Structural Characterisation of Neuronal Voltage-sensitive K+ ...

Structural Characterisation of NeuronalVoltage-sensitive K1 Channels HeterologouslyExpressed in Pichia pastoris

David N. Parcej* and Luise Eckhardt-Strelau

Department of StructuralBiology, Max-Planck-Institutefor Biophysics, 60439 Frankfurtam Main, Germany

Neuronal voltage-dependent Kþ channels of the delayed rectifier typeconsist of multiple Kv a subunit variants, which assemble as hetero- orhomotetramers, together with four Kvb auxiliary subunits. Direct struc-tural information on these proteins has not been forthcoming due to thedifficulty in isolating the native Kþ channels. We have overexpressed thesubunit genes in the yeast Pichia pastoris. The Kv1.2 subunit expressedalone is shown to fold into a native conformation as determined by high-affinity binding of 125I-labelled a-dendrotoxin, while co-expressed Kv1.2and Kvb2 subunits co-assembled to form native-like oligomers. Sites ofpost-translational modifications causing apparent heterogeneity on SDS-PAGE were identified by site-directed mutagenesis. Engineering toinclude affinity tags and scale-up of production by fermentation allowedroutine purification of milligram quantities of homo- and heteroligomericchannels. Single-particle electron microscopy of the purified channelswas used to generate a 3D volume to 2.1 nm resolution. Protein domainswere assigned by fitting crystal structures of related bacterial proteins.Addition of exogenous lipid followed by detergent dialysis producedwell-ordered 2D crystals that exhibited mostly p121 symmetry. Projectionmaps of negatively stained crystals show the constituent molecules to be4-fold symmetric, as expected for the octameric Kþ channel complex.

q 2003 Elsevier Ltd. All rights reserved.

Keywords: channel; expression; electron microscopy; structure*Corresponding author

Introduction

Kþ channels are integral membrane proteins thatselectively allow the flux of Kþ across the cellmembrane.1 Molecular cloning2,3 and scanning ofgenomic databases4 has unveiled a vast repertoireof putative Kþ channel subunits in both eukaryotesand prokaryotes. All have a common pore region,flanked by two transmembrane domains, which isresponsible for ion selectivity and conduction,while the amino acid sequence and predicted top-ology outside this domain is variable. Inwardrectifier Kþ channels contain the two trans-

membrane domains together with extended N andC-terminal sequences, while voltage-dependent(Kv) Kþ channels are predicted to possess a totalof six transmembrane regions along with N andC-terminal sequences of variable length. Themechanism of Kþ selectivity in the pore has beenclarified by X-ray crystallography of a two-trans-membrane Kþ channel, KcSA5 from Streptomyceslividans,6 which was expressed in Escherichia coli.Near-absolute conservation of the pore signaturesequence strongly suggests that the mechanism ofKþ discrimination is the same in all Kþ channels.Sequence and functional analyses indicate that thearrangement of transmembrane helices surround-ing the pore may differ between Kþ channeltypes,7 while there is no direct structural infor-mation regarding the arrangements of the extramembrane-spanning domains in Kv and otherchannel types. This information is important, sinceKv channels in neurones perform several essentialfunctions, including control of cell excitability andmodulation of neurotransmitter release.

0022-2836/$ - see front matter q 2003 Elsevier Ltd. All rights reserved.

E-mail address of the corresponding author:[email protected]

Abbreviations used: a-DTX, a-dendrotoxin; Chapso,3-[(3-cholamidopropyl)dimethylammonio]-2-hydroxy-1-propanesulphonate; DecM, n-decyl-b-D-maltopyranoside; DoDM, n-dodecyl-b-D-maltopyranoside; DMPC, 1,2-dimyristoyl-sn-glycero-3-phosphocholine; PVDF, poly(vinylidene difluoride).

doi:10.1016/j.jmb.2003.07.009 J. Mol. Biol. (2003) 333, 103–116

Kv channels have been characterised biochemi-cally and isolated from brain,8,9 thanks to theirsusceptibility to a-dendrotoxin (a-DTX), a poly-peptide from mamba venom. They have beenshown to be octamers comprising four a and fourb subunits.10 The a subunits are encoded by genesof the Kv1 subfamily (Kv1.1–1.6), which are ableto form active channels as both homo- and hetero-oligomers, giving rise to many possible combi-nations. Analysis of purified channels has shownmany of the combinations to be present in vivo.11

The most prominent Kv1 subtype is Kv1.2, whichis also the most susceptible to a-DTX. Proteinsequencing of the b subunit from isolated channelsled to the cloning of its gene and subsequentisolation of other subtypes.12 Some Kvb types (e.g.Kvb1) have been shown to directly influencechannel inactivation by a “ball and chain”mechanism.13 The major isoform in purified Kþ

channels is Kvb2, which has been shown topromote surface expression of some but not all asubunits in vitro.14,15 However, though lacking aball domain, it too can speed inactivation of Kþ

channels16 by an unknown mechanism. Unfortu-nately, the low level of Kv channel expression inbrain (approximately 0.5–1 pmol of [125I]a-DTXbinding/mg of membrane protein) makes it diffi-cult to isolate enough material for structural andspectroscopic analysis, a problem complicated alsoby the aforementioned heterogeneity.

One successful approach to obtaining structuraldata has been to express parts of the channel inlarge quantities. However, this has been restrictedso far to soluble domains such as the T1 assemblydomain17 and isolated Kvb subunit.18 Severalefforts have been made19 – 21 to heterologouslyexpress large amounts of whole eukaryotic Kv sub-units, but these often resulted in low yields ofactive protein. In this study, we have expressedKv1.2 alone or together with Kvb2 subunits in themethylotrophic yeast Pichia pastoris. We haveshown the protein to be active using [125I]a-DTXbinding as a measure and have investigated post-translational modifications by site-directedmutagenesis. After purification by affinity chroma-tography we have performed single-particleelectron microscopy and produced 2D crystalssuitable for analysis in the electron microscope. Toour knowledge, this represents the first structuraldata on a heterologously expressed mammalianKþ channel protein.

Results and Discussion

Identification of post-translationalmodifications in Kv1.2 after expression of wild-type and mutant constructs in P. pastoris

Production of Kv1.2 protein by P. pastoris wasdemonstrated on Western blots of membranesusing anti-Kv1.2 antibodies (Figure 1). Labellingwas not observed in membranes from non-induced

cells, or in membranes from cells transformed withempty vector (before or after induction). In con-trast, strong labelling was observed with mem-branes from induced cells harbouring the Kv1.2construct. The antibody staining was diffuse andcould sometimes (e.g. Figure 1) be resolved intoindividual bands. The size of the lower resolvedband (58 kDa) was close to that predicted from theamino acid sequence (56.7 kDa) and to thatobserved for in vitro translated Kv1.2 subunit.22

This would suggest that the remaining hetero-geneity may be due to post-translational modifi-cation of the protein. Previously we have shownthat Kv1.2 examined in brain membranes23

exhibited similar behaviour during SDS-PAGE,due partly to N-glycosylation. It has been shownthat Kv1.2 and other channels are additionallymodified by tyrosine24 and serine/threoninephosphorylation.12,25,26 We therefore made mutantchannels in which we destroyed putative con-sensus N-glycosylation sequences and phosphoryl-ation sites (paying particular attention to a tyrosinekinase site at the N terminus and conversedprotein kinase A sites in the C terminal domain)and examined their electrophoretic mobility(Figure 2). Removal of the N-glycosylation sitebetween putative transmembrane domains S1 andS227 (construct Kv1.2(K)N) noticeably and consist-ently narrowed the band observed on Westernblots, but considerable heterogeneity was stillpresent. However, when Kv1.2 was furthermutated to remove a potential protein kinaseA/cGMP-dependent kinase,28 serine 447, adramatic effect was observed whenever the proteinwas observed on Western blots. Protein bearing

Figure 1. Kv1.2 protein production in P. pastorisSMD1163 cells. Cells transformed with empty vector(pPIC3.5K) or Kv1.2(K) construct were harvested before(0) or 24 hours (24) after induction with methanol.Crude cell membranes were prepared and 10 mg ofprotein was subjected to SDS-PAGE and Westernblotting. Blots were probed with anti-Kv1.2 antibody(0.025 mg/ml) and visualised with alkaline phosphatase-coupled secondary antibody. Arrows show the migrationof standard proteins; o marks the gel origin, and df thedye front.

104 Expressed Eukaryotic Kþ Channel Structure

this double mutation migrated as a major speciesof 58 kDa with only a small amount of greatermass material. Further removal of other serineresidues at positions 449 (triple mutantKv1.2(K)NP12) and 451 (quadruple mutantKv1.2(K)NP123) had little or no additional effect.Conversely, substitution in Kv1.2(K)N of a tyrosineresidue at position 132 by tryptophan actuallycaused an increase in intensity of staining of theupper relative to the lower band. It is surprisingthat a single phosphorylation event could causesuch a large alteration in mobility. Possibly, thechange is due to local changes in charge thatinfluences SDS binding, although lack of any effectdoes not necessarily indicate that a site is not modi-fied. This analysis shows that the heterogeneity ofKv1.2 observed in brain is due to glycosylation/phosphorylation, and that the protein produced inP. pastoris is similarly modified.

Binding of specific ligands demonstrates thatKv1.2 produced in P. pastoris is in native form

Unfortunately, protein produced in many hetero-logous expression systems is often found to beinactive or misfolded. This may be particularlyproblematic for eukaryotic membrane proteins29

and has been observed for Kþ channels.30 In orderto address this, we used a-DTX, a polypeptidefrom mamba venom, which has been shown to bea specific and high-affinity blocker of Kv1.2 Kþ,channels and is a sensitive probe of correct channelfolding, assembly and stability.10,31 – 34 Membranesfrom P. pastoris expressing Kv1.2 subunit genes(Kv1.2(K) construct), display high levels of satur-able a-DTX binding (Figure 3A). The number ofbinding sites observed (98(^30) pmol/mg of

membrane protein; n ¼ 8) is almost 100-fold inexcess of that in native rat brain membranes(1–1.5 pmol/mg)35 and greatly exceeds the levelsmeasured in other heterologous expression sys-tems to date.36 Further analysis (Figure 3B),shows that the toxin binds to the channelsproduced by P. pastoris with an affinity(0.25(^0.03) nM) identical with those in brainmembranes. Furthermore, this binding is blockedwith high affinity by another Kþ channel toxin,charybdotoxin (Figure 3C; apparent Ki ¼0:09ð^0:02Þ; n ¼ 5), also as found for nativechannels.37 This shows that at least some of theKv1.2 protein in P. pastoris is in the native confor-mation. Because it is difficult to quantify the totalprotein produced from Western blots, we cannotrule out the possibility that a population of inactiveprotein is present. This requires binding measure-ments on purified protein (see below).

Production of the Kvb2 subunit

In order to test production of the cytosolicauxiliary subunit Kvb2, both untransformed cellsand those already producing Kv1.2(NP12) mutantsubunit were transformed with Kvb2 constructs.Surprisingly, analysis by Western blots indicatedthat in both cases the Kvb2 subunit was associatedlargely with the membrane fraction (Figure 4A).When relatively large amounts of protein wereloaded (e.g. Figure 4A), the antibodies recognisedtwo species of 39 kDa and 41 kDa, suggestingthe occurrence of either proteolysis or post-translational modification. The former is unlikely,since the antibodies are raised to the extremeC-terminal end and the protein is able to bindstreptactin agarose (see later) by virtue of a strepII

Figure 2. Effect of mutations onthe migration of Kv1.2 channel onSDS-PAGE. A, Western blot ofmembranes (10 mg of protein)from cells expressing mutant Kv1.2subunit constructs. Kv1.2 proteinwas detected with anti-Kv1.2 anti-body (0.025 mg/ml) followed byincubation with alkaline phos-phatase-conjugated secondary anti-body. The calculated mass of theedges of the Kv1.2(K) band is indi-cated (Mr). B, Comparison of puta-tive phosphorylation sites in Kv1.1and Kv1.2. Numbers show theresidue positions starting from theinitiating methionine residue.

Expressed Eukaryotic Kþ Channel Structure 105

tag at the N terminus. Unlike for Kv1.2, there is nodirect functional measure for Kvb2 proteinproduction. However, SDS-PAGE followed bystaining with Coomassie brilliant blue of mem-branes from cells expressing Kv1.2 alone, Kvb2alone or both subunits (Figure 4B), indicates thatthe Kvb2 protein is produced in far greaterquantities than Kv1.2.

Purification of the Kv1.2 K1 channel proteinproduced in P. pastoris

After testing numerous combinations of affinitytags at various positions in the protein, weobtained the best results for Kv1.2(K) constructsbearing polyhistidine and strepII affinity tags atthe N terminus. Binding experiments (not shown)indicate no detrimental effect on binding affinity

by the addition of the tags. Scale-up of cell culturein a fermenter yielded 150–300 g of cell mass perlitre. Breaking the cells using a Microfluidisergave yields of 10–20 mg of membrane protein pergram wet weight of cells. To solubilise proteinfrom the membranes, we were able to use con-ditions that were optimised for the native brainprotein.10 Retention of [123I]a-DTX binding activitythroughout the Ni-NTA affinity purificationindicated that the solubilised channels were activeand stable. The amount of binding in the eluatewas about 50% of that applied (Table 1),which compares well with toxin-affinitychromatography.9 In addition, the specific activityof the purified protein was approximately 75% ofthe theoretical maximum of 4390 pmol/mg ofprotein (calculated assuming one toxin molecule isbound per tetrameric complex of 228 kDa), which

Figure 3. Binding of [125I]a-DTX to membranes from cells expressing Kv1.2. Crude cell membranes were preparedfrom P. pastoris cells and [125I]a-DTX binding measured as described in Materials and Methods. A, Specific binding of3 nM labelled toxin to SMD1163 cells expressing Kv1.2(K) construct. Parallel binding to rat brain synaptosomal mem-branes is shown for comparison. Error bars are standard deviations for eight (Kv12(K)-SMD1163) or three (rat brainmembranes) experiments. (B) Scatchard analysis of binding to membranes from Kv1.2(K)-producing SMD1163 cells.Data were fit to a single-site binding model using the non-linear curve-fitting program GRAFIT. (B) Total binding;(O) non-displaceable binding; (X) saturable binding. C, Blockade of [125I]a-DTX binding (1 nM) to Kv1.2(K) membranesby increasing concentrations of unlabelled a-DTX (X) or charybdotoxin (B).

Figure 4. Production of Kvb2subunit. Membranes (m) or super-natant (s) fractions (10 mg ofmembrane protein or equivalentsupernatant volume) from cellsproducing Kvb2 subunit 24 hoursafter induction were analysed bySDS-PAGE and Western blotting.A, Left, P. pastoris cells expressingKvb2 construct alone probed withanti-Kvb antibodies (0.5 mg/ml);middle, cells co-expressingKv1.2(NP12) and Kvb2 constructsprobed with anti-Kvb antibodies;right, co-expressing cells probed

with anti-Kv1.2 antibody. B, Coomassie-stained gel of membranes (30mg of protein) from cells expressing Kv1.2alone, Kvb2 subunit alone or co-expressing Kv1.2 and Kvb2 before (0) or 24 hours after induction. Arrows show theposition of the Kv1.2 and Kvb2 subunit bands. The position of the P. pastoris alcohol oxidase protein (aox) is indicated.


again is slightly better than for the purified brainchannel.38 This indicates that most or all of theKv1.2 protein produced in P. pastoris is correctlyfolded and assembled.

SDS-PAGE followed by staining the Ni-NTAcolumn eluate with Coomassie brilliant blue indi-cates a high degree of purity after this single step.Subsequent chromatography on streptactin-agarose was used routinely to concentrate thepurified channels but led to no noticeable increasein purity (Figure 5). The diffuse staining of purifiedKv1.2 was as expected from the multiple bandsseen in blots of membranes of the wild-typeprotein and is very similar to the pattern observedwith purified brain channels.8,9 Importantly, withthis procedure we were able to produce milligramamounts of protein, which is vastly superior to theamounts achievable using Semliki Forest virus-infected mammalian cells.36

Isolation of co-assembled Kv1.2/Kvb2complexes by sequentialaffinity chromatography

Most neuronal Kv Kþ channel complexes contain

both Kv and Kvb subunits.10 It is therefore of inter-est to isolate such complexes, as they represent theauthentic oligomers. As indicated above, cellstransformed with both Kv1.2(K)NP12 and Kvb2constructs produced both proteins. We thereforeplaced separate affinity sequences on each subunitso that we could isolate channels containing bothKv1.2 and Kvb2 proteins. Chromatography onNi-NTA was used as a first step to bind Kv1.2channels that contained an N-terminal poly-histidine tag. As expected, because of its highlevel of production relative to Kv1.2, a largeamount of Kvb2 subunit was visible in the break-through of the Ni-NTA column. However, Kvb2protein was detected in the eluate from thiscolumn, indicating its association with Kv1.2. Thestaining (Figure 6) of the triply mutatedKv1.2(K)NP12 protein used here was, consistentwith the earlier mutation analysis, much lessbroad than that observed for the purified wild-type Kv1.2 (Figure 5). The Ni-NTA eluate was

Table 1. Purification of Kv1.2 Kþ channel produced in P. pastoris

Volume(ml)

Total protein(mg)

Total [125I]a-DTXbinding activity

(pmol)Specific activity

(pmol/mg protein)Recovery

(%)Purification

(fold)

Crude soluble extract 150 2382 171000 72 100 1Ni-NTA breakthrough 150 1782 0 0 0 –Ni-NTA eluate 25 26.5 89600 3381 52 47

Figure 5. Purification of Kþ channels produced inP. pastoris. Kv1.2(K) protein bearing N-terminal polyhisti-dine and strepII sequences was purified as described inMaterials and Methods. Coomassie-stained gel of crudesoluble extract (Crude, 30 mg of protein loaded), break-through of the NI-NTA column (Ni-NTA BT, 30 mg ofprotein loaded), eluate from the Ni-NTA column(Ni-NTA eluate, 2 mg of protein loaded) and streptactin-agarose eluate (Strep eluate, 2 mg of protein loaded).

Figure 6. Purification of Kv1.2/Kvb2 containing Kþ

channel complexes. Membranes from cells co-producingKv1.2(NA12) protein with an N-terminal histidine tagand Kvb2 subunit bearing a StrepII tag at the N-terminalwere solubilised and subjected to chromatography onNi-NTA-Sepharose followed by streptactin-agarose.Fractions were separated by SDS-PAGE and stainedwith Coomassie brilliant blue R250. Crude, crude solubleextract (30 mg of protein loaded); NI-NTA BT, break-through of Ni-NTA column (30 mg of protein loaded);Ni-NTA eluate, eluate from the Ni-NTA column (2 mg ofprotein loaded); Strep. BT, breakthrough of streptactincolumn (2 mg of protein loaded); Strep. eluate, eluate ofthe streptactin column (3 mg).


then re-chromatographed on streptactin resin,which was specific for the StrepII tag on Kvb2 sub-units. Some Kv1.2 protein was found in the break-through of this column, which indicated thatthe association of the subunits is not complete.However, the eluate contains both proteins,which must therefore be associated. Theremoval of non-associated Kv1.2 subunit isillustrated by the greater proportion of Kvb2 inthe streptactin-agarose eluate. Thus, in additionto channels containing just the Kv1.2 subunitwe were able to isolated native-like oligomersthat could be used for electron microscopeanalysis.

Single-particle electron microscopy of purifiedKv1.2/Kvb2 K1 channels

When the isolated Kv1.2(K)NP12/Kvb2channels were examined by electron microscopyafter negative staining, many of the particlesadopted orientations that appeared as a roughlyoblong shape. In some cases, one end of the oblongcould be resolved into two stain-excluding regions.In order to improve the signal to noise ratio,approximately 4000 particle images were selectedfrom micrographs, and aligned by translationaland rotational cross-correlation techniques. Theaveraged overall structure (Figure 7A) is mirror-symmetric with the mirror axis parallel with thelong edge of the oblong. This is consistent withthe “side-on” projection of an object with even-

fold symmetry, in this case an octameric channelcontaining four Kv and four Kvb subunits. Theparticles with different views were then classifiedusing EMAN, with most of the classes (Figure 7B)being variations on the oblong theme. A clearclass with 4-fold symmetry was observed, whileno particle consistent with a top view of a 2-foldstructure was found. We therefore used EMAN tocalculate a volume in which the 4-fold character-istic of the channels was assumed. This initialmodel was then subjected to six refinement cyclesusing two completely different methods. In oneapproach, each image was aligned to the entire 3Dvolume using the Radon alignment methodsimplemented in SPIDER. In each cycle, the originalimages were aligned against the latest 3D modeland a new 3D volume produced. In the secondapproach, the volume was refined in EMAN byclassifying all the images against reprojections ofthe 3D model, and then constructing a new 3Dmodel using the realigned class averages. Whenrefinement was conducted without imposing4-fold symmetry (Figure 7C), the volume wasnoisier and less symmetric but still retained thegeneral 4-fold character, validating the initialassumption of C4 symmetry. The resolution of thefinal models was estimated by the Fourier shellcorrelation between two volumes composed ofhalf the data set with no imposed symmetry.39

Depending on the criteria chosen (Table 2) theresolution was found to be between 2.1 nm and2.5 nm.

Figure 7. Single-particle analysis of isolated Kv1.2/Kvb2 channels. A, Small area of a micrograph of a grid stainedwith 4% (w/v) ammonium molybdate. Protein is white against the dark background. Contrast is relatively low dueto the use of the deep-stain method. Inset, 2D average of particles after translational and rotational alignment. B, Pro-jections of the 3D reconstruction (upper panel) and their corresponding class averages (lower). C, Surface represen-tation of the 3D volumes. Upper panel, volume obtained using EMAN with C4 symmetry applied throughout.Middle panel, volume obtained after refinement using the Radon transform method in Spider with C4 symmetryimposed. Lower panel, volume refined as in the middle panel except no symmetry was applied at any stage of therefinement. All volumes are shown after six refinement rounds. D, Slices at 0.36 nm intervals through the volumeperpendicular to the presumed membrane plane starting from the top, membrane-spanning domain.


Structure of the channels determined byelectron microscopy

The single-particle 3D reconstructions(Figure 7C) may be divided into two cleardomains with an unresolved, tenuous connectionbetween them. The approximate dimensions of thedifferent parts of the volume are indicated and anestimated mass of 490 kDa was calculated bycounting full volume elements in the reconstruc-tion and assuming a protein density of 1.3 g/ml.This value is somewhat higher than the predictedmass of 390 kDa for the octameric complex, which

may be accounted for by significant detergentbinding to the protein.10 Using the Foldhunteralgorithm in EMAN, it was possible to unequivo-cally fit published T1/Kvb2 structure40 to thelarger of the two domains (Figure 8). Theexcellent correspondence obtained clearlyidentifies the large domain of the volume as theextramembrane, cytosolic portion of the channel.It was not possible to align the KCSA structure inthe same way, since its transmembrane portionwould represent only two of the six helices plusthe pore present in Kv channels. We thereforeplaced it manually in the opposite end of themolecule to the T1/b (Figure 8) with both terminiof KCSA oriented to the supposed cytoplasmicface. This identifies this region as the trans-membrane domain, but the present resolutiondoes not allow us to speculate on the arrangementsaround the selectivity filter and pore, nor to gleaninformation on the disposition of the S1–S4 helices.In fact, since KCSA extends slightly below thelower face of the transmembrane domain, itwould appear that some of the membrane-spanning region may be unresolved. An interestingpoint of our reconstructions is the distinctrotation of the membrane domain relative to the

Table 2. Resolution of single-particle reconstructions

0.5 FSCNoise

3 £ 5 £

Spider 2.5 2.1 2.2EMAN 2.3 1.5 2.2

Resolution determined using the Fourier shell correlation oftwo volumes generated from half the data set (no symmetry).Criteria used were FSC value of 0.5, or the point at which theFSC corresponded to three times or five times the noise corre-lation. Values are shown in nm.

Figure 8. Fitting of X-ray structures to the symmetrised EMAN volume. T1/b (pdb entry 1EXB, yellow) and KCSA(pdb entry 1BL8, green) were reduced to 1.5 nm resolution and aligned to the 3D volume using EMAN (T1/b) ormanually (KCSA). Left, single particle volume shown in red; middle, individual crystal structures; right, crystalstructures and volume shown in overlay using the program O.66


extramembrane domain. For unclear reasons, theamount of relative rotation appears slightlydifferent for the two volumes, possibly because inthe SPIDER volume the transmembrane is lesswell resolved and less symmetric. This displace-ment explains why in the 2D average and indi-vidual images only the putative extramembranedomain is resolvable into two densities. At themoment we cannot tell if this is a stable, consistentfeature of the Kþ channel structure or is due toflexibility in the unresolved linker region. Such adistinction requires a more elaborate analysisusing cryo-electron microscopy. After this workwas completed, a high-resolution structure of anarchaebacterial voltage-dependent Kþ channel(KVAP) was presented.41 This fascinating structurewas surprising as, aside from the pair surroundingthe pore, the membrane helices were found to be inpositions quite different from those predicted.Although we did not try to fit the KVAP structureto our volume, the pore of the channel is closelyhomologous to KCSA, which is shown above.

It is interesting to compare our reconstruction tothat reported by Sokolova et al.42 for the DrosophilaShaker Kþ channel protein in which Kvb subunitswere absent. The width determined for theDrosphila channel putative transmembrane domain(about 10 nm) is somewhat larger than in ourvolume. Although the Shaker a subunit is largerthan the rat homologue (74 kDa compared to57 kDa), this is due to extended intracellular Nand C termini, which would not be expected toaffect the dimensions of the extracellular/trans-membrane domain. It is likely therefore that thesize difference is due to differences in the amountand nature of the detergent bound as well as post-translational modifications. The Drosophila subunitis known to be glycosylated,27 whereas we haveused a glycosylation-deficient mutant for thesestudies. Significantly, their mass estimate of300 kDa for the transmembrane domain alone wasfar greater than the predicted mass for a tetramer.Sokolova et al. were also able to place the KCSAmodel into the structure and, like us, found asmall amount protruded from the bottom of thetransmembrane domain. In general, the membraneend of the Drosphila channel reconstruction wasslightly more symmetric than in our volumes andfurther, they were able to identify “windows”between it and the T1 domain (also identified byfitting of the crystal structure). Presumably, thewindows are formed by the linker regions, whichare unresolved in our structure. However, interest-ingly, they also noted a small rotation between theT1 and membrane domains, corresponding to thatobserved in our volume. Very recently, a low-resolution structure of Kþ channels isolated frombrain has been presented43 using similar methods.Despite the aforementioned potential for vari-ability due to detergent binding and post-translational modification, the two volumes arevery similar. This bodes well for higher-resolutionanalysis, where the ability to express a single Kv

subunit with the Kvb protein avoids potentialproblems caused by the known heterogeneity ofmammalian brain oligomers.11

Two-dimensional crystals of expressedK1 channels

The same Kv1.2(K)NP12/Kvb2 complex as usedfor single-particle analysis was employed for 2Dcrystallisation in lipid bilayers. When lipid dis-solved in DecM was used, relatively small crystals(Figure 9A) resulted. However, much largerarrays were apparent when Chapso was utilisedas the solubilising detergent (Figure 9A). Thelattice was square with unit cell dimensions of15.7 nm. Perhaps surprisingly for a crystal com-prising 4-fold symmetrical units, examination ofthe symmetry-derived phase residuals44 indicateda p121 crystallographic symmetry for the majorityof crystalline areas. This plane group is a glidereflection in which the symmetry-related elementsin the projected cell are mirrored and shifted byhalf a unit cell. Tetrameric particles are clearlyvisible in the projection map (Figure 9D), butappear slightly distorted. However, occasionallycrystals with p4 symmetry were observed inwhich the tetramers are much more clearlyresolved (Figure 10A). In these crystals, thehigher density “core” is surrounded by weaker“arms” that are the closest point of approachbetween molecules. The tetramers also display adistinct handedness (visible most clearly at theend of the arms) which is the same for all particles.This strongly indicates that all the channels areoriented in the same direction in the membrane.To compare the single-particle reconstruction tothe crystals, the putative membrane-spanning (a)and T1/Kvb (b) domains of the EMAN volumewere projected parallel with the membrane planeand overlaid on to the single-layer crystal map(Figure 10A). It is immediately apparent that thecore density in the crystal tetramer is smaller thanthe single-particle a projection. This would be con-sistent with the membrane-spanning domain beingwithin the lipid bilayer and inaccessible to thestain. However, since the map is a projection, it islikely that the core density consists of staining ofboth extracellular and intracellular parts of theprotein. The b single particle volume outline, onthe other hand, covers the whole of the crystaltetramer including the “arms”. This would there-fore suggest that the between tetramer contactsare mediated by the b subunits and that these con-tacts are the important ones for crystal formation.

The p4 crystals also help to explain the p121 sym-metry of the majority crystal form. If two unit celloutlines (one mirrored and shifted half a unit cellrelative to the other) are placed on top of the p121

lattice (Figure 10B), the tetramer positions corre-spond very well. This is consistent with the p121

crystals being composed of two layers of p4crystals in back-to-back orientation. However, wecannot determine whether the double-layer


crystals are formed de novo and the single layersare produced by their disassembly, or single-layercrystals form and then stack to produce doublelayers, or single-layer and double-layer crystalsare produced independently. In order to producethe p121 crystal type consistently, interactionsbetween layers are likely to be specific; however,they must be different from those that form crystalcontacts within single layers. This is in contrast tocases where formation of double layers is a prere-quisite for crystal formation.45

Summary

To date, only a handful of medium or high-resolution structures of polytypic membraneproteins from eukaryotes have been published. Ofthese, all have been relatively abundant proteins

purified from natural sources. Since the majorityof eukaryotic ion channels, receptors and trans-porters do not fall into this category, they must beoverexpressed in order to produce the milligramquantities required for structural analysis. How-ever, this is not a trivial task and may even be thecrucial bottleneck in a project aimed at obtaininghigh-resolution information. In the case ofeukaryotic Kþ channels, many attempts (for e.g.see Ref. 30) have been made at overexpression.Generally, they have successfully produced activechannels, but only rarely in sufficient quantity foreven 2D crystallisation. We have thereforeexpressed the genes for rat brain voltage-dependent Kþ channel subunits in P. pastoris. Aftermuch optimisation at each stage we have beenable to produce large quantities of protein. To testwhether the protein was in an active form, we

Figure 9. 2D crystals of expressed Kþ channels. A and B, Electron micrographs of negatively stained crystalsobtained using either DecM (A) or Chapso (B) to solubilise the added, exogenous lipid. C, Resolution of a singleimage of a 2D crystal after image processing. Squares represent spots in the Fourier transform with numbers indicatingquality on a scale of 1 (best) to 8 (worst). Rings indicate resolution bands of 3.0, 2.0, 1.5, 1.2 and 1.0 nm. D, Averagedprojection map of eight Chapso crystals after data merging and application of p121 symmetry; 2 £ 2 unit cells aredisplayed.


elected to use a toxin-binding assay. Unlikereconstitution followed by channel measurements,which may measure only a small fraction of thechannels, the toxin binding is quantitative. Thesemeasurements indicated that the protein isproduced in a native, active form. Importantly, thelevels obtained are 20–50 times greater than thatseen so far in any other system. After purificationof the channels we have performed single-particleelectron microscopy, which recapitulates the workdone on insect Kþ channels (containing insect Kvtype subunits only) expressed in COS cells and onnative mammalian Kþ channels, which waspublished while this manuscript was inpreparation. The fact that all the 3D reconstruc-tions are consistent suggests again that thechannels expressed in Pichia are a good substitutefor native protein. Our mutational analysisindicates that the protein is glycosylated on theloop between putative transmembrane segmentsS1 and S2. However, the recent KVAP structuresurprisingly places this sequence within the lipidbilayer. It may be that the protein is highly mobileduring voltage gating or even that the structurehas been distorted by the antibody against voltage-sensor that was required for 3D crystallisation.This would make a structure of a native channel,preferably in the native lipid environment, evenmore informative. To this end, we have been ableto prepare good-quality 2D crystals in lipidbilayers. The projection map obtained after imageprocessing indicates that the channels areassembled into the appropriate oligomers. Satisfy-ingly, we could use data from the single-particle

analysis to understand how the crystals areformed, while the crystal data allow us to be confi-dent in our assumptions used in single-particleprocessing. Currently, we are establishing appro-priate freezing conditions for cryo-electronmicroscopy so that we may obtain medium tohigh-resolution structures.

Materials and Methods

Escherichia coli strain Top10F0 (Invitrogen) was used forsub-cloning and propagation of recombinant plasmids.The protease-deficient P. pastoris strain SMD1163 (his4,pep4, prb) (Invitrogen) was used routinely for theexpression of recombinant Kþ channel subunit genes.a-DTX was purified from venom from the greenmamba, Dendroaspis angusticeps (J. Leakey, Kenya), andradiolabelled as described.35 Enzymes for molecularbiology were obtained from New England Biolabs orStratagene. The following detergents were used: Thesit(Boehringer Mannheim or Simec trade AG), Tween 20and Chapso (Calbiochem), DecM and DoDM (Glycon).Lipids were obtained from Avanti Polar Lipids Inc.(Alabaster, AL). Kv1.2 and Kvb2 cDNAs (EMBLaccession numbers X16003 and X76724, respectively)were generous gifts from Professor Olaf Pongs(Hamburg). Anti-Kv1.2 monoclonal antibody (cloneK14/16), reactive to residues 463–480, was obtainedform Upstate Biotechnology. Antibodies reactive withKvb2 protein were raised against the synthetic peptide,CSILGNKPYSKKDYRS corresponding to residues 353–367 plus an additional N-terminal cysteine residue thatwas used for coupling to Ultralink Iodoacetyl resin(Pierce Chemical Co.). This affinity support was used topurify anti-Kvb antibodies from crude sera using

Figure 10. A, Projection map calculated from a rare single-layer crystal; P4 symmetry is imposed Overlays show out-lines of projected single-particle volume: a, putative membrane-spanning domain; b, extramembrane region contain-ing Kvb2 subunit and the T1 domain. B, Comparison of p4 and p121 crystal types. 3 £ 3 unit cells of eight mergedimages of the p121 crystals are shown. The black outline shows five molecules from the p4 crystal. The shaded overlayis the black outline mirrored and shifted by half a unit cell.


standard procedures.46 DNA sequencing was performedby MWG Biotech. All other reagents were obtainedfrom Sigma Chemical Co. or Merck GmbH unless stated.

Manufacture of expression constructs andP. pastoris transformation

Polymerase chain reactions (PCR) employed eitherpfu I or the Taq Precision Plus system (Stratagene). AllDNA manipulations used standard methods.47 The openreading frame encoding the Kv1.2 protein was amplifiedfrom Kv1.2-pAKS by PCR (forward primer, F1: 50 TCCGGATCCCAAACCATGGCAGTGGCTACC30; reverseprimer, R1: 50 GTTGAATTCAGACGTCAGTTAACATTTTGG 30), introducing a 50 Bam HI restriction site and a30 Eco RI site. In addition, a Kozak consensus sequence(ACC ATG G, where ATG is the start codon) was incor-porated leading to the amino acid change T2A. After gelpurification and digestion with Eco RI and Bam HI, thePCR fragment was ligated into the similarly digestedpBluescript SKIIþ vector (Stratagene). Positive colonieswere screened by restriction analysis and sequencing toproduce Kv1.2 (K)-SKII.

The Quickchange (Stratagene) method was used tointroduce mutations into Kv1.2(K)-SKII by following themanufacturer’s protocol. The following mutations weremade:

(i) Kv1.2(K)N-SKII: N207Q to destroy the consensusN-glycosylation site between putative transmembranedomains S1 and S2.48

(ii) Kv1.2(K)NP1: double N207Q, S447A mutation.(iii) Kv12(K)NP12: triple N207Q, S447A, S449G

mutation.(iv) Kv12(K)NP123: quadruple N207Q, S447A,

S449G, S451A.(v) Kv12(K)NY132: double mutation N207Q,

Y132W.

These constructs were then sub-cloned into Bam HI/Eco RI-digested P. pastoris expression vector pPIC3.5K.All mutations were confirmed by DNA sequencing.

To aid purification, tag sequences were added to the 50

end of the Kv1.2 coding region, to yield the following Ntermini:

. MAH(9)D(4)KIVAT; Kv1.2NHE: histidine tagfollowed by an enterokinase cleavage site.

. MAWSHPQFEKH(9)D(4)KIVAT; Kv1.2SNHE:Strep II tag49 followed by histidine tag and entero-kinase cleavage site,

where the first Kv1.2 residues are indicated in bold.P. pastoris cells were transformed by electroporation

with 15–20 mg of Pme I linearized vectors, using con-ditions recommended by the manufacturer. After initialselection for Hisþ transformants, multicopy integrantswere selected by their resistance to increasing concen-trations of G418. Clones resistant to 0.2–1.0 mg/ml ofG418 were selected for further study.

The Kvb2 subunit gene was similarly cloned into theexpression vector, pPICZC (Invitrogen) and was sup-plemented with a 50 sequence encoding the Strep II tag50

to produce Kvb2NS, which contained an open readingframe beginning MAWSHPQFEKISYPE. The beginningof the Kvb2 sequence is indicated in bold type.

After Bst X1 linearization, this DNA was used to trans-form P. pastoris SMD1163 cells or cells already expressing

the Kv1.2(K)NP12-NHE construct. Selection for recombi-nants was achieved by testing for zeocin-resistance.

Induction of K1 channel production

Single colonies were grown overnight in MGY med-ium (0.34% (w/v) yeast nitrogen base, 1% (w/v)ammonium sulphate, 4 £ 1025% (w/v) biotin, 1% (w/v)glycerol) to an absorbance at 600 nm ðA600Þ of 2–6. Afterpelleting at 1500g for ten minutes, the cells wereresuspended to an A600 of 1.0 in MM (0.34% (w/v) yeastnitrogen base, 1% (w/v) ammonium sulphate,4 £ 1025% (w/v) biotin, 0.5% (v/v) methanol) andgrown for 24–48 hours at 30 8C. Additional methanolwas added after 24 hours to a final concentration of0.5% (v/v), in order to maintain inducing conditions.Large-scale cultures were performed in a 5 l fermenterusing a glycerol fed-batch strategy to accumulate bio-mass prior to induction with methanol,51 using sodiumhexametaphosphate as the phosphate source.52

P. pastoris membrane preparation

For small shake-flask culture volumes (up to 400 ml),cells were suspended in 0.05 M sodium phosphate (pH7.4), 1 mM EDTA, 5% (w/v) glycerol, 0.1 mg/ml of soy-bean trypsin inhibitor, 1 mM benzamidine and 0.1 mMPefabloc SC to an A600 of 50–100. After addition of anequal volume of ice-cold, acid-washed glass beads(0.25–0.5 mm diameter), the cells were broken by vortexmixing for eight 30 second bursts separated by 30 secondcooling on ice. Glass beads, unbroken cells and other celldebris were removed by centrifugation at 1500g for tenminutes and the pellet washed with an equal volume ofbuffer and recentrifuged. The combined supernatantswere then centrifuged at 50,000g for 30 minutes. Thecrude membrane pellet was resuspended in ice-coldwater and the protein content determined using the DCprotein assay (BioRad). Larger-scale preparation of mem-branes from fermentation cultures used a Microfluidiser.Cells (300–400 g of packed pellet) were suspended to25–35% wet weight in 50 mM Tris–HCl (pH 8.2) andprotease inhibitors as above. The cells were then passedfive times through a Microfluidiser model M-110L(Microfluidics Corp., Newton, MA) equipped with a110 mM interaction chamber and cooling coil, whichwere immersed in water at 4 8C. After centrifugation at1500g for ten minutes, the pellet was rehomogenisedand the supernatants combined. To precipitate the crudemembrane fraction, glycerol, polyethylene glycol(average molecular mass 4000) and NaCl were added tofinal concentrations of 10% (w/v), 10% (w/v) and0.1 M, respectively. After incubation on ice for15 minutes, the mixture was centrifuged at 12,000g for20 minutes. The pellet was washed once by resuspend-ing in water and centrifuging for one hour at 30,000g,prior to resuspension in ice-cold water and proteindetermination as above.

Purification of Kv1.2 K1 channels from P. pastoris

Membranes (100–250 ml) from cells expressingKv1.2SNHE constructs were detergent-solubilised asdetailed10 for brain membranes and the crude extractloaded (0.5–1 ml/minute) onto a 40 ml column of Ni-NTA resin (Qiagen) equilibrated with buffer A (25 mMimidazole, 100 mM KCl, 0.2% (w/v) Tween 80, pH 7.5).The column was then washed at 3 ml/minute with


150 ml of buffer A containing 1 M NaCl followed by100 ml of buffer A. To recover bound protein, the columnwas eluted at 0.5 ml/minute with buffer A containing300 mM imidazole. Fractions containing Kþ channels(determined by [125I]a-DTX binding or SDS-PAGE) werepooled and loaded at 0.5 ml/minute onto a 2 ml columnof streptactin-agarose (IBA GmbH, Germany). Thecolumn was subsequently washed with buffer S (20 mMTris–HCl (pH 8.0), 50 mM KCl, 0.02% (w/v) NaN3) con-taining either 0.1% (w/v) Tween 80 or DoDM, and theneluted at 0.25 ml/minute in the same buffer containing2.5 mM desthiobiotin. Protein in the collected fractionswas determined by the DC protein assay.

Measurement of [125I]a-DTX binding to membranesand soluble extracts

For routine measurements, membranes, crude solubleextracts (2 mg of protein) or purified Kþ channels(approximately 40 ng of protein) were incubated with3 nM [125I]a-DTX in 250 ml of 50 mM imidazole–HCl(pH 7.4), 90 mM NaCl, 5 mM KCl, 1 mM SrCl2, 0.02%(w/v) Triton X-100 (membranes) or 10 mM imidazole,20 mM KCl, 0.05% (w/v) Tween 80 (soluble channels) atroom temperature. After 30 minutes, a 200 ml aliquotwas applied to a GF/B glass-fibre disc (Whatman)soaked previously in 0.3% (w/v) polyethelynimine,53

which was then washed rapidly with two 5 ml portionsof ice-cold 25 mM imidazole–HCl (pH 7.4), 30 mM KCl.Bound ligand was quantified by determining the g-radi-ation level of the filter. Non-displaceable binding wasassessed by including a 100-fold excess of unlabelledtoxin. For determination of binding parameters, variousconcentrations of [125I]a-DTX were included in the reac-tion with or without 100-fold molar excess of unlabelleda-DTX for determination of non-specific binding. Incompetition experiments, membranes were incubatedwith 1 nM [125I]a-DTX, together with increasing concen-trations of unlabelled competing ligand. Data weretreated as detailed elsewhere.9,54

Single-particle electron microscopy

Purified Kþ channels were diluted to approximately30 mg/ml in buffer S containing 0.05% (w/v) Tween 80and applied to 400-mesh electron microscopy grids coatedwith a carbon film. The specimen was stained using adeep stain technique,55 with 4% (w/v) ammoniummolybdate. Images were collected under low-dose con-ditions in a Philips CM120 electron microscope operatingat 100 kV accelerating voltage and calibrated magnifi-cation of 58 600 £ ; defocus of the images ranged from1.0 to 1.8 mm underfocus. Micrographs were digitisedusing a SCAI scanner (Zeiss) with a final pixel size of21 mm (0.36 nm at the specimen level), particle imagesexcised interactively and contrast transfer correctionapplied as described by Radermacher et al.56 For align-ment, a first reference was created using a reference-free alignment procedure57 and then particle imageswere aligned to this reference three times by rotationaland translation cross-correlation methods.58 To produce3D reconstruction of the channel, the program EMAN59

was used to generate a first 3D volume. Initially, thedata set was searched for images that displayed C4 sym-metry. These data, combined with side on views wereused to generate a 4-fold symmetrised reference. Indi-vidual particle images were then realigned to the refer-ence volume using either Radon-transform alignment

methods60,61 implemented in the SPIDER62 image proces-sing system or to reprojections of the volume usingEMAN.

Two-dimensional crystallisation

Purified Kv1.2/Kvb2 Kþ channels were diluted to0.8 mg/ml in buffer S containing 0.1% DoDM, 20%(w/v) glycerol and 10 mM DTT. A 4:1 (w/w) mixture ofDMPC/brain polar lipids (Avanti), dissolved at 10 mg/ml of total lipid in either 5% (w/v) DecM or Chapsowas added to give a lipid to protein ratio of 0.4 (w/w).

After incubation at 4 8C the mixture was dialysed at37 8C against 10 mM Hepes (pH 6.8), 20 mM KCl, 10%(w/v) glycerol, 1 mM EDTA, 5 mM DTT for three to fivedays. For electron microscopy, 5 ml of dialysate wasapplied to a glow-discharged, carbon-coated electronmicroscope grid and stained three times with 7.5 mldrops of 1% (w/v) uranyl acetate solution. Images werecollected on a Philips CM120 microscope at 120 kV andthose that displayed optical diffraction were scanned ona SCAI scanner with a pixel size of 7 mm. Images werecorrected for contrast-transfer function, lattice distortionsand astigmatism using the MRC image processingpackage.63 – 65

Other methods

SDS-PAGE and Western blotting were carried out asdescribed.23 Rat brain cerebrocortical synaptosomalmembranes were prepared as described.35

Acknowledgements

We thank Werner Kuhlbrandt for continuedsupport and encouragement in this work, MichaelRadermacher for generous help on single-particleprocessing and particularly Radon transformmethods, and Teresa Ruiz for help with single-particle electron microscopy.

References

1. Hille, B. (1992). Ionic Channels in Excitable Membranes,Sinauer Associates, Sunderland, MA.

2. Jan, L. Y. & Jan, Y. N. (1997). Cloned potassiumchannels from eukaryotes and prokaryotes. Annu.Rev. Neurosci. 20, 91–123.

3. Pongs, O. (1992). Molecular biology of voltage-dependent potassium channels. Physiol. Rev. 72,S69–S89.

4. Salkoff, L. & Jegla, T. (1995). Surfing the DNA data-bases for Kþ channels nets yet more diversity.Neuron, 15, 489–492.

5. Doyle, D. A., Cabral, J. M., Pfutzner, R. A., Kuo, A. L.,Gulbis, J. M., Cohen, S. L. et al. (1998). The structureof the potassium channel—molecular-basis of Kþ

conduction and selectivity. Science, 280, 69–77.6. Schrempf, H., Schmidt, O., Kummerlen, R., Hinnah,

S., Muller, D., Betzler, M. et al. (1995). A prokaryoticpotassium ion channel with two predicted trans-membrane segments from Streptomyces lividans.EMBO J. 14, 5170–5178.

7. Minor, D. L., Masseling, S. J., Jan, Y. N. & Jan, L. Y.


(1999). Transmembrane structure of an inwardlyrectifying potassium channel. Cell, 96, 879–891.

8. Rehm, H. & Lazdunski, M. (1988). Purification andsubunit structure of a putative Kþ-channel proteinidentified by its binding-properties for dendrotoxin-I. Proc. Natl Acad. Sci. USA, 85, 4919–4923.

9. Parcej, D. N. & Dolly, J. O. (1989). Dendrotoxinacceptor from bovine synaptic plasma-membranes—binding-properties, purification and subunitcomposition of a putative constituent of certainvoltage-activated Kþ channels. Biochem. J. 257,899–903.

10. Parcej, D. N., Scott, V. E. S. & Dolly, J. O. (1992).Oligomeric properties of alpha-dendrotoxin-sensi-tive potassium-ion channels purified from bovinebrain. Biochemistry, 31, 11084–11088.

11. Shamotienko, O. G., Parcej, D. N. & Dolly, J. O.(1997). Subunit combinations defined for Kþ channelKv1 subtypes in synaptic membranes from bovinebrain. Biochemistry, 36, 8195–8201.

12. Scott, V. E. S., Rettig, J., Parcej, D. N., Keen, J. N.,Findlay, J. B. C., Pongs, O. & Dolly, J. O. (1994).Primary structure of a beta-subunit of alpha-dendro-toxin-sensitive Kþ channels from bovine brain. Proc.Natl Acad. Sci. USA, 91, 1637–10641.

13. Rettig, J., Heinemann, S. H., Wunder, F., Lorra, C.,Parcej, D. N., Dolly, J. O. & Pongs, O. (1994). Inacti-vation properties of voltage-gated Kþ channelsaltered by presence of beta-subunit. Nature, 369,289–294.

14. Shi, G. Y., Nakahira, K., Hammond, S., Rhodes, K. J.,Schechter, L. E. & Trimmer, J. S. (1996). Beta-subunitspromote K þ channel surface expression througheffects early in biosynthesis. Neuron, 16, 843–852.

15. Nagaya, N. & Papazian, D. M. (1997). Potassiumchannel alpha and beta subunits assemble in theendoplasmic reticulum. J. Biol. Chem. 272, 3022–3027.

16. McIntosh, P., Southan, A. P., Akhtar, S., Sidera, C.,Ushkaryov, Y., Dolby, J. O. & Robertson, B. (1997).Modification of rat brain Kv1.4 channel gating byassociation with accessory Kvbeta1.1 and beta2.1subunits. Pflugers Arch. 435, 43–54.

17. Kreusch, A., Pfaffinger, P. J., Stevens, C. F. & Choe, S.(1998). Crystal-structure of the tetramerizationdomain of the shaker potassium channel. Nature,392, 945–948.

18. Gulbis, J. M., Mann, S. & MacKinnon, R. (1999).Structure of a voltage-dependent Kþ channel betasubunit. Cell, 97, 943–952.

19. Sun, T. Y., Naini, A. A. & Miller, C. (1994). High-levelexpression and functional reconstitution of shakerKþ channels. Biochemistry, 33, 9992–9999.

20. Li, M., Unwin, N., Stauffer, K. A., Jan, Y. N. & Jan,L. Y. (1994). Images of purified shaker potassiumchannels. Curr. Biol. 4, 110–115.

21. Spencer, R. H., Sokolov, Y., Li, H. L., Takenaka, B.,Milici, A. J., Aiyar, J. et al. (1997). Purification,visualization, and biophysical characterization ofKv1.3 tetramers. J. Biol. Chem. 272, 2389–2395.

22. Wang, H., Kunkel, D. D., Martin, T. M.,Schwartzkroin, P. A. & Tempel, B. L. (1993). Hetero-multimeric Kþ channels in terminal and juxta-paranodal regions of neurons. Nature, 365, 75–79.

23. Muniz, Z. M., Parcej, D. N. & Dolly, J. O. (1992).Characterization of monoclonal antibodies againstvoltage-dependent Kþ channels raised using alpha-dendrotoxin acceptors purified from bovine brain.Biochemistry, 31, 12297–12303.

24. Huang, X. Y., Morielli, A. D. & Peralta, E. G. (1993).

Tyrosine kinase-dependent suppression of apotassium channel by the G protein-coupled m1muscarinic acetylcholine receptor. Cell, 75,1145–1156.

25. Levin, G., Keren, T., Peretz, T., Chikvashvili, D.,Thornhill, W. B. & Lotan, I. (1995). Regulation ofRCK1 currents with a cAMP analog via enhancedprotein synthesis and direct channel phosphoryl-ation. J. Biol. Chem. 270, 14611–14618.

26. Rehm, H., Pelzer, S., Cochet, C., Chambaz, E.,Tempel, B. L., Trautwein, W. et al. (1989). Dendro-toxin-binding brain membrane protein displays aKþ channel activity that is stimulated by bothcAMP-dependent and endogenous phosphoryl-ations. Biochemistry, 28, 6455–6460.

27. Santacruz-Toloza, L., Huang, Y., John, S. A. &Papazian, D. M. (1994). Glycosylation of shaker pot-assium channel protein in insect cell culture and inXenopus oocytes. Biochemistry, 33, 5607–5613.

28. Kennelly, P. J. & Krebs, E. G. (1991). Consensussequences as substrate specificity determinants forprotein kinases and protein phosphatases. J. Biol.Chem. 266, 15555–15558.

29. Tate, C. G., Haase, J., Baker, C., Boorsma, M.,Magnani, F., Vallis, V. & Williams, D. C. (2003). Com-parison of seven different heterologous proteinexpression systems for the production of the sero-tonin transporter. Biochim. Biophys. Acta, 1610,141–153.

30. Klaiber, K., Williams, N., Roberts, T. M., Papazian,D. M., Jan, L. Y. & Miller, C. (1990). Functionalexpression of Shaker Kþ channels in a baculovirus-infected insect cell line. Neuron, 5, 221–226.

31. Grissmer, S., Nguyen, A. N., Aiyar, J., Hanson, D. C.,Mather, R. J., Gutman, G. A. et al. (1994). Pharmaco-logical characterization of five cloned voltage-gatedKþ channels, types Kv1.1, 1.2, 1.3, 1.5, and 3.1, stablyexpressed in mammalian cell lines. Mol. Pharmacol.45, 1227–1234.

32. Hopkins, W. F. (1998). Toxin and subunit specificityof blocking affinity of 3 peptide toxins for hetero-multimeric, voltage-gated potassium channelsexpressed in Xenopus oocytes. J. Pharmacol. ExptlTher. 285, 1051–1060.

33. Imredy, J. P. & Mackinnon, R. (1998). Mapping of adendrotoxin binding-site—determination of toxinresidues affecting affinity to romk1 potassiumchannel. Biophys. J. 74, 86.

34. Tytgat, J., Debont, T., Carmeliet, E. & Daenens, P.(1995). The alpha-dendrotoxin footprint on amammalian potassium channel. J. Biol. Chem. 270,24776–24781.

35. Black, A. R., Breeze, A. L., Othman, I. B. & Dolly, J. O.(1986). Involvement of neuronal acceptors fordendrotoxin in its convulsive action in rat brain.Biochem. J. 237, 397–404.

36. Shamotienko, O., Akhtar, S., Sidera, C., Meunier,F. A., Ink, B., Weir, M. & Dolly, J. O. (1999).Recreation of neuronal Kv1 channel oligomers byexpression in mammalian cells using Semliki Forestvirus. Biochemistry, 38, 16766–16776.

37. Harvey, A. L., Marshall, D. L., De-Allie, F. A. &Strong, P. N. (1989). Interactions between dendro-toxin, a blocker of voltage-dependent potassiumchannels, and charybdotoxin, a blocker of calcium-activated potassium channels, at binding sites onneuronal membranes. Biochem. Biophys. Res. Commun.163, 394–397.

38. Scott, V. E. S., Parcej, D. N., Keen, J. N., Findlay, J. B.


C. & Dolly, J. O. (1990). Alpha-dendrotoxin acceptorfrom bovine brain as a Kþ channel protein—evidencefrom the N-terminal sequence of its larger subunit.J. Biol. Chem. 265, 20094–20097.

39. Ruiz, T., Kopperschlager, G. & Radermacher, M.(2001). The first three-dimensional structure ofphosphofructokinase from Saccharomyces cerevisiaedetermined by electron microscopy of singleparticles. J. Struct. Biol. 136, 167–180.

40. Gulbis, J. M., Zhou, M., Mann, S. & MacKinnon, R.(2000). Structure of the cytoplasmic beta subunit-T1assembly of voltage-dependent Kþ channels. Science,289, 123–127.

41. Jiang, Y., Lee, A., Chen, J., Ruta, V., Cadene, M.,Chait, B. T. & Mackinnon, R. (2003). X-ray structureof a voltage-dependent Kþ channel. Nature, 423,33–41.

42. Sokolova, O., Kolmakova-Partensky, L. & Grigorieff,N. (2001). Three-dimensional structure of a voltage-gated potassium channel at 2.5 nm resolution.Structure, 9, 215–220.

43. Orlova, E. V., Papakosta, M., Booy, F. P., van Heel, M.& Dolly, J. O. (2003). Voltage-gated Kþ channel frommammalian brain: 3D structure at 18 A of the com-plete (a)4(b)4 complex. J. Mol. Biol. 326, 1005–1012.

44. Valpuesta, J. M., Carrascosa, J. L. & Henderson, R.(1999). Analysis of electron microscope images andelectron diffraction patterns of thin crystals of phi 29connectors in ice. J. Mol. Biol. 240, 281–287.

45. Breyton, C., Haase, W., Rapoport, T. A., Kuhlbrandt,W. & Collinson, I. R. (2002). Three-dimensional struc-ture of SecYEG, the bacterial protein translocationcore complex. Nature, 418, 662–665.

46. Harlow, E. & Lane, D. (1988). Antibodies: A LaboratoryManual, Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY.

47. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989).Molecular Cloning: A Laboratory Manual, Cold SpringHarbor Laboratory Press, Cold Spring Harbor, NY.

48. Santacruz-Toloza, L., Perozo, E. & Papazian, D. M.(1994). Purification and reconstitution of functionalShaker Kþ channels assayed with a light-drivenvoltage-control system. Biochemistry, 33, 1295–1299.

49. Schmidt, T. G. M., Kopke, J., Frank, R. & Skerra, A.(1996). Molecular interaction between the Strep tagaffinity peptide and its cognate target streptavidin.J. Mol. Biol. 225, 753–776.

50. Skerra, A. & Schmidt, T. (2000). Use of the Strep-Tagand streptavidin for detection and purification ofrecombinant proteins. Methods Enzymol. 326,271–304.

51. Stratton, J., Chiruvolu, V. & Meagher, M. (1998). Highcell-density fermentation. Methods Mol. Biol. 103,107–120.

52. Curless, C., Baclaski, J. & Sachdev, R. (1996). Phos-phate glass as a phosphate source in high cell densityEscherichia coli fermentations. Biotechnol. Prog. 12,22–25.

53. Bruns, R. F., Lawson-Wendling, K. & Pugsley, T. A.(1983). A rapid filtration assay for soluble receptors

using polyethylenimine-treated filters. Anal. Biochem.132, 74–81.

54. Wang, F. C., Bell, N., Reid, P., Smith, L. A., McIntosh,P., Robertson, B. & Dolly, J. O. (1999). Identification ofresidues in dendrotoxin K responsible for its dis-crimination between neuronal Kþ channels contain-ing Kv1.1 and 1.2 alpha subunits. Eur. J. Biochem.263, 222–229.

55. Stoops, J. K., Schroeter, J. P., Bretaudiere, J. P., Olson,N. H., Baker, T. S. & Strickland, D. K. (1991). Struc-tural studies of human alpha 2-macroglobulin: con-cordance between projected views obtained bynegative-stain and cryoelectron microscopy. J. Struct.Biol. 106, 172–178.

56. Radermacher, M., Ruiz, T., Wieczorek, H. & Gruber,G. (2001). The structure of the V1-ATPase deter-mined by three-dimensional electron microscopy ofsingle particles. J. Struct. Biol. 135, 26–37.

57. Marco, S., Chagoyen, M., de la Fraga, L. G., Carazo,J. M. & Carrascosa, J. L. (1996). A variant to the ran-dom approximation of the reference free alignmentalgorithm. Ultramicroscopy, 66, 5–10.

58. Frank, J., Radermacher, M., Wagenknecht, T. &Verschoor, A. (1988). Studying ribosome structureby electron microscopy and computer-image proces-sing. Methods Enzymol. 164, 3–35.

59. Ludtke, S. J., Baldwin, P. R. & Chiu, W. (1999).EMAN: semiautomated software for high-resolutionsingle-particle reconstructions. J. Struct. Biol. 128,82–97.

60. Radermacher, M. (1994). Three-dimensional recon-struction from random projections: orientationalalignment via Radon transforms. Ultramicroscopy, 53,121–136.

61. Lanzavecchia, S., Bellon, P. L. & Radermacher, M.(1999). Fast and accurate three-dimensional recon-struction from projections with random orientationsvia Radon transforms. J. Struct. Biol. 128, 152–164.

62. Frank, J., Radermacher, M., Penczek, P., Zhu, J., Li, Y.,Ladjadj, M. & Leith, A. (1996). SPIDER and WEB:processing and visualization of images in 3D electronmicroscopy and related fields. J. Struct. Biol. 116,190–199.

63. Crowther, R. A., Henderson, R. & Smith, J. M. (1996).MRC image processing programs. J. Struct. Biol. 116,9–16.

64. Henderson, R., Baldwin, J. M., Ceska, T. A., Zemlin,F., Beckmann, E. & Downing, K. H. (1990). Modelfor the structure of bacteriorhodopsin based onhigh-resolution electron cryo-microscopy. J. Mol.Biol. 213, 899–929.

65. Grigorieff, N. (1998). NADH:ubiquinone oxidoreduc-tase (complex I) at 22 A in ice. J. Mol. Biol. 277,1033–1046.

66. Jones, T. A., Zou, J.-Y., Cowan, S. W. & Kjeldgaard,M. (1991). Improved methods for building proteinmodels in electron density maps and the location oferrors in these models. Acta Crystallog. sect. A, 47,110–119.

Edited by G. von Heijne

(Received 17 June 2003; received in revised form 30 July 2003; accepted 31 July 2003)


Structural Characterisation of Neuronal Voltage-sensitive K+ ...

Documents

Transcript of Structural Characterisation of Neuronal Voltage-sensitive K+ ...