Spring 2007 Bioinformatiatics Ch. 6 - Genomics. Completed genomes Spring 2009 Bioinformatiatics .
Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the...
Transcript of Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the...
![Page 1: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/1.jpg)
Chapter 9
Mapping and characterizing whole genomes
• Structural Genomics• Functional genomics
![Page 2: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/2.jpg)
How many genes has a human?
![Page 3: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/3.jpg)
27,000
5,500
![Page 4: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/4.jpg)
Interpretation of genomicinformation:
high throughputtechnologies are used to getideas about gene (orgenomic) function.
![Page 5: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/5.jpg)
Structural and functional genomics:a hierarchical representation
![Page 6: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/6.jpg)
Structural Genomics.The analysis of the physical structure of genomes.
![Page 7: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/7.jpg)
Mapping Genomes
Cytogenetic and Genetic maps were very helpful forsequencing genomes.
Cytogenetic maps are established by correlating chromosomallandmarks with phenotyps. The correlation with the location ofcloned DNA can result in high resolution maps.
![Page 8: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/8.jpg)
Chromosome painting by in situ hybridisation using different-labelled probes.
![Page 9: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/9.jpg)
A B
a b
A B a b
a bX
A B
A = rote Blüte, B = hohe Pflanze
F1:
Genetische Karten
![Page 10: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/10.jpg)
A B
a b
a b
a bX
Genetische Karten 1: die Phänotypen der Allele der GeneA und B werden betrachtet
A B
a ba b
a b
parental:
Die Gene A und Bsind mit 10 cMgekoppelt,Analyse durch Auswertung derPhänotypen
rekombinant:A b
a ba B
a b
90
10
![Page 11: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/11.jpg)
A B
a b
a b
a bX
Genetische Karten 2: der Phänotyp der Allele von A undder DNA-Polymorphismus in Position B werden betrachtet
A B
a ba b
a b
parental:
rekombinant:
A b
a B
90
10
Phänotyp DNA in B
A/a
a/a
A/a
a/a
B/b b/b
b/b B/b
![Page 12: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/12.jpg)
A B
a b
a b
a bX
Genetische Karten 3: die DNA-Polymorphismen in denPositionen A und B werden betrachtet
A B
a ba b
a b
parental:
rekombinant:
A b
a B
90
10
DNA in A DNA in B
B/b b/bA/a a/a
b/b B/bA/a a/a
![Page 13: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/13.jpg)
High resolution genetic maps: making use of meiotic recombination
a) Restriction fragment lenght polymorphism maps (RFLP maps)
neutral DNA sequence variation is used
![Page 14: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/14.jpg)
A probe P detects a DNA polymorphism when the genomic DNA is cut by acertain restriction enzyme (RE). The pedigree of the dominant diseasephenotype D shows linkage of the D locus to the RFLP locus; only child 8is a recombinant.
![Page 15: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/15.jpg)
preparation of the probe
Obtaining a DNA fingerprint by using VNTR (variable numbertandem repeats) probe. VNTRs are also called minisatellite DNA.VNTRs consist of a variable number of a repeating unit which isabout 15 to 100 bp in length.
![Page 16: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/16.jpg)
In this example, a Southern blot is used for detection. Now replaced by PCR
![Page 17: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/17.jpg)
DNA fingerprints
are used in forensic medicine. Minute DNAamounts isolated for example from bloodare used by amplifying specific VNTRsequences with PCR.
![Page 18: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/18.jpg)
VNTRs can be used for genetic mapping. The molecular markers can bemapped to one another or to a locus with a known phenotype.
![Page 19: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/19.jpg)
Microsatellite Markers
Microsatellites is a class of repetitive DNA that is based on di- andtrinucleotide repeats that are highly variable between individuals. Thesesimple-sequence length polymorphisms (SSLPs) are also used for geneticmapping.(VNTRs are also classified as SSLPs).
(CA)n(GT)n
Primer 1
Primer 2
5'5'
![Page 20: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/20.jpg)
Microsatellites as molecular markers for mapping.
![Page 21: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/21.jpg)
Microsatellites as molecular markers for mapping.
![Page 22: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/22.jpg)
High resolution genetic maps
b) Simple sequence length polymorphisms (SSLPs)
RFLP markers have first been used in molecular mapping projects. Theyare now replaced by markers based on the variation of short tandem
repeats.
• Tandemly repeated• Variable numbers of repeats, give different size restriction fragments
detected on Southern blots• Simple sequence length polymorphisms (SSLPs)
– e.g., TGACGTATGACGTATGACGTATGACGTA– mutations give rise to large number of alleles– higher proportion of heterozygotes– two types in genomics
• minisatellite (VNTRs)• microsatellite
![Page 23: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/23.jpg)
• Minisatellites– based on variation of number of tandem repeats
(VNTRs) which segregate as alleles– in humans, repeat unit is 15-100 nucleotides, for total
of 1-5 kb– if number of repeats is variable, Southern blot will
show numerous bands– basis of DNA fingerprinting and can be used in
mapping• Microsatellites
– sequences dispersed throughout the genome– variable numbers of di- or trinucleotide repeats– detected by PCR
There are several more molecular mapping techniques existing
![Page 24: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/24.jpg)
Physical Mapping of Genomes
![Page 25: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/25.jpg)
Long chromosomal fragments (~ 150 kb) can be cloned into BAC vectorsand a genomic librqary can be established.
![Page 26: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/26.jpg)
Individual BAC clones are alligned in order to cover wholechromosomes. These BAC contigs are one possible starting materialfor genome sequencing projects.
(An example from the yeast genome is presented in the next figure.)
heterochromatin
centromer
chromosome
![Page 27: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/27.jpg)
![Page 28: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/28.jpg)
Genome projects
After alignement of the BAC clones, each BAC is sequenced by shotgunsequencing: DNA fragments of 1 - 2 kb are generated, sequenced from bothends, and aligned by sequence comparisons.
An alternative is to omitt the BAC clones and to start shotgun sequencingdirectly with the genomic DNA.
![Page 29: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/29.jpg)
A bacterial genome
![Page 30: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/30.jpg)
Arabidopsis thaliana genome sequence
The Arabidopsis genome initiative, Nature408, 796-815 (2000)
![Page 31: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/31.jpg)
Lin et al, Nature 402, 761-768 (1999)
![Page 32: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/32.jpg)
Proportion of predicted genes in functional categoriesAbout 25,000 genes have been predicted
The Arabidopsis genome initiative, Nature 408, 796-815 (2000)
![Page 33: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/33.jpg)
Segmentally duplicated regions in the Arabidopsis genome.The Arabidopsis genome initiative, Nature 408, 796-815 (2000)
![Page 34: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/34.jpg)
Functional genomics
• Study of expression and interaction of gene products• Requires new vocabulary and techniques
– transcriptome: all DNA transcripts• may be monitored by use of DNA chips
– proteome: all encoded proteins• complicated by alternative splicing
– interactome: all interactions between all categories ofmolecules
• detected by two-hybrid system and relatedprocedures
– phenome: phenotype of each gene knockout
![Page 35: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/35.jpg)
Functional genomics
• The study of transcriptional regulation by using DNA chips• The study of proteins by using 2D gels and mass spectroscopy• The study of metabolites by using chromatographic separation and mass
spectroscopy
![Page 36: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/36.jpg)
The analysis of cells, tissues, and organisms can occur on differentlevels of gene expression
DNA
RNA
Protein
Metabolite
Genome
Transcriptome
Proteome
Metabolome
![Page 37: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/37.jpg)
Transcriptome analysisba using microarrays (DNA chips)
![Page 38: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/38.jpg)
Display of gene expression patterns detected bymicroarrays.
Each row is a different gene and each column adifferent time point. Red means active; greeninactive.
![Page 39: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/39.jpg)
Caterpillar and butterfly of the same species
Lottspeich, Angewandte Chemie, 1999
Proteome
![Page 40: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/40.jpg)
![Page 41: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/41.jpg)
Arabidopsis proteins separated on a 2D PAGE; provided by Angelika GörgFirst Dimension: 3-10 IPG
isoelectric focusingSDS PAGE
![Page 42: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/42.jpg)
++
samplegrating
UV or IR laser
TOF detector
MALDI-TOF analysis of proteins
![Page 43: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/43.jpg)
Lipophilic phase of Arabidopsis leaves analysed by GC/MS; ~ 160 metabolitescan be distiguished.
![Page 44: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/44.jpg)
Metabolite profiling by GC/MS. Base peak intensity GC/MS chromatogram of the polarfraction of a leaf extract from the Arabidopsis dgd1 mutant (A). Target metabolites areidentified by exact retention times and their corresponding mass spectra (B) as shownfor the co-eluting peaks of malate, -aminobutyric acid (GABA), and an unidentifiedcompound. m/z, Ratio of mass to charge.
![Page 45: Structural Genomics • Functional genomics - …...Structural Genomics. The analysis of the physical structure of genomes. Mapping Genomes Cytogenetic and Genetic maps were very helpful](https://reader033.fdocuments.in/reader033/viewer/2022042620/5f467384ef383748ff0a46f2/html5/thumbnails/45.jpg)
Scheme showing how the integration of results from differenttechnological levels of functional genomics leads to construction of a
virtual plant
Functional Genomics