STRUCTURAL STUDIES OF

THE KLEBSIELLA PNEUMONIAE PANTOTHENATE KINASE

IN COMPLEX WITH

PANTOTHENAMIDE SUBSTRATE ANALOGUES

by

Buren Li

A thesis submitted in conformity with the requirements

for the degree of Master of Science.

Graduate Department of Pharmacology and Toxicology

University of Toronto.

© Copyright by Buren Li (2012)

ii

Structural studies of the Klebsiella pneumoniae pantothenate kinase in complex with

pantothenamide substrate analogues

Buren Li

Master of Science

2012

Department of Pharmacology and Toxicology

University of Toronto

ABSTRACT

N-substituted pantothenamides are analogues of pantothenate, the precursor of the

essential metabolic cofactor coenzyme A (CoA). These compounds are substrates of

pantothenate kinase (PanK) in the first step of CoA biosynthesis, possessing

antimicrobial activity against multiple pathogenic bacteria. This enzyme is an attractive

target for drug discovery due to low sequence homology between bacterial and human

PanKs. In this study, the crystal structure of the PanK from the multidrug-resistant

bacterium Klebsiella pneumoniae (KpPanK) was first solved in complex with N-

pentylpantothenamide (N5-Pan). The structure reveals that the N5-Pan pentyl tail is

located within a highly aromatic pocket, suggesting that an aromatic substituent may

enhance binding affinity to the enzyme. This finding led to the design of N-pyridin-3-

ylmethylpantothenamide (Np-Pan) and its co-crystal structure with KpPanK was solved.

The structure reveals that the pyridine ring adopts alternative conformations in the

aromatic pocket, providing the structural basis for further improvement of

pantothenamide-binding to KpPanK.

iii

ACKNOWLEDGEMENTS

First and foremost, I would like to extend my gratitude to my parents and sisters

for their unwavering love and support.

My time in the graduate program has been made easier and enjoyable because of

generous laboratory colleagues who are always willing to share their expertise and

knowledge. I would like to especially thank Dr. BumSoo Hong for all those hours we

spent troubleshooting my errors and of course, talking about life. I am also grateful to

Johnny Guan, who was my mentor when I first arrived at the Park lab and has

encyclopedic knowledge of all laboratory practices and techniques. It was also a pleasure

to have worked alongside fellow students Hanyoul Lee, Cathy Kim, Kathy Mottaghi,

Scott Hughes and Negar Nosrati. I would like to thank former members of the Park

group, Drs. Yufeng Tong, Nan Zhong, as well as Lucy Nedyalkova, Slav Dimov and

Limin Shen, who have never hesitated to lend a hand in my times of need.

All work presented in this thesis was performed at the Structural Genomics

Consortium (SGC), a truly ideal environment for structural biology research. I am

indebted to Dr. Wolfram Tempel for helping me with crystal screening and Synchrotron

data collection, and to Drs. Guillermo Senisterra and Abdellah Al-Hassani for valuable

technical assistance in running kinetic assays. I would also like to extend my thanks to

Drs. David Smil and Yuri Bolshan, the chemists at the SGC who generously provided the

compounds used in these studies.

I have also benefitted from the kindness and expertise of my co-supervisor Dr.

Peter McPherson and advisor Dr. David Riddick, both of whom agreed to serve in their

iv

respective capacities without hesitation. They have my thanks for going above and

beyond what I expected whenever I consult with them.

I would also like to thank my defense committee members: Dr. Martin Zack

(chair), Dr. Jeffrey Lee (external appraiser), Dr. Hong-Shuo Sun (internal appraiser) and

Dr. David Riddick (additional voting member). Their careful review of this thesis is

greatly appreciated.

Last but definitely not least, I would like to extend my sincerest thanks to my

supervisor Dr. Hee-Won Park. I feel extremely fortunate to have met such a bighearted,

inspiring and selfless mentor. The rewarding journey wasn’t always smooth, and results

didn’t always come readily. But I would always be reassured by Dr. Park that with hard

work and strong convictions, things will work out.

v

TABLE OF CONTENTS

Abstract ii

Acknowledgements iii-iv

Table of Contents v-vi

Lists of Tables and Appendix vii

List of Figures viii-ix

Abbreviations x-xi

1. INTRODUCTION

1.1 Urgency for antimicrobial drug discovery 1-3

1.2 Pantothenate Essentiality and Uptake Mechanisms 3-5

1.3 Overview of Coenzyme A 5-11

1.4 Synthesis of Coenzyme A 11

1.4.1 De novo Pantothenate Synthesis 12

1.4.2 Coenzyme A Synthesis from Pantothenate 14

1.4.2.1 Conversion of Pantothenate to 4’-phosphopantothenate 16

1.4.2.2 Conversion of 4’-phosphopantothenate to 4’-

phosphopantetheine

16-17

1.4.2.3 Conversion of 4’-phosphopantetheine to coenzyme A 17

1.5 Pantothenate Kinase as point of drug discovery 17-18

1.5.1 Pantoyltaurine 20

1.5.2 N’-pantoyl-substituted amide 20-21

1.5.3 N-substituted pantothenamide 21-22

1.6 Overview of Pantothenate Kinases 24

1.6.1 Type I Pantothenate Kinases 24-27

1.6.2 Type II Pantothenate Kinases 27-31

1.6.3 Type III Pantothenate Kinases 31-32

1.7 Hypothesis and Rationale for Study 38

1.7.1 Aims and Approaches 38-39

1.7.2 Rationale for Experimental Approach

1.7.2.1 Structure Determination of Macromolecules 39

1.7.2.2 X-ray Crystallography 39-40

1.7.2.3 Protein Crystallization 40

1.7.2.4 Data Collection 42

1.7.2.5 Structure Determination 42-43

2. MATERIALS AND METHODS

2.1 Materials 43-44

2.2 Methods

2.2.1 Preparation of Expression Plasmid 46

2.2.2 Protein Expression and Purification 49-50

2.2.3 Protein Crystallization and Data Collection 52-53

2.2.4 Structure Determination, Refinement and Validation 57-59

vi

2.2.5 Spectrophotometric Assessment of Substrate Kinetics 63

3. RESULTS

3.1 Structural Overview of KpPanK 65

3.1.1 Nucleotide-binding site 65-66

3.1.2 N5-Pan binding site of KpPanK 69

3.1.3 Np-Pan binding site of KpPanK 71-72

3.2 KpPanK substrate kinetics 74

4. DISCUSSION

4.1 Comparison with EcPanK 77-78

4.2 Comparison with MtPanK 80-81

4.3 Modeling of a Branched Compound 84-85

4.4 KpPanK Substrate Kinetics 88

4.5 Summary of Findings 88-89

4.6 Recommendations for Future Studies 89-92

References 93-100

vii

LIST OF TABLES

Table I Sequences of primers used to generate each KpPanK construct. 48

Table II Summary of substrates used for KpPanK co-crystallization and the

best resolution achieved.

56

Table III Data collection and refinement statistics for KpPanK crystals. 61

Table IV Characterization of KpPanK substrate kinetics. 76

Table V Summary of polar interactions involving the pantothenate moiety of

substrates in KpPanK, EcPanK and MtPanK structures.

82

viii

LIST OF FIGURES

Figure 1 Chemical structure of coenzyme A. 7

Figure 2 Overview of fatty acid synthesis. 9

Figure 3 De novo pantothenate biosynthesis pathway in bacteria. 13

Figure 4 CoA biosynthesis from pantothenate in bacteria. 15

Figure 5 Chemical structures of pantothenate and related derivatives. 19

Figure 6 Proposed mechanisms of pantothenamide toxicity. 23

Figure 7 Phylogenetic distributions of prokaryotic and eukaryotic

pantothenate kinases from notable organisms.

33

Figure 8 Sequence-based alignments of prokaryotic and eukaryotic PanKs

from types I (A), II (B), and III (C).

34-36

Figure 9 Comparison of the structures and dimer folds of types I, II and III

bacterial PanKs.

37

Figure 10 Phase diagram of crystallization. 41

Figure 11 Overview of the pET28-MHL expression vector. 45

Figure 12 Small scale test of expression of KpPanK constructs. 47

Figure 13 Purification of KpPanK. 51

Figure 14 Crystals of KpPanK co-crystallized with N5-Pan. 54

Figure 15 Crystals of KpPanK co-crystallized with Np-Pan. 55

Figure 16 Diffraction patterns of KpPanK crystals. 60

Figure 17 Matthews Probability calculation of the oligomeric state of the

KpPanK asymmetric unit.

62

Figure 18 Pyruvate kinase (PK)/lactate dehydrogenase (LDH) coupled assay

for characterization of kinase activity.

64

Figure 19 Structure of a KpPanK subunit. 67

ix

Figure 20 Interaction of KpPanK nucleotide-binding residues with ADP. 68

Figure 21 Residues of the KpPanK substrate-binding site. 70

Figure 22 Interactions of the pyridine of Np-Pan with substrate pocket

residues.

73

Figure 23 Michaelis-Menten plot of reaction velocity vs. substrate

concentration.

75

Figure 24 Structural differences between KpPanK and EcPanK substrate

binding sites.

79

Figure 25 Comparison of the substrate-binding sites of KpPanK and MtPanK. 83

Figure 26 Modeling of a branched version of Np-Pan in the KpPanK substrate-

binding site.

86

Figure 27 Modeling of a branched derivative of Np-Pan in human PanK3. 87

x

ABBREVIATIONS

ACP = acyl carrier protein

ACS = acetyl-CoA synthetase

AnPanK = Aspergillus nidulans pantothenate kinase

ASKHA = acetate and sugar kinase/heat shock protein 70/actin

Baf = Bvg accessory factor

DPC = dephospho-coenzyme A

DPCK = dephospho-coenzyme A kinase

EcPanK = Escherichia coli pantothenate kinase

Ed-CoA = ethyldethia-CoA

ESBL = extended spectrum β-lactamase

FAS = fatty acid synthase

hPanK3 = human pantothenate kinase isoform 3

IPTG = isopropyl β-D-1-thiogalactopyranoside

MIC = minimum inhibitory concentration

mPanK = Mus musculus pantothenate kinase

MR = molecular replacement

MtPanK = Mycobacterium tuberculosis pantothenate kinase

N5-Pan = N-pentylpantothenamide

N7-Pan = N-heptylpantothenamide

N9-Pan = N-nonylpantothenamide

Np-Pan = N-pyridin-3’-ylmethylpantothenamide

xi

PanF = pantothenate permease

PanK = pantothenate kinase (coaA)

P-Pan = 4’-phosphopantothenate

PP = 4’-phosphopantetheine

PPAT = phosphopantetheine adenyltransferase (coaD)

PPC = phosphopantothenoylcysteine

PPCDC = phosphopantothenoylcysteine decarboxylase (coaC)

PPCS = phosphopantothenoylcysteine synthetase (coaB)

RMSD = root mean square deviation

SVMT = sodium-dependent multi-vitamin transporter

1

1. INTRODUCTION

1.1 Urgency for antimicrobial drug discovery

Drug-resistant pathogens represent a major challenge to healthcare and drug

development. Conventional classes of antibiotics that were once capable of controlling

infections are becoming more and more ineffective (Rice 2012). The rate of drug

development has not been able to keep up with the increasing number of therapeutic

options lost because of drug resistance (Bassetti, Ginocchio et al. 2011). Most

antimicrobial agents share conventional cellular targets that include interfering with cell

wall formation, membrane function, and DNA and protein synthesis (Neu 1989; Rice

2012). Under selective pressures introduced through excessive use of antibiotics,

microorganisms have developed resistance to drugs by: increased efflux, alteration of the

drug targets, and enzymatic inactivation (Neu 1989).

Resistance in gram-negative bacterial pathogens is particularly troubling; their

lipopolysaccharide outer membrane provide intrinsic resistance against several classes of

antibiotics, such as macrolides and cationic peptides (Delcour 2009). As such, there are

limited treatment regimens for infection caused by gram-negative bacteria, which in some

cases are prompt recipients of resistance genes. A prominent example is the acquisition

of extended spectrum β-lactamases (ESBL) in Enterobacteriaceae that hydrolyze a broad

range of penicillins, and render numerous members of the drug class ineffective (Paterson

and Bonomo 2005). The first ESBL discovered was TEM-1 (named after Temoniera, the

source patient) (Bradford 2001). A second related enzyme was discovered and named

TEM-2. A third, unrelated and much less common ESBL is SHV, named so due to the

2

variable effects sulfhydryl compounds had on substrate specificity. The advent of

cephalosporins was considered a major breakthrough in countering β-lactamase-mediated

drug resistance (Paterson and Bonomo 2005). Soon after, overuse of these drugs led to

the emergence of ESBLs capable of hydrolyzing cephalosporins; mutations that promote

substrate promiscuity are found in the genes that encode the three ESBLs (Philippon,

Labia et al. 1989). Recently, there has been a rise in bacteria that produce

carbapenemases, a β-lactamase-like enzyme that provides resistance to carbapenem drugs

(often considered drugs of last resort) (Daikos and Markogiannakis 2011). Widespread

drug resistance can result in treatment failure and increased mortality (Tumbarello, Spanu

et al. 2006). Therefore, the development of new drugs with novel mechanisms of action

and/or cellular targets is crucial to treat increasingly drug-resistant infections and

alleviate a depleted drug pipeline.

Klebsiella pneumoniae is a prominent gram-negative and drug-resistant

bacterium. Pathogenic strains are typically expressors of ESBLs (belonging to the TEM

and SHV classes) and display resistance to a wide spectrum of beta-lactams including

many penicillins and cephalosporins (Paterson, Hujer et al. 2003). Infections caused by

multi-drug resistant strains of K. pneumoniae are mainly treated with carbapenems (e.g.

imipenem and meropenem) (Yigit, Queenan et al. 2001). This therapeutic option is

becoming less viable, with the increasing findings of carbapenem-resistant K.

pneumoniae isolates; these strains display lowered drug permeability due to altered porin

protein (Ardanuy, Linares et al. 1998) and/or expression of the AmpC carbapenemase

(Bradford, Urban et al. 1997). Carbapenem resistance in gram-negative bacteria

3

underscores the urgent need for novel drug discovery, considering the drugs’ status as

“agents of last resort” (Hirsch and Tam 2010).

1.2 Pantothenate Essentiality and Uptake Mechanisms

Williams et al. first discovered pantothenic acid (vitamin B5, its conjugate base is

called pantothenate) as a growth stimulant of Saccharomyces cerevisiae (Williams,

Lyman et al. 1933). Because of the ubiquitous nature of the acidic substance, it was

named after the Greek word pantothen, which means “from everywhere” (Williams,

Lyman et al. 1933). Insights into the chemical structure of pantothenic acid followed the

discovery of β-alanine as another yeast growth factor (Williams and Rohrman 1936). β-

alanine is a cleavage product of pantothenic acid, and yeast excretes excess pantothenic

acid only when β-alanine is supplemented in the growth medium (Weinstock, Mitchell et

al. 1939).

Snell et al. found that extracts from pig liver and yeast share a growth factor

essential for the survival of lactic acid bacteria such as Lactobacillus delbruckii (Snell,

Strong et al. 1937). Purification and chemical characterization of this unknown substance

led to its identification as pantothenic acid (Snell, Strong et al. 1938; Snell, Strong et al.

1939). Pantothenic acid can also stimulate the growth of bacterial pathogens such as

Corynebacterium diphtheriae (Evans, Handley et al. 1939); β-alanine is also a growth

factor at higher concentrations (Mueller and Cohen 1937). In other bacteria such as

Scenedesmus obliquus, the amino acid precursor cannot be substituted for the essential

vitamin (Algeus 1951). The synthetic pathway of pantothenate was first discovered and

4

characterized in Escherichia coli (Merkel and Nichols 1996). Despite disruption of any

one of the enzymes in the pantothenate synthesis pathway, E. coli is viable as long as

pantothenate is present in the medium (Gerdes, Scholle et al. 2002). A racemic mixture

of pantothenic acid possesses 50% activity of the dextrorotatory (D) isomer, while the

levorotatory shows none (Stiller, Harris et al. 1940). Pantothenate was later discovered to

be the precursor of the essential coenzyme A (CoA) metabolic cofactor (described below)

(Hoagland and Novelli 1954).

The uptake of pantothenate occurs by means of a transporter present in virtually

all bacteria (Gerdes, Scholle et al. 2002; Genschel 2004). In E. coli, exogenous

pantothenate is readily taken up by a 12-transmembrane transporter called pantothenate

permease (PanF), encoded by the PanF gene (Jackowski and Alix 1990). The activity of

PanF relies on a sodium ion gradient and has a Kt (transporter constant, analogous to

Michaelis-Menten constant) of 0.4μM for pantothenate. Over 90% of pantothenate is

trapped by phosphorylation within 5 minutes of entry (Jackowski and Alix 1990). While

an increase in PanF expression results in increased intracellular pantothenate, there is no

corresponding relationship in levels of the final product CoA (Vallari and Rock 1985). In

addition, the permease also possesses pantothenate efflux activity (Vallari and Rock

1985). The E. coli PanF shares some similarity in sequence to the E. coli proline

symporter as well as mammalian glucose transporters (Reizer, Reizer et al. 1990). These

transporters share two conserved tyrosine residues that are proposed to be essential for

binding Na+ ions.

5

In chicks and rats, the discovery that a sodium-dependent, secondary active

process was responsible for pantothenate uptake was the first evidence of the vitamin’s

uptake in mammals (Fenstermacher and Rose 1986). In humans, pantothenate is

transported into the cytosol by the sodium-dependent multi-vitamin transporter (SVMT)

(Prasad, Wang et al. 1999). The water-soluble vitamins biotin and lipoate are also

substrates for the SVMT transporter (Prasad, Wang et al. 1998). The transport of the

vitamins is dependent on both a sodium gradient and a specific membrane potential

(Prasad and Ganapathy 2000). The vitamin lipoate is capable of inhibiting the uptake of

the other two vitamins (Prasad, Wang et al. 1998). The Kt values of this transporter for

pantothenate and biotin are 1-3μM, and slightly higher for lipoate at 8-20μM (Prasad,

Wang et al. 1999).

1.3 Overview of Coenzyme A

During the investigation of a detoxification reaction in liver extract, Lipmann

discovered a cofactor that is necessary for the acetylation of aromatic amines; the

substance was thus termed coenzyme A (CoA, A for acetylation) (Lipmann, Kaplan et al.

1947). CoA is also required for acetylating other substances such as choline, histamine,

amino acids and glucosamine (Lipmann 1953). The chemical structure of CoA

comprises 3’-adenosine diphosphate, pantothenate and β-mercaptoethylamine moieties

(Fig. 1); the latter two constitute a pantetheine group (Baddiley, Thain et al. 1953). The

knowledge that CoA is synthesized from pantothenate and is required for acetylation led

to investigations into the effects of pantothenate-deficient conditions in rats; not

6

unexpected, the ability of rats to carry out acetylation was greatly diminished, but rapidly

restored when pantothenate is readministered (Snell and Wright 1950). Lipmann also

found a correlation between CoA and lipid levels, as lipid contents in rat liver and yeast

are lower in CoA-poor conditions (Lipmann 1953).

7

Figure 1. Chemical structure of coenzyme A. CoA is made up of 3’-adenosine

diphosphate, pantothenate and β-mercaptoethylamine moieties, the last two of which

constitute a pantetheine group.

3’-adenosine

diphosphate pantothenate β-mercapto-

ethylamine

pantetheine

8

CoA is a universally conserved acyl group carrier essential in multiple

physiological processes that include Claisen condensation reactions and the citric acid

cycle (also known as Kreb cycle, and tricarboxylic acid cycle). Claisen condensation is

the formation of carbon-carbon bonds between two esters, or one ester and a carbonyl

compound, of which fatty acid synthesis is a notable example (Heath and Rock 2002).

The essentiality of CoA to fatty acid synthesis is two-fold. Firstly, CoA is a

precursor for acyl carrier protein (ACP), an essential component of the fatty acid synthase

(FAS) complex. Holo-ACP synthase converts apo-ACP to holo-ACP (the active form)

by transferring the phosphopantetheine moiety from CoA onto the serine 36 side chain

hydroxyl of apo-ACP (Flugel, Hwangbo et al. 2000). Besides synthesizing ACP, acyl

groups derived from acyl-CoA are required to activate/prime components of the FAS

complex. First, the acetyl group from acetyl-CoA is transferred onto a cysteine residue of

the FAS complex. Similarly, the phosphopantetheine of holo-ACP is charged with

malonyl from malonyl-CoA. Fatty acid synthesis then proceeds through repeated cycles

of condensation, reduction, dehydration and isomerization steps whereby the fatty acid

chain is extended two carbon units at a time by malonyl groups delivered by CoA (Fig. 2)

(Lehninger 2004). In conditions of CoA deficiency, decreased levels of saturated and

unsaturated fatty acids are observed in E. coli (Jackowski and Rock 1986).

9

Figure 2. Overview of fatty acid synthesis. The FAS complex first

receives acetyl (cysteine) and malonyl

(ACP pantetheine) groups that are

delivered by CoA.

1. The condensation step involves

transfer of the acetyl group to the

ACP malonyl group; the CH2 of

malonyl nucleophilically attacks the

carbonyl carbon of the acetyl group.

The reaction is driven by the highly

exergonic acyl bond cleavage of

decarboxylation.

2. In the reduction step, the β carbonyl

is reduced using the electron-

donating cofactor NADPH.

3. Water is removed in an elimination

reaction between the second and

third carbon units.

4. In a second reduction step, the

double bond is reduced to yield a

saturated bond.

5. To prepare for a new cycle, the

newly formed acyl group is

transferred to the FAS cysteine, and

the ACP pantetheine receives a new

malonyl group from malonyl-CoA.

(from Principles of Biochemistry 4e.

Lehninger 2004. Figure 21-2)

10

Acetyl-CoA (synthesized from acetate and CoA), the most common esterified

CoA derivative, is central to cellular metabolism (Lehninger 2004). In the citric acid

cycle oxaloacetate is acetylated using acetyl-CoA to generate citrate. Each cycle

generates the reduced coenzymes NADH and FADH2 that contribute to oxidative

phosphorylation in ATP synthesis, accounting for over 90% of cellular energy

requirements. In addition, the citric acid cycle generates precursors of amino acids and

nucleotides, such as oxaloacetate and α-ketoglutarate (Lehninger 2004). In E. coli, a

consequence of CoA depletion is overall deficiency in protein synthesis; this is likely due

in part to a lack of succinyl-CoA suggesting that amino acid precursors generated by the

citric acid cycle are insufficient to support amino acid synthesis (Jackowski and Rock

1986).

Acetylation plays diverse regulatory roles in prokaryotes. In E. coli, the RimL

acetyltransferase uses acetyl-CoA to acetylate L12 ribosomal stock proteins, which

increases the level of interaction within the stock complex to enhance stability in

conditions of stress (Tanaka, Matsushita et al. 1989; Gordiyenko, Deroo et al. 2008). It is

possible that protein acetylation serves as a signal for degradation, similar to eukaryotic

proteolysis (Hwang, Shemorry et al. 2010). Protein lysine acetylation in bacteria is

essential for multiple biochemical pathways that include transcription, translation, protein

folding, and amino acid and nucleotide biosynthesis (Jones and O'Connor 2011). In E.

coli, proteins that are lysine-acetylated catalyze reactions in glycolysis, the citric acid

cycle as well as carbohydrate metabolism (Yu, Kim et al. 2008). In Salmonella enterica,

acetyl-CoA is a negative feedback regulator of its own synthesis by contributing to the

11

acetylation of an acetyl-CoA synthetase (ACS) lysine residue to block ATP-dependent

adenylation of acetate; the sirtuin CobB activates ACS via deacetylation (Starai, Celic et

al. 2002). Also in S. enterica, reversible acetylation helps to regulate metabolism by

modifying enzymes involved in gluconeogenesis and glycolysis in response to specific

carbon sources (Wang, Zhang et al. 2010). As it turns out, approximately 90% of

enzymes involved in metabolism are acetylated, and the overall level of acetylation in

carbon source-reponsive proteins is significantly higher when cells are grown in glucose

versus citrate (Wang, Zhang et al. 2010). These data suggest that acetyl-CoA, a

metabolic molecule itself, is used to regulate metabolic homeostasis (Wang, Zhang et al.

2010). Bacteria also possess acetyltransferases that catalyze acetyl-CoA-dependent

acetylation and inactivation of aminoglycoside antibiotics, contributing to a significant

global rise in aminoglycoside resistance (Vetting, Magnet et al. 2004).

1.4 Synthesis of Coenzyme A

The synthesis of CoA can be separated into two parts: de novo synthesis of

pantothenate, and the synthesis of CoA from pantothenate (Begley, Kinsland et al. 2001).

The first pathway is limited to fungi, plants and certain bacteria; mammals, including

humans, must depend on diet in obtaining pantothenate (Raman and Rathinasabapathi

2004). The latter pathway is essential and conserved in all living systems (Genschel

2004).

12

1.4.1 De novo Pantothenate Synthesis

Pantothenate synthesis was first characterized in E. coli, and occurs in 4

enzymatic steps (Fig. 3) (Merkel and Nichols 1996). First, α-ketoisovalerate is

hydroxymethylated at the α-carbon position by ketopantoate hydroxymethyltransferase

(KPHMT, encoded by the panB gene) to yield ketopantoate (Merkel and Nichols 1996).

Ketopantoate is then reduced at its carbonyl oxygen to hydroxyl by NADPH-dependent

ketopantoate reductase (KPR, encoded by panE gene) to produce pantoate (Frodyma and

Downs 1998). β-alanine, derived from the decarboxylation of L-aspartate by aspartate

decarboxylase (ADC, encoded by panD gene), is then combined with pantoate in an

ATP-dependent condensation reaction catalyzed by pantothenate synthetase (PS, encoded

by the panC gene) to produce pantothenate (Merkel and Nichols 1996).

13

Figure 3. De novo pantothenate biosynthesis pathway in bacteria. Enzymes are

abbreviated as follows: KPHMT (ketopantoatehydroxymethyl transferase), KPR

(ketopantoate reductase), PS (pantothenate synthetase), ADC (aspirate decarboxylase)

(from Genschel et al., 2004).

14

1.4.2 Coenzyme A Synthesis from Pantothenate

CoA synthesis from the pantothenate occurs in 5 enzymatic steps (Fig. 4). In the

first step, pantothenate kinase (PanK) catalyzes the phosphorylation of pantothenate.

Next, 4’-phosphopantothenate is conjugated with a cysteine residue by 4’-

phosphopantothenoyl cysteine synthetase, followed by decarboxylation by 4’-

phosphopantothenoyl cysteine decarboxylase to produce 4’-phosphopantetheine. The

adenylation of 4’-phosphopantetheine is catalyzed by 4’-phosphopantetheine

adenyltransferase to produce dephospho-CoA, which is phosphorylated by dephospho-

CoA kinase to produce CoA.

15

Figure 4. CoA biosynthesis from pantothenate in bacteria. (from Genschel et al.,

2004).

16

1.4.2.1 Conversion of Pantothenate to 4’-phosphopantothenate

The first step in CoA synthesis is the ATP-dependent phosphorylation of

pantothenate by pantothenate kinase (PanK, also known as coaA, encoded by the coaA

gene) to yield 4’-phosphopantothenate (P-Pan) (Jackowski and Rock 1981). This thesis

will focus on the structure and kinetic properties of the pantothenate kinase from the

bacterium Klebsiella pneumoniae. The kinetic, regulatory and structural properties of the

various classes of PanKs will be discussed in detail in a later section.

1.4.2.2 Conversion of 4’-phosphopantothenate to 4’-phosphopantetheine

In bacteria, such as E. coli, the synthesis of 4’-phosphopantetheine (PP) is

synthesized in two steps from P-Pan. The two enzymatic reactions are catalyzed by the

bifunctional 4’-phosphopantothenoylcysteine (PPC) synthetase/decarboxylase (PPC-

S/DC), encoded by the coaBC gene (Strauss, Kinsland et al. 2001). First, cysteine is

combined with P-Pan in a condensation reaction that uses CTP and releases CMP and

diphosphate as products. In the second step, the same enzyme then catalyzes the

decarboxylation of PPC into 4’-phosphopantetheine (PP) (Strauss and Begley 2001).

PPCDC was first discovered as a product of the dfp gene, whose N-terminal

domain shares sequence similarities with EpiD peptidylcysteine decarboxylase proteins

(Kupke, Uebele et al. 2000). It was renamed to coaBC when the C-terminal domain of

dfp was found to also possess PPCS activity (Strauss, Kinsland et al. 2001; Kupke 2002).

In humans however, the same reactions are catalyzed by two separate enzymes, PPC-S

and PPC-DC (Manoj, Strauss et al. 2003). Another distinction from the bacterial

17

pathway is that the human PPC-S enzyme uses ATP instead of CTP to catalyze cysteine

conjugation (Manoj, Strauss et al. 2003).

1.4.2.3 Conversion of 4’-phosphopantetheine to Coenzyme A

The penultimate step in CoA synthesis is the conversion of PP to 3’-dephospho-

CoA (DPC) by phosphopantetheine adenyltransferase (PPAT, encoded by coaD gene)

(Geerlof, Lewendon et al. 1999). This reversible reaction is ATP-dependent, and releases

pyrophosphate as a product (Geerlof, Lewendon et al. 1999). Dephospho-coenzyme A

kinase (DPCK, also known as CoA synthase, and encoded by coaE gene) catalyzes the

ATP-dependent, final reaction in CoA synthesis by phosphorylating the 3’-hydroxyl

group of the ribose moiety to yield CoA (Mishra, Park et al. 2001). In eukaryotes

however, these two reactions are catalyzed by a two-domain protein that possesses both

catalytic activities (Zhyvoloup, Nemazanyy et al. 2002).

1.5 Pantothenate Kinase as a point of drug discovery

CoA biosynthesis is known to be universally essential, even in pathogenic

bacteria and fungi. Within this pathway, PanK is a practical target for drug discovery,

given that it catalyzes the rate-determining step in CoA biosynthesis (Vallari, Jackowski

et al. 1987). Inhibitor design based on CoA, a negative feedback regulator of its own

synthesis, is impractical, since CoA and its analogues cannot freely cross the bacterial

cell membrane (Mishra and Drueckhammer 2000). There is low sequence and structural

homology between prokaryotic and eukaryotic PanKs (Genschel 2004; Ivey, Zhang et al.

18

2004; Hong, Yun et al. 2006; Hong, Senisterra et al. 2007). Most currently available

antibiotics have an intracellular target and must overcome the obstacles to entry presented

by the bacterial cell wall (Delcour 2009). Pantothenate and its derivatives (Fig. 5), from

a structural perspective, are virtually indistinguishable and are readily taken up by

bacteria via PanF transporters (Vallari and Rock 1985; Strauss and Begley 2002; Zhang,

Frank et al. 2004). The sections below outline pantothenate analogues that possess

antimicrobial activity.

19

Figure 5. Chemical structures of pantothenate and related derivatives. A.

Pantothenate (The atom positions are labeled in the chemical structure). B.

Pantoyltaurine. C. N-pantoyl-substituted amine. D. N-substituted Pantothenamide. The

compounds differ in the carboxylic acid terminal (right side).

A. B.

C. D.

C1 C2

C3 C4

C6

N5 C7

C8

20

1.5.1 Pantoyltaurine

The first pantothenate analogue discovered to show antibacterial activity is

pantoyltaurine, in which the carboxyl group of pantothenate in the C8 position is replaced

with a sulphonate group (Fig. 5B). Snell demonstrated the growth inhibitory effects of

pantoyltaurine on the lactic acid bacterium Lactobacillus arabinosus, and the addition of

pantothenic acid antagonizes the effect observed (Snell 1941). Pantoyltaurine is also

capable of inhibiting the growth of other pathogenic bacteria such as the streptococci S.

hemolyticus and S. pneumoniae (McIlwain 1942). Similarly the addition of pantothenate

to the growth medium provides some resistance to pantoyltaurine. In Corynebacterium

diphtheriae, pantoyltaurine shows differential growth inhibition depending on the

specific strain tested (McIlwain and Hawking 1943). In bacteria capable of de novo

pantothenate synthesis such as Escherichia coli, Proteus morgani and Staphylococcus

aureus, pantoyltaurine has no growth inhibitory effects (McIlwain and Hawking 1943).

Pantoyltaurine can be used to treat mice and rats infected with sulfonamide-resistant

strains of S. hemolyticus (McIlwain and Hawking 1943). A proposed mechanism of

action of pantoyltaurine is that its structural similarity to pantothenate leads to inhibition

of pantothenate-dependent cellular pathways (McIlwain 1942).

1.5.2 N-pantoyl-substituted amides

Pantothenol (Fig. 5C) (the terminal carboxyl of pantothenate is replaced by a

hydroxyl), is capable of inhibiting the growth of lactic acid bacteria that are incapable of

synthesizing pantothenate (Shive and Snell 1945). Like pantoyltaurine, pantothenol does

21

not have any effect on the growth of either E. coli or S. aureus, and its antimicrobial

activity is likely due to its competitive inhibition of pantothenate. Similar to

pantothenate, only the dextrorotatory isomer possesses activity. Pantothenol also has

comparable potency to pantoyltaurine (Shive and Snell 1945). In contrast to bacteria,

pantothenol can promote growth in chicks with nearly equivalent efficacy as pantothenate

(Hegsted 1948).

1.5.3 N’-substituted pantothenamides

Previous pantothenate analogues have been synthesized via substitution of the

terminal carboxylic acid group. The addition of chemical moieties beyond the C8

position of pantothenate was explored in the form of pantothenamides. While showing

cytotoxicity in various bacteria, these compounds are especially effective against E. coli

(Clifton, Bryant et al. 1970) and S. aureus (Virga, Zhang et al. 2006).

In E. coli, N5-Pan is a substrate of PanK, and its phosphorylated product is

processed by most downstream enzymes to produce the CoA analogue ethyldethia-CoA

(Ed-CoA) (Strauss and Begley 2002). Part of the potency of N5-Pan against E. coli is

attributed to its rapid conversion to Ed-CoA, approximately 10.5 times faster than the

conversion of pantothenate to CoA (Strauss and Begley 2002). As efficient alternate

substrates of PanK, pantothenamides are effective competitive inhibitors of pantothenate

showing IC50 values below 60μM (Ivey, Zhang et al. 2004). CoA analogues derived

from pantothenamides lack the crucial terminal sulfhydryl group required for formation

of acyl-CoA thioesters and likely interfere with CoA-utilizing enzymes (Strauss and

22

Begley 2002). Furthermore, in E. coli analogues of holo-ACP can be made from Ed-

CoA, and the accumulation of the inactive modified ACP molecules can lead to the

inhibition of fatty acid synthesis (Zhang, Frank et al. 2004). However, the notion that the

accumulation of inactive ACP underlies pantothenamide antimicrobial activity has been

challenged since ACP phosphodiesterase can readily hydrolyze the inactive ACP back to

apo-ACP (Thomas and Cronan 2010). In addition, exogenously supplementing fatty

acids to S. pneumoniae cannot provide full resistance to N5-Pan (Zhang, Frank et al.

2004). Compared with untreated E. coli cells, the pool of intracellular acetyl-CoA is

significantly reduced upon treatment with N5-Pan, which points to the inhibition of CoA

synthesis as an underlying mechanism of pantothenamide toxicity (Thomas and Cronan

2010). The proposed mechanisms of action of pantothenamides in E. coli are illustrated

in Figure 6.

In S. aureus, the mechanism of action of pantothenamides is unclear.

Pantothenamides were reported to inhibit PanK activity in S. aureus in contrast to being

pseudosubstrates in E. coli (Choudhry, Mandichak et al. 2003). However, exposing

strains of S. aureus to pantothenamides can lead to accumulation of inactivated ACP and

deficient fatty acid levels, suggesting that S. aureus and E. coli are probably inhibited by

the same mode of action (Virga, Zhang et al. 2006).

First-generation pantothenamides are capable of interfering with the growth of

human cells. When tested in human HepG2 cells these compounds showed a significant

level of growth inhibition with IC50 (concentration required to inhibit growth by 50%)

values as low as 64 and 128μg/mL (Choudhry, Mandichak et al. 2003).

23

Figure 6. Proposed mechanisms of pantothenamide toxicity in E. coli.

The chemical structures of pantothenate, CoA and ACP are shown on the left. The

corresponding structures of N5-Pan and its downstream products are shown on the right.

Green and red arrows represent inductive/stimulatory and inhibitory effects, respectively.

The orange arrows indicate the absence of the essential sulfhydryl group essential for the

biological function of carrying acyl groups. (adapted from Thomas and Cronan, 2010).

.

Pan

CoA

ACP

N5-Pan

N5-CoA

N5-ACP Fatty Acid Synthesis

CoA-utilizing pathways

24

1.6 Overview of Pantothenate Kinases

PanK catalyzes the first step of CoA biosynthesis by catalyzing the ATP-

dependent phosphorylation of the precursor pantothenate. PanKs are divided into three

classes based on amino acid sequence, structure, regulatory properties and substrate

kinetics (Fig 7). Type I PanKs are the first PanKs discovered and characterized,

predominantly found in prokaryotes. Type II PanKs are mainly found in eukaryotic

species, but interestingly also in select bacteria. Type III PanKs have an even wider

distribution within the bacterial kingdom compared with type I enzymes. The sections

below outline the properties distinct to each class.

1.6.1 Type I Pantothenate Kinases

The Escherichia coli PanK (EcPanK) is the best characterized type I enzyme.

The enzyme is encoded by the coaA gene, which when translated gives two products of

molecular weight 36.4kDa and 35.4 kDa (a difference of 8 N-terminal residues) (Song

and Jackowski 1992). In E. coli, a concentration 8μM β-alanine in the extracellular

medium results in maximal CoA intracellular concentrations (Jackowski and Rock 1981).

Higher β-alanine concentrations produce an amount of non-phosphorylated pantothenate

more than that required to maintain an optimal CoA level, leading to pantothenate

excretion (Jackowski and Rock 1981). Furthermore, strains harboring multiple copies of

the coaA gene express 76-fold higher levels of EcPanK, but only produce 2.7-fold higher

levels of CoA (Song and Jackowski 1992). These findings suggest that EcPanK plays a

25

key regulatory role in CoA biosynthesis (Jackowski and Rock 1981; Song and Jackowski

1992).

EcPanK exists as a homodimer in solution (Song and Jackowski 1994). The

enzyme contains the Walker A phosphate-binding motif (GXXXXGKS) and belongs to

the P-loop kinase superfamily (Walker, Saraste et al. 1982; Yun, Park et al. 2000).

Kinetic studies have revealed sequential substrate binding in EcPanK; the binding of ATP

is required for binding of pantothenate (Song and Jackowski 1994). The binding of ATP

to one subunit of an EcPanK dimer promotes positive cooperative ATP-binding to the

second subunit (Song and Jackowski 1994). Kinetic characterization reveals that the

Michaelis-Menten constants (Km) for pantothenate and ATP are 36 and 136μM,

respectively.

In line with its presumed regulatory role in CoA biosynthesis, EcPanK is

negatively regulated by feedback inhibition with CoA (Vallari, Jackowski et al. 1987).

Non-acylated CoA inhibits EcPanK activity approximately five times more potently than

esterified derivatives like acetyl-CoA. CoA can also competitively inhibit the binding of

ATP (Vallari, Jackowski et al. 1987). A lysine residue of the P loop is essential for both

CoA and ATP binding; the lysine(101)-methionine mutant cannot not bind either

compound (Song and Jackowski 1994).

The structures of EcPanK in complex with non-hydrolyzable ATP analogue

AMPPNP and CoA are available (PDB: 1ESM and PDB: 1ESN) (Yun, Park et al. 2000).

EcPanK is a dimer in the asymmetric unit. Comparison of the two co-crystal structures

reveal that the α, β phosphates of CoA and the β, γ phosphates of AMPPNP occupy the

26

same space in the active site, and provides structural basis for CoA inhibition of EcPanK.

Specifically, the biphosphates compete for binding to lysine 101 (Yun, Park et al. 2000).

Interestingly the adenine moiety of CoA does not occupy the same space as that of

AMPPNP, but instead flips to occupy another protein cleft (Yun, Park et al. 2000). The

CoA-bound structure also reveals the basis for more potent inhibition by CoA compared

with its thioesters; the terminal thiol group of CoA is located within a confined pocket in

which acyl groups of the CoA thioesters cannot optimally fit (Yun, Park et al. 2000).

Comparison of the two co-crystal structures also reveals three key residues involved in

CoA binding, but not ATP binding. This finding is confirmed by mutations of Arg106,

His177 and Phe247 to alanine, which reveal decreased potency of CoA inhibition while

retaining catalytic activity (Rock, Park et al. 2003). E. coli strains expressing these

mutants show significantly higher intracellular levels of phosphorylated pantothenate

derivatives and CoA, providing further evidence of EcPanK’s key regulatory role in CoA

synthesis (Rock, Park et al. 2003).

The ternary complex structure of EcPanK bound with ADP and pantothenate is

also available (Fig. 9A) (PDB: 1SQ5) (Ivey, Zhang et al. 2004). When superimposed

onto the EcPanK-AMPPNP complex, the overall protein fold of the ternary complex is

conserved with the exception of significant movement of a loop region containing

residues 243-263; this stretch of residues is thought to act as a lid that closes over the

active site upon substrate-binding. Superimposition with the EcPanK-CoA complex

reveals that pantothenate of the ternary complex and the pantetheine moiety of CoA have

the same mode of binding. The ternary complex was also used to simulate binding of

27

N5-Pan and N7-Pan, placing the alkyl chains within a hydrophobic pocket containing

multiple aromatic residues. The two pantothenamides are substrates of EcPanK with Km

values of 140 and 128μM, respectively (Ivey, Zhang et al. 2004).

The PanK from Mycobacterium tuberculosis (MtPanK) is another type I enzyme

and shares approximately 52% sequence identity with EcPanK. Unlike EcPanK which

has a clear preference for ATP, MtPanK can use either ATP or GTP as phosphate donors

with equivalent efficiency. The structures of MtPanK in complex with multiple substrate

and product combinations lend a unique opportunity for structural comparisons with

EcPanK (Chetnani, Das et al. 2009; Chetnani, Kumar et al. 2010; Chetnani, Kumar et al.

2011). The structural properties of the active site of MtPanK are distinct from those of

EcPanK. While the EcPanK active site conformation has flexibility to accommodate

substrates and products, the MtPanK active site conformation is rigid and requires

significant substrate movements for product formation. Similar to EcPanK, MtPanK can

phosphorylate pantothenamides such as N-nonylpantothenamide (N9-Pan) (Chetnani,

Kumar et al. 2011).

1.6.2 Type II Pantothenate Kinases

Type II PanKs are found primarily in eukaryotic species. The first type II enzyme

characterized is the PanK from Aspergillus nidulans (AnPanK) that also has sequence

resemblance to the PanK of S. cerevisiae (Calder, Williams et al. 1999). However,

AnPanK has very low sequence homology with the well-characterized EcPanK.

Furthermore, whereas CoA is the strongest inhibitor of EcPanK, AnPanK is more

28

strongly inhibited by acetyl-CoA (Calder, Williams et al. 1999). Differences in amino

acid sequence and regulatory properties between AnPanK and EcPanK have justified a

separate classification for AnPanK.

The first mammalian PanK discovered and characterized is the PanK from M.

musculus (mPanK) that has high sequence homology to AnPanK, but also bares little

resemblance to EcPanK (Rock, Calder et al. 2000). The mPanK1 gene encodes for two

alternatively spliced gene products; mPanK1α is expressed in the heart and kidney, and

mPanK1β is found in the liver and kidney. Like AnPanK, acetyl-CoA inhibits both

isoforms of mPanK more strongly than CoA with an IC50 of approximately 20μM (Rock,

Calder et al. 2000). However, CoA shows stimulatory activity that appears to be unique

to mPanK1β (Rock, Calder et al. 2000). Malonyl-CoA strongly inhibits the α-isoform,

but moderately so for the β-isoform (Rock, Karim et al. 2002). It is possible that

differential expression of mPanK1α and mPanK1β serves to regulate free CoA:esterified

CoA levels (Rock, Karim et al. 2002).

There are four subtypes of human PanKs (PANK1, PANK2, PANK3 and

PANK4) that were discovered when PANK2 was mapped out in connection with

pantothenate kinase-associated neurodegeneration (PKAN) (Zhou, Westaway et al.

2001). All four human PANK isoforms share a conserved catalytic core, and are

products of the differentially spliced PANK gene (Hong, Senisterra et al. 2007). PANK1

(containing isoforms α and β) is expressed in multiple organs including the heart, kidney

and liver. PANK2 is exclusively found in the brain (specifically, basal ganglia). PANK3

is expressed primarily in the liver (Zhou, Westaway et al. 2001). PANK4 is found

29

mainly in muscle and has sequence similarity with S. cerevisiae and C. elegans (Zhou,

Westaway et al. 2001). As it lacks the essential glutamate residue required for kinase

activity, PANK4 is the only inactive isoform and its function is unknown (Hong,

Senisterra et al. 2007). The involvement of PANK2 mutations in neurodegeneration is

unclear though they are correlated with abnormal iron accumulation in the brain (Leoni,

Strittmatter et al. 2012).

Although type II enzymes are widely known to constitute the group to which

eukaryotic PanKs belong, some bacterial PanKs are classified into this class. Most

notable are the PanKs from staphylococci (S. aureus, S. epidermidis and S. haemolyticus)

as well as bacilli (B. cereus and B. subtilis) (Choudhry, Mandichak et al. 2003).

Phylogenetic analysis shows that SaPanK is a distant relative of the PanK from

Drosophila melanogaster (Choudhry, Mandichak et al. 2003). Unlike all previously

discovered type I and II PanKs, CoA and its thioesters do not inhibit SaPanK (Leonardi,

Chohnan et al. 2005). The lack of feedback regulation would lead to elevated levels of

CoA; S. aureus lacks glutathione and likely relies on CoA, a component of the CoA/CoA

disulfide reductase redox (CoADR) system, to relieve oxidative stress (Leonardi,

Chohnan et al. 2005).

The structure of SaPanK in complex with the ATP analogue AMPPNP is

available (Fig. 9B) (PDB: 2EWS) (Hong, Yun et al. 2006). Each subunit of the SaPanK

dimer is made up of actin-like domains that place the enzyme within the acetate/sugar

kinase/heat shock protein 70/actin (ASKHA) superfamily (Hurley 1996; Hong, Yun et al.

30

2006). A Mg2+

ion coordinates the AMPPNP β and γ phosphates, which also interact

with the P loop and “pseudo-P loop” motifs of the actin domains.

The crystal structures of the human PANK1α and PANK3 in complex with

acetyl-CoA have been solved (PDB: 2I7N and 2I7P) (Hong, Senisterra et al. 2007).

Human PANK1α and PANK3 show a high affinity for acetyl-CoA, as extensive dialysis

and incubation with the ATP analogue AMPPNP can not dislodge the feedback regulator

from the active site (Hong, Senisterra et al. 2007). Like SaPanK, human PanK also

contains actin-like domains that resemble motifs of ASKHA family members. The

binding site of the pantetheine group of acetyl-CoA is located at the dimer interface; this

is in contrast to type I PanKs that do not share subunits for inhibitor/substrate binding

(Hong et al., 2007). The human structures provide the structural basis for stronger

inhibition of CoA thioesters versus CoA; the carbonyl group from the acetyl group forms

a hydrogen bond with a valine main chain amide nitrogen. Mutagenesis studies involving

thermostability assays, in conjunction with structural analysis of the two solved human

PanK isoforms, led to classification of PANK2 mutations (in connection with PKAN)

into three categories; mutations are either located at the dimer interface (affecting ability

to dimerize), the active site (affecting catalytic activity and/or capacity to bind

substrates), or the protein surface (to negatively affect thermostability) (Hong, Senisterra

et al. 2007).

No kinetic studies have been published regarding human PANKs using

pantothenamides as substrates. However, one study found that the pantothenamides N7-

Pan and N9-Pan showed potent IC50 values of 64 and 128μ/mL respectively when tested

31

in human HepG2 liver cells (Choudhry, Mandichak et al. 2003). In addition, the structure

of human PANK3 in complex with N7-Pan (PDB: 3SMS) shows that the compound

occupies the pantothenate-binding site of the human enzyme.

1.6.3 Type III Pantothenate Kinases

Type III PanKs (also called coaX) are a recently discovered class with low

sequence homology to types I and II PanKs, and also show considerably different

structural and kinetic properties. Compared to type I PanKs, this third type has an even

wider distribution in the bacterial kingdom (Yang, Eyobo et al. 2006). Despite sharing

minimal similarity in sequence to types I and II PanKs, the remaining four enzymes of

the five-step CoA synthesis pathway are conserved (Brand and Strauss 2005). Km values

of type III PanKs for pantothenate are comparable to those of types I and II PanKs,

though Km values for ATP are unusually high in the millimolar range (Brand and Strauss

2005; Hong, Yun et al. 2006; Yang, Eyobo et al. 2006). Some bacteria such as

Mycobacteria express types I and III PanKs, though the latter is non-essential (Awasthy,

Ambady et al. 2010). In addition, unlike prokaryotic type I and eukaryotic type II

enzymes, type III PanKs are not feedback-regulated by CoA or its thioesters. Similar to

S. aureus, the lack of feedback regulation in bacilli (such as B. anthracis and B. subtilis)

can be justified also by a lack of glutathione and dependence on the CoADR redox

system for detoxification of oxidative stress (Nicely, Parsonage et al. 2007). Another

distinct feature of type III PanKs is the requirement of a monovalent cation, such as

NH4+, or K

+, for activity (Hong, Yun et al. 2006).

32

The structures of the type III PanKs from Pseudomonas aeruginosa (PaPanK)

(Fig. 9C) (PDB: 2F9T) (Hong, Yun et al. 2006) and Thermotoga maritima (TmPanK)

(PDB: 3BEX) (Yang, Eyobo et al. 2006) are available. These enzymes contain actin-like

folds, like SaPanK, placing them in the ASKHA superfamily. However, they cannot use

pantothenamides as substrates. The PaPanK-pantothenate binary complex provides the

structural basis for resistance of type III-expressing bacteria to pantothenamides; the

portion of the substrate-binding site that interacts with the pantothenate carboxyl end

does not have additional space to fit any N-substitutions on pantothenamides (Hong, Yun

et al. 2006). The TmPanK-ADP-Pan ternary complex structure (PDB: 3BF1) (Yang,

Strauss et al. 2008) reveals the substrate-binding site to be at the dimerization interface;

like type II PanKs, the substrate is stabilized by binding to both subunits of the dimer.

Interestingly, some type III PanKs (such as those from P. aeruginosa and H.

pylori) have high sequence homology to the Bordetella pertussis Bvg accessory factor

(Baf) (Brand and Strauss 2005). Baf is a transcriptional regulatory protein that interacts

with the transcription factor Bvg to enhance the expression of the ADP-ribosylating

pertussis toxin (DeShazer, Wood et al. 1995; Wood and Friedman 2000; Williams,

Boucher et al. 2005).

33

Figure 7. Phylogenetic distributions of prokaryotic and eukaryotic pantothenate

kinases from notable organisms. The phylogenetic tree shows the distribution of the

three types of PanKs. The human and murine PanKs are both of isoform 3, the subtype

containing only the conserved catalytic core. The tree was generated using the software

on www.phylogeny.fr, following alignment of sequences by ClustalW.

Type 1

Type 2

Type 3

http://www.phylogeny.fr/

34

A.

35

B.

36

Figure 8. Sequence-based alignments of prokaryotic and eukaryotic PanKs from

types I (A), II (B), and III (C). Conserved (red) and similar (yellow) residues are

indicated.

C.

37

Figure 9. Comparison of the structures and dimer folds of types I, II and III

bacterial PanKs. A. EcPanK (PDB: 1SQ5). B. SaPanK (PDB: 2EWS). C. PaPanK

(PDB: 2F9T). Each colour denotes a single subunit.

A.

C.

B.

38

1.7 Hypothesis and Rationale for Study

Our working hypothesis is that structural characterization of the KpPanK

substrate-binding site will provide basis for design of specific KpPanK pantothenate

analogues to treat klebsiella infections.

KpPanK has high sequence homology with EcPanK (90.3% identity), which

contains an aromatic pocket towards the carboxyl end of the pantothenate substrate; it is

likely that KpPanK has a similar pocket that was proposed to accommodate

pantothenamide N-substitutions for EcPanK (Ivey, Zhang et al. 2004). This pocket

represents an empty space that can be occupied with N-substitutions for enhanced

binding affinity; we propose that chemical groups can be introduced to optimize

interactions with pocket residues. High sequence homology with EcPanK also suggests

that pantothenamides can also be phosphorylated as substrates by KpPanK. Next, a K.

pneumoniae contains a PanF similar to that found in E. coli. Moreover, the four

downstream enzymes involved in CoA biosynthesis are present in K. pneumoniae,

suggesting that these substrate analogues, as in E. coli, can lead to accumulation of CoA

derivatives, covalent inactivation of ACP and subsequent inhibition of fatty acid

synthesis.

1.7.1 Aims and Approaches

The primary objective of these studies is to solve the three-dimensional structure

of KpPanK by X-ray crystallography, an important technique that can allow us to

elucidate the architecture of its substrate-binding site at atomic resolution. Structural

39

characteristics of the pantothenate-binding site can then be exploited for the design of

pantothenate derivatives that bind to KpPanK with high affinity.

1.7.2 Rationale for Experimiental Approach

1.7.2.1 Structure Determination of Macromolecules

Nuclear magnetic resonance (NMR) spectroscopy and X-ray crystallography

represent the two principal methods for structure determination of biological

macromolecules at the atomic level. Each method has its strengths and weaknesses.

NMR spectroscopy enables elucidation of atomic details of a protein in its solution state,

but is limited by the extensive amount of time required for solving one structure

(Gronwald and Kalbitzer 2010) as well as the size of the protein of interest; the technique

is ideally suited for proteins under 40 kDa in size (Doerr 2006). X-ray crystallography is

the method of choice for solving structures. This technique represents an efficient

method of macromolecular structure determination at atomic resolution without the

limitations of protein size and time restraints imposed by NMR (Feng, Pan et al. 2010).

To date, nearly 90% of over 80,000 structures deposited to the Protein Data Bank (PDB)

were solved by crystallography.

1.7.2.2 X-ray Crystallography

X-ray crystallography takes advantage of a protein crystal’s ability to scatter X-

ray beams (Bragg 1915). X-rays are diffracted by the electron cloud surrounding each

atom. Subsequently, diffraction patterns recorded by a detector can be used to recreate

40

the electron density into which a model of the target protein can be built (Bragg 1915;

Rupp 2009).

1.7.2.3 Protein Crystallization

Protein overexpression and purification are necessary for providing a protein

sample of adequately high concentration and purity required for crystallization. A

common method for crystallization is vapour diffusion. Purified protein is first mixed

with a solution of precipitant (for example, ammonium sulfate or polyethylene glycol),

within a closed container over a large reservoir that holds the same solution. The

concentrations of both components are initially below that necessary to precipitate the

protein out of solution (Rhodes 2006). The water content of the mixture gradually

diffuses to the reservoir, thereby raising the concentrations of protein and precipitant to

cause precipitation; a crystal is the result of protein precipitated out of solution in an

ordered manner (Rhodes 2006). Crystal formation takes place in two stages: nucleation

and growth (Fig. 10A). First, protein molecules cluster together to “nucleate”, or to form

a seed. This is followed by the addition of protein molecules in solution to the seed

during crystal growth (Fig 10B).

Factors that can affect crystallization include pH, type of precipitant,

concentrations of protein and precipitant, protein purity and temperature (Rhodes 2006).

The use of screening kits is a practical method for determining an initial crystallization

condition. The fine-tuning of these factors may be necessary to produce optimally

diffracting protein crystals (this is commonly referred to as optimization).

41

Figure 10. Phase diagram of protein crystallization. A. Sufficiently high

concentrations of protein and precipitant are necessary for nucleation and crystal growth

(blue); only crystal growth can be attained at lower concentrations (green). The red zone

indicates low concentrations that cannot support nucleation or growth. B. Large crystals

are ideally grown when peak protein and precipitant concentrations achieved are just

enough to achieve nucleation, followed by a shift to the green zone for crystal growth.

(from Crystallography Made Crystal Clear. Rhodes 2006, Figure 3.5).

A. B.

42

1.7.2.4 Data Collection

Two key components of structure factors used to calculate an electron density

map are amplitude and phase (Rhodes 2006). The former can be acquired through data

collection, which involves obtaining information on the intensities of reflections (or

spots), the square roots of which are amplitudes of the structure factors. Data collection

consists of obtaining the diffraction patterns of the protein crystal in one-degree

increments; usually a total rotation of 180º (to obtain 180 frames) is sufficient to achieve

a complete data set.

The collection of x-ray diffraction data at extremely low temperatures (known as

cryocrystallography) such as in liquid nitrogen, is beneficial as it protects the crystal

against radiation damage (Rhodes 2006). A single crystal could then be used to collect a

complete data set, which otherwise would require several crystals if data collection took

place at room temperature. Ice crystals can form when protein crystals are frozen,

requiring the use of cryoprotectants (substances that prevent ice crystal formation).

1.7.2.5 Structure Determination

Following data collection, the first step in processing the data is indexing, which

involves finding the correct crystal symmetry space group based on the geometric

arrangement of reflections (ie. spots in a diffraction pattern) (Rupp 2009). In the

integration step, intensities are assigned to the reflections for all frames. Next, the

scaling of data merges all corresponding reflections between each frame into a single set

43

of unique reflections (after removal of all outliers), and finds a consistent intensity scale

for all reflections.

Data collection can only provide information on structure factor amplitudes,

whereas phase information is lost. Molecular replacement (MR) is a common method

employed to solve this “phase problem” by using a similar structure as a search model.

MR searches for a correct solution by orienting the model such that it corresponds with

the observed amplitudes (Rossmann 1962; Evans and McCoy 2008). Next, the phases of

the model are “borrowed” and used to estimate phases of the unknown structure, which

are combined with experimentally determined amplitudes to calculate an electron density

map for the target protein.

2 MATERIALS AND METHODS

2.1 Materials

The KpPanK template gene (1-316) was synthesized by GenScript. The

expression vector pET28-MHL was developed in-house by the Structural Genomics

Consortium (Fig 11). Pfu UltraII DNA polymerase was purchased from Agilent

Technologies. Restriction enzymes for plasmid digestion were purchased from New

England Biolabs. Primers were synthesized by Eurofins Operon. PCR purification and

miniprep kits were purchased from Qiagen. Growth media (Luria-Bertani, and Terrific

Broth) were purchased from Sigma-Aldrich. Benzonase nuclease was purchased from

Novagen. DE52 anion exchange resin was purchased from Whatman. Nickel-

44

nitrilotriacetic acid (Ni-NTA) resin beads were purchased from Qiagen. SDS-PAGE gels

(TGX 4-20%) were purchased from Biorad.

Adenosine diphosphate (ADP) was purchased from Sigma. The pantothenamides

used for structural and kinetic studies, N5-Pan, Np-Pan and compound 349, were

generously provided by our in-house chemists, Drs. David Smil and Yuri Bolshan. D-

pantothenic acid was purchased from Sigma-Aldrich. Crystallization screening kits were

developed and made in-house. 96-well plates (Art Robbins Intelliplates) used for

crystallization trials were purchased from Hampton Research. Proteases used for in situ

proteolytic treatment were purchased from Sigma. For crystal optimization, the Additive

Screen kit from Hampton Research was used.

For the kinase activity assay, the following were purchased from Sigma: pyruvate

kinase and lactate dehydrogenase enzymes, adenosine triphosphate (ATP),

phosphoenolpyruvate (PEP), and reduced β-nicotinamide adenine dinucleotide (NADH).

45

Figure 11. Overview of the pET28-MHL expression vector. The vector encodes a

kanamycin resistance marker and a hexahistidine tag located N-terminal to the gene of

interest. The vector is first linearized by restriction enzyme digestion (at sites flanking

the SacB gene), and the SacB gene is replaced with the gene of interest upon ligation. A

powerful promoter, the T7 promoter, mediates rapid transcription of the inserted gene by

the T7 polymerase.

46

2.2 Methods

2.2.1 Preparation of Expression Plasmid

KpPanK constructs were designed based on previously solved structures in the

PDB (specifically, EcPanK and MtPanK) as well as secondary structure predictions.

Gene inserts for each construct were amplified by polymerase chain reaction; primers

corresponding to each construct contain sequences that are complementary to BseRI

restriction enzyme recognition sites (Table I). A small amount of PCR products was

analyzed by electrophoresis on a 1% agarose gel to confirm the presence and size of

amplified gene inserts. For ligation of gene to vector, 1μL of PCR product was mixed

with 2µL of Infusion HD EcoDry pellet (Clontech) dissolved in linearized pET28-MHL

vector (pre-digested with BseRI enzyme). The mixture was incubated at 37ºC for 20

minutes, room temperature for 10 minutes and put on ice. The ligated mixture was then

transformed to E. coli DH5α cells, and plated onto LB agar plates (containing

kanamycin) and incubated overnight at 37ºC. Colonies confirmed with a positive gene

insert were chosen for growth, and the plasmid DNA was extracted by miniprep (Qiagen

Miniprep kit).

47

Figure 12. Small scale test of expression of KpPanK constructs. The soluble portion

(left) and whole cell lysates (right) for each construct are shown. The arrow indicates the

protein bands corresponding to solubly-expressed KpPanK. The sizes of the standard

protein ladder markers on the left are indicated.

K1 K2 K3 K4 K5 K6 K7 10 kD

15 kD

20 kD

25 kD

37 kD

50 kD

75 kD

100 kD

150 kD

250 kD

48

Table I. Sequences of primers used to generate KpPanK constructs of variable

truncation. The forward (ttgtatttccagggc) and reverse (caagcttcgtcatca) tail additions

correspond to the BseRI recognition sites. The start and end positions of each construct

are also indicated.

315 12 caagcttcgtcatcaACGTAAGCGTACTTGATTCACAG ttgtatttccagggcTACCTACAATTTAACCGCCACC K7

316 12 caagcttcgtcatcaTTTACGTAAGCGTACTTGATTCAC ttgtatttccagggcTACCTACAATTTAACCGCCACC K6

315 9 caagcttcgtcatcaACGTAAGCGTACTTGATTCACAG ttgtatttccagggcATGACACCGTACCTACAATTTAAC K5

316 9 caagcttcgtcatcaTTTACGTAAGCGTACTTGATTCAC ttgtatttccagggcATGACACCGTACCTACAATTTAAC K4

315 6 caagcttcgtcatcaACGTAAGCGTACTTGATTCACAG ttgtatttccagggcCAGACGTTAATGACACCGTAC K3

316 6 caagcttcgtcatca TTTACGTAAGCGTACTTGATTCAC ttgtatttccagggcCAGACGTTAATGACACCGTAC K2

316 1 caagcttcgtcatca TTTACGTAAGCGTACTTGATTCAC ttgtatttccagggcATGAGCCAAAAAGAGCAGACG K1

End Start Reverse Primer Forward Primer Construct

49

2.2.2 Protein Expression and Purification

KpPanK plasmids were transformed into E. coli BL21(DE3) competent cells

(BL21 refers to a strain deficient in lon and ompT proteases, and DE3 designates an

IPTG-inducible T7 polymerase – explained below) by heat shock, and plated onto LB

agar and incubated at 37ºC overnight. The next day, Luria-Bertani (LB) broth (Sigma)

was inoculated with transformants and grown at 37ºC for 16 hours. Next morning, the

overnight LB broth culture was transferred into Terrific Broth (TB) (Sigma) and further

grown at 37 ºC to achieve an OD600 of ~0.7 before overnight induction with 1mM

isopropyl β-D-thiogalactopyranoside (IPTG) at 18 ºC for 16 hours (T7 polymerase

expression in BL21(DE3) cells is under the control of the lac operon, whereby the

allolactose analogue IPTG binds to and inactivates the lac repressor to induce T7

expression, leading to excess gene transcription). The cells were harvested next morning

by centrifugation, flash frozen with liquid nitrogen and stored at -80 ºC until purification.

Prior to the start of protein purification, cell pellet was thawed and resuspended in

buffer A (50mM Tris-HCl pH 8.0, 5% [v/v] glycerol, 300mM NaCl), and supplemented

with 5mM imidazole, 0.5% 3-[(3-cholamidopropyl)dimethylammonio]-1-

propanesulfonate, 5 units/mL benzonase, 1mM phenylmethylsulfonyl fluoride and 1mM

benzamidine. The cells were lysed by sonication using a Misonix Sonicator 3000 (10s

ON, 10s OFF, for a total of 20 minutes at power output ~120W). The lysate was then

clarified by centrifugation (16000rpm for 90 minutes using a Beckman Coulter J-20 XPI

Centrifuge fitted with a JLA 16.250 rotor) and the supernatant was loaded into an open

column (Biorad Econo) containing DE52 resin (pre-charged with 2.5M NaCl) (DE52 is

50

an ionic exchange resin that is used both to capture anionic molecules such as nucleic

acids, and to filter the lysate). The flow-through from the first column drips onto a

second open column containing nickel nitrilotriacetic (Ni-NTA) resin beads to which

hexahistidine tagged proteins bind with high affinity. Once the lysate had passed

through, the Ni-NTA beads were washed with 50mL buffer A containing 30mM

imidazole. The protein was then eluted using 10mL of buffer A containing 500mM

imidazole (Fig. 13A).

The protein sample was further purified by size exclusion chromatography (SEC)

using Superdex 75 resin that was pre-equilibrated with gel filtration buffer (20mM Tris-

HCl pH 8.0, 5% glycerol, 200mM NaCl). The purity of each fraction was assessed using

SDS-PAGE gels (Fig. 13B); fractions of the highest purity were pooled together. The

molecular weight of the protein was verified by mass spectrometry.

Types I and II PanKs are known to bind with high affinity to CoA and its

thioesters, which show up in the crystal structures despite extensive dialysis (Hong,

Senisterra et al. 2007; Chetnani, Das et al. 2009). To remove co-purified substrates or

inhibitors, the protein was dialyzed for 3 days in 20mM Tris-HCl pH 8.0. The protein

was then concentrated to 35mg/mL using centrifugal filter units (Amicon 15mL size with

10kDa cutoff). Protein concentration was verified by triplicate measurements using the

NanoDrop 1000 Spectrophotometer (this instrument measures UV absorbance at 280nm,

which is due mainly to tryptophan and tyrosine residues).

51

Figure 13. Purification of KpPanK. A). SDS-PAGE gel of the wash flowthrough (left)

and eluted protein (right) during Ni-NTA affinity purification. (Note: The protein was

purified by splitting the sample into two open columns.) B). SDS-PAGE gel of gel

filtration peak fractions.

HiLoad 26 60 S75001:10_UV HiLoad 26 60 S75001:10_Fractions

0

500

1000

1500

2000

mAU

120 140 160 180 200 220 ml

A1 A2 A3 A4 A5 A6 A7 A8 A9 A10 A11 A12 B12 B11 B10 B9 B8 B7 B6 B5 B4 B3 B2 B1

A10 A11 B12 B11 B10 A12 10 kD

15 kD

20 kD

25 kD

37 kD

50 kD

75 kD

100 kD

150 kD

250 kD B.

10 kD

15 kD 20 kD 25 kD 37 kD

50 kD

75 kD 100 kD

150 kD

250 kD

Wash Elution

A.

52

2.2.3 Protein Crystallization and Data Collection

KpPanK protein was incubated with 5mM MgCl2, 30mM ADP and 30mM

substrate (pantothenate, N5-Pan, N7-Pan, Np-Pan or compound 349) overnight at 4ºC.

The inclusion of ADP is due to sequential substrate binding observed in the type I E. coli

PanK (ie. nucleotide binds first, followed by substrate) (Song and Jackowski 1994). The

diphosphate form was chosen over the triphosphate form to prevent formation of a

phosphorylated product which can be released easily. The protein was then mixed at 1:1

(0.5μL) ratio with solutions from two in-house screening kits (containing 96 conditions

each) using a Rigaku Phoenix-HT liquid-handling robot, and crystallized using the sitting

drop vapour diffusion method in 96-well Intelliplates. In situ proteolysis was also used to

increase the success rate of crystallization (Dong, Xu et al. 2007). Briefly, this method

involves the addition of trace amounts of protease to the buffer:protein mixture for the

purpose of truncating flexible polypeptides to yield more globularly shaped proteins

(favourable for crystallization). In these studies, 1:500 ratio by weight of protease to

protein was added (e.g. 1mg of protease per 500 mg of protein). The proteases used

include: α-chymotrypsin, trypsin, elastase, subtilisin, endoproteinase Glu-C V8, papaya

proteinase I, dispase I and thermolysin.

Within a week, crystals appeared in a condition containing 20% (w/v) PEG3350

and 0.2M tri-lithium citrate in drops that did not contain proteases (Fig 14A, 15A).

Though crystals also appeared when proteases were supplemented, initial attempts at

optimization omitted proteases. Crystals were transferred to a cryoprotectant solution

53

containing 1:1 mixture of paratone-N and mineral oil, and stored in liquid nitrogen for

screening/data collection.

Dr. Wolfram Tempel (SGC, Toronto) generously provided technicial assistance

in screening crystals using the in-house X-ray generator (Rigaku Rotating Copper Anode)

in the Structural Genomics Consortium (SGC). Among crystals from the original

condition and several initial rounds of optimization (altering PEG3350 and tri-lithium

citrate concentrations), the best resolution was 3.5Å. The diffraction quality of the

crystals was significantly improved by growing them in the mixture mentioned

previously and supplementing 0.2 μL of additives from the Hampton Research Additive

Screen kit (96 additives): (±)-1,3-butanediol helped improve N5-Pan bound crystal

diffraction to 2.1Å (Fig. 14B); 2,5-hexanediol improved the resolution of crystals from

protein incubated with Np-Pan (Fig. 15B).

Data used to solve the final structures were collected at the Advanced Photon

Source (Argonne National Laboratory, IL, USA). Diffraction data for KpPanK

complexed with N5-Pan were collected using 19-ID beamline. Data for KpPanK

complexed with Np-Pan were collected using the 23-IDB beamline. Dr. Wolfram

Tempel and ANL staff generously provided assistance in collecting X-ray diffraction

data.

Diffraction data were indexed and integrated by using the program XDS (Kabsch

2010), and processed and scaled by Pointless and Scala (Evans 2006) in the CCP4 suite

(Collaborative Computational Project 1994).

54

Figure 14. Crystals of KpPanK co-crystallized with N5-Pan. A. Initial crystals of

N5-Pan bound KpPanK, grown by mixing 0.5μL protein (35mg/mL incubated with

30mM N5-Pan, 30mM ADP and 5mM MgCl2) and 0.5μL reservoir buffer (20% w/v

PEG3350, 0.2M tri-lithium citrate). These crystals diffracted with an average resolution

of 3.5Å. B. Optimized crystals of KpPanK incubated with N5-Pan grown by adding

0.2μL 40% (±)-1,3-butanediol to the mixture mentioned. The best crystal diffracted to

2.1Å resolution.

B.

A.

55

Figure 15. Crystals of KpPanK co-crystallized with Np-Pan. A. Initial crystals of

Np-Pan bound KpPanK, grown by mixing 0.5μL protein (35mg/mL incubated with

30mM Np-Pan, 30mM ADP and 5mM MgCl2) and 0.5μL reservoir buffer (20% w/v

PEG3350, 0.2M tri-lithium citrate). B. Optimized crystals of Np-Pan bound KpPanK

grown by adding 0.2μL 2,5-hexanediol to the mixture mentioned. The best crystal

diffracted to 1.95Å resolution.

A.

B.

56

Table II. Summary of substrates used for KpPanK co-crystallization and the best

resolution achieved.

1.95 Å yes N-pyridin-3-

ylmethylpantothenamide

(Np-Pan)

4.0Å yes Compound 349

>10.0Å yes N-heptylpantothenamide

(N7-Pan)

2.1Å yes N-pentylpantothenamide

(N5-Pan)

>10.0Å yes Pantothenate

Best Resolution Successful crystallization

Chemical

Structure

Compound

57

2.2.4 Structure Determination, Refinement and Validation

The structure of KpPanK complexed with N5-Pan was solved by molecular

replacement using the program PHASER-MR (Read 2001) and one monomer of the E.

coli PanK (PDB: 1SQ5) as a search model (EcPanK is a suitable model because it shares

90% sequence identity with KpPanK). The output from XDS following indexing and

integration provided the unit cell dimensions of the KpPanK crystals, and indicated the

lattice with the highest symmetry space group to be primitive orthorhombic (P222) (a

crystal lattice in the form of a rectangular prism defined by 90º crystallographic axes).

The number of molecules in the asymmetric unit could be predicted using the Matthews

coefficient (volume of the unit cell divided by the product of the protein’s molecular

weight, number of asymmetric units per unit cell and the number of molecules per

asymmetric unit). Matthews probability calculation (Matthews 1968; Kantardjieff and

Rupp 2003) indicated that there are most likely eight or nine monomers per asymmetric

unit (Fig. 17), based on empirically observed Matthews coefficients from structures

deposited in the PDB. However, since the known functional unit of type I PanKs is a

homodimer (Song and Jackowski 1994), eight subunits were entered as a search

parameter in molecular replacement. The high resolution limit was set to 4Å in

PHASER-MR to allow for possible conformational differences in the side chains between

the KpPanK structure and the search model. The space groups belonging to the primitive

orthorhombic class (P222, P2221, P21212 and P212121) were tested to find the correct

molecular replacement solution. Of the tested space groups, the group P212121 showed

the best solution (ie. no clashes were observed between the subunits when the model was

58

displayed on screen). After one round of model refinement, the working and free R

factors were 28% and 32%, respectively.

Manual model building was done using the program Coot (Emsley and Cowtan

2004; Emsley, Lohkamp et al. 2010). Water molecules were built in Coot with the

following restrictions with the following requirements: visible density with hydrogen

bond distances between 2.2 and 3.2Å. Uninterpretable density was modeled as unknown

(UNX) atoms. The model was refined using Refmac5 (Murshudov, Skubak et al. 2011)

in the CCP4 suite. Hydrogen atoms were generated for refinement in Refmac5, but were

excluded in the coordinate output.

For KpPanK in complex with Np-Pan, the diffraction data were integrated,

indexed and scaled as with the N5-Pan structure. Indexing by XDS also indicated nearly

identical unit cell dimensions and space group as the N5-Pan structure. As such, the

coordinates of the KpPanK·N5-Pan structure were used to refine against the newly scaled

data of the KpPanK·Np-Pan complex after removing all water molecules and bound N5-

Pan. The working and free R factors from an initial round of refinement were 24% and

28% respectively. Water molecules were added using Coot, as mentioned in model

building of the KpPanK·N5-Pan complex.

The restraints for the chemical structures of ligands (N5-Pan and Np-Pan) used in

refinement were generated using the PRODRG server (Schuttelkopf and van Aalten

2004). The Molprobity server was used to validate both structures for bond angle and

length variations, Ramachandran outliers and proper amino acid rotamers (or

conformation of side chains) (Chen, Arendall et al. 2011). All figures were generated

59

using PyMOL (The PyMOL Molecular Graphics System, Version 1.5.0.3, Schrödinger,

LLC).

Statistics for data collection and refinement are shown in Table III. The KpPanK

structures in complex with N5-Pan and Np-Pan have been deposited to the PDB with

accession codes 4F7W and 4GI7, respectively.

60

Figure 16. Diffraction patterns of KpPanK crystals. A. Diffraction pattern of a

crystal when screened with the SGC in-house X-ray generator Rigaku (model FR-E)

containing a rotating copper anode. B. Diffraction pattern of obtained during data

collection using the 19-ID beamline (Advanced Photon Source, Argonne National

Laboratory, IL).

A.

B.

61

Ligand N5-Pan Np-Pan

PDB ID 4F7W 4GI7

Data Collection

Beamline 19-ID Advanced Photon Source

(APS)

23-IDB (APS)

Wavelength (Å) 0.97931 1.03321

Resolution (Å) 48.04-2.05 40-1.95

Space Group P212121 P212121

No. of molecules in asymmetric

unit

8 8

Unit Cell Parameters (Å) a = 127.8, b = 130.8,

c = 190.2

a = 127.9, b = 130.9,

c = 193.0

(degrees) α = β = γ = 90 α = β = γ = 90

No. of measured reflectionsa

1327648 (181294) 1668077 (214666)

No. of unique reflections 187519(27124) 234904 (33760)

Completeness (%) 99.7(99.3) 99.9 (99.1)

Friedel Redundancy 7.1(6.7) 7.1 (6.4)

/σ 13.7(3.0) 9.3 (2.1)

Rmergeb (%) 14.8(89.8) 12.9(85.2)

Refinement

Resolution (Å) 40.0-2.1 40-2.0

Rwork/Rfree (%)c

18.7/22.7 22.2/25.7

No. of atoms

protein 19392 19896

ligand/ion 389 372

water 988 1023

Average B-factors (Å2)

protein 26.3 33.4

ligand/ion 24.4 32.8

water 25.9 32.8

RMSD bond length (Å) 0.013 0.010

RMSD bond angle (degrees) 1.4 1.4

Ramachandran Analysisd

Favored (%) 91.6 91.9

Additionally allowed (%) 8 7.7

Generously allowed (%) 0.2 0.4

Disallowed (%) None None

Table III. Data collection and refinement statistics for KpPanK crystals.

a Numbers in parentheses are for the outer shell.

b Rmerge = Σ[(I − I )]/Σ(I), where I is the observed intensity and is the average intensity.

c Rwork = Σ[|Fobs| − |Fcalc|]/Σ|Fobs|, where |Fobs| and |Fcalc| are magnitudes of observed and calculated

structure factors respectively. Rfree was calculated as Rwork using 5.0% of the data, which was set

aside for an unbiased test of the progress of refinement.

d The program PROCHECK(Laskowski 1993) was used.

62

Figure 17. Matthews Probability calculation of the oligomeric state of the KpPanK

asymmetric unit. The probabilities for the oligomeric state of the KpPanK asymmetric

unit were calculated based on the crystal’s diffracting resolution, unit cell dimensions,

space group, as well as the protein’s molecular weight. The highest probable oligomeric

states are located near the top of each peak.

63

2.2.5 Spectrophotometric assessment of substrate kinetics

KpPanK substrate kinetics were examined based on an adapted protocol of the

pyruvate kinase/lactate dehydrogenase (PK/LDH) coupled assay publ