998) Glycerol kinase from Escheri-chia coli and an Ala65 → Thr mutant: the crystal structuresreveal conformational changes with implications for allos-teric regulation. Struct 6: 1407–1418.

Fivelman, Q.L., McRobert, L., Sharp, S., Taylor, C.J., Saeed,M., Swales, C.A., et al. (2007) Improved synchronous pro-duction of Plasmodium falciparum gametocytes in vitro.Mol Biochem Parasitol 154: 119–123.

Gouet, P., Courcelle, E., Stuart, D.I., and Metoz, F. (1999)ESPript: analysis of multiple sequence alignments inPostScript. Bioinform 15: 305–308.

Greenwood, B.M., Bojang, K., Whitty, C.J.M., and Target,G.A.T. (2005) Malaria. Lancet 365: 1487–1498.

Guan, H.P., Li, Y., Jensen, M.V., Newgard, C.B., Steppan,C.M., and Lazar, M.A. (2002) A futile metabolic cycle acti-vated in adipocytes by antidiabetic agents. Nat Med 8:1122–1128.

Hansen, M., Kun, J.F.J., Schultz, J.E., and Beitz, E. (2002)A single, bi-functional aquaglyceroporin in blood-stagePlasmodium falciparum malaria parasites. J Biol Chem277: 4874–4882.

Herzberg, O., and Moult, J. (1991) Analysis of the steric strainin the polypeptide backbone of protein molecules. ProtStruct Funct Genet 11: 223–229.



http://www.pdb.org

Holz, G.G. (1977) Lipids and malarial parasite. Bull WorldHealth Organ 55: 237–248.

Hurley, J.H. (1996) The sugar kinase/heat-shock protein70/actin superfamily: implications of conserved structure formechanism. Annu Rev Biophys Biomol Struct 25: 137–196.

Hurley, J.H., Faber, H.R., Worthylake, D., and Meadow, N.D.(1993) Structure of the regulatory complex of Escherichiacoli IIIGlc with glycerol kinase. Science 259: 673–677.

Liu, Y., Promeneur, D., Rojek, A., Kumar, N., Frokiaer, J.,Nielsen, S., et al. (2007) Aquaporin 9 is the major pathwayfor glycerol uptake by mouse erythrocytes, with implica-tions for malarial virulence. Proc Natl Acad Sci USA 104:12560–12564.

McCabe, E. (2001) Disorders of glycerol metabolism. InMetabolic and Molecular Bases of Inherited Diseases.Scriver, C.R., Beaudet, A.L., Sly, W.S., and Valle, D. (eds).New York: McGraw-Hill, pp. 2217–2237.

Mair, G.R., Braks, J.A.M., Garver, L.S., Wiegant, J.C.A.G.,Hall, N., Dirks, R.W., et al. (2006) Regulation of sexualdevelopment of Plasmodium by translational repression.Science 313: 667–669.

Murshudov, G.N., Vagin, A.A., and Dodson, E.J. (1997)Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr D53: 240–255.

Ormo, M., Bystrom, C.E., and Remington, S.J. (1998) Crystalstructure of a complex of Escherichia coli glycerol kinaseand an allosteric effector fructose 1,6-bisphosphate.Biochem 37: 16565–16572.

Perrakis, A., Morris, R., and Lamzin, V.S. (1999) Automatedprotein model building combined with iterative structurerefinement. Nat Struct Biol 6: 458–463.

Promeneur, D., Liu, Y.J., Maciel, J., Agre, P., King, L.S.,and Kumar, N. (2007) Aquaglyceroporin PbAQP duringintraerythrocytic development of the malaria parasite Plas-modium berghei. Proc Natl Acad Sci USA 104: 2211–2216.

Roudier, N., Verbavatz, J.M., Maurel, C., Ripoche, P., andTacnet, F. (1998) Evidence for the presence of Aquaporin-3in Human red blood cells. J Biol Chem 273: 8407–8412.

Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecu-lar Cloning: A Laboratory Manual. Cold Spring Harbor, NewYork: Cold Spring Harbor Laboratory Press.

Santiago, T.C., Zufferey, R., Mehra, R.S., Coleman, R.A.,

and Mamoun, C.B. (2004) The Plasmodium falciparumPfGatp is an endoplasmic reticulum membrane proteinimportant for the initial step of malarial glycerolipidsynthesis. J Biol Chem 279: 9222–9232.

Sharp, S., Lavstsen, T., Fivelman, Q.L., Saeed, M.,McRobert, L., Templeton, T.J., et al. (2006) Programmedtranscription of the var gene family, but not of stevor. Plas-modium falciparum gametocytes. Euk Cell 5: 1206–1214.

Studier, F.W. (2005) Protein production by auto-induction inhigh density shaking cultures. Protein Expr Purif 41: 207–234.

Trager, W., and Jensen, J.B. (1976) Human malaria parasitesin continuous culture. Science 193: 673–675.

Vagin, A., and Teplyakov, A. (2000) An approach to multi-copy search in molecular replacement. Acta CrystallogrD56: 1622–1624.

Vial, H., and Ancelin, M. (1992) Malarial lipids. An overview.Subcell Biochem 18: 259–306.

Witteveen, C.F.B., Vandevondervoort, P., Dijkema, C., Swart,K., and Visser, J. (1990) Characterization of a glycerolkinase mutant of Aspergillus niger. J Gen Microbiol 136:1299–1305.

Yeh, J.I., Charrier, V., Paulo, J., Hou, L.H., Darbon, E., Clai-borne, A., et al. (2004) Structures of enterococcal glycerolkinase in the absence and presence of glycerol: correlationof conformation to substrate binding and a mechanism ofactivation by phosphorylation. Biochem 43: 362–373.

Young, J.A., Fivelman, Q.L., Blair, P.L., de la Vega, P., LeRoch, K.G., Zhou, Y.Y., et al. (2005) The Plasmodium fal-ciparum sexual development transcriptome: a microarrayanalysis using ontology-based pattern identification. MolBiochem Parasitol 143: 67–79.

Supporting information

Additional supporting information may be found in the onlineversion of this article.

Please note: Wiley-Blackwell are not responsible for thecontent or functionality of any supporting materials suppliedby the authors. Any queries (other than missing material)should be directed to the corresponding author for the article.



Structure and non-essential function of glycerol kinase in...

Documents

Transcript of Structure and non-essential function of glycerol kinase in...