static-content.springer.com10.1007... · Web viewYellow arrows represent the binding direction of...

9
Supplementary Data CRISPR/Cas9 mediated somatic and germline gene correction to restore hemostasis of hemophilia B mouse Cong Huai 1* , Ph.D.; Chenqiang Jia 1* , M.S.; Ruilin Sun 2 , Ph.D.; Peipei Xu 1 , B.S.; Taishan Min 1 , B.S.; Qihan Wang 1 , M.S.; Chengde Zheng 1 , M.S.; Hongyan Chen 1† , Ph.D. & Daru Lu 1† , Ph.D. 1 Key Laboratory of Genetic Engineering, MOE Key Laboratory of Contemporary Anthropology, Fudan University School of Life Sciences, Shanghai 200438, China 2 Shanghai Research Center for Model Organisms, Shanghai 201210, China * These authors contribute equally to this work Correspondence and requests for materials should be addressed to Prof. Daru Lu. Address: Room C613, Building for School of Life Sciences, Fudan University, No. 2005 Songhu Rd, Shanghai, China Telephone/Fax: 86-21-51630619 Email: [email protected]

Transcript of static-content.springer.com10.1007... · Web viewYellow arrows represent the binding direction of...

Supplementary Data

CRISPR/Cas9 mediated somatic and germline gene correction to restore

hemostasis of hemophilia B mouse

Cong Huai1*, Ph.D.; Chenqiang Jia1*, M.S.; Ruilin Sun2, Ph.D.; Peipei Xu1, B.S.; Taishan

Min1, B.S.; Qihan Wang1, M.S.; Chengde Zheng1, M.S.; Hongyan Chen1†, Ph.D. & Daru

Lu1†, Ph.D.

1 Key Laboratory of Genetic Engineering, MOE Key Laboratory of Contemporary

Anthropology, Fudan University School of Life Sciences, Shanghai 200438, China

2 Shanghai Research Center for Model Organisms, Shanghai 201210, China

* These authors contribute equally to this work

Correspondence and requests for materials should be addressed to Prof. Daru Lu.

Address: Room C613, Building for School of Life Sciences, Fudan University, No. 2005

Songhu Rd, Shanghai, China

Telephone/Fax: 86-21-51630619

Email: [email protected]

Supplementary Fig. 1 All three sgRNAs used in HTV treatment are effective in

DNA binding and cleavage

a Schematic diagram shows the relative location of the absent DNA (red line) and

sgRNA binding sites. Yellow arrows represent the binding direction of each sgRNA,

pink boxes represent the PAM region. b In vitro DNA cleavage activity of each

sgRNA by RGEN assay. M, DNA ladder. c T7E1 assay performed on genome DNA

extracted from Cas9-sgRNA transfected 293T cells. The frequency of Cas9-induced

indels is indicated as a “%” below each lane.

Supplementary Fig. 2 In vivo gene correction of adult HB mice through

hydrodynamics-based DNA transfection of Cas9 components

a Detection resolution of unlabeled probe by high-resolution melting analysis. b-c

Normalized melting peak of unlabeled probe hybridization performed on hepatic

cDNA obtained from HR1 or HR2 sgRNA-treated mice. d Amplified fragment length

polymorphism assay performed on hepatic cDNA obtained from mice treated as

indicated.

Supplementary Fig. 3 Detection of off-target gene-editing

a Sequence and location of the top 5 potential off-target binding sites of HR3 sgRNA.

The difference between the HR3 binding sequence and the off-target sequence is

highlighted by bold and boxed font. b HRMA of the five potential off-target sites

performed on the microinjected embryos. c Concentration and activity in plasma of

mice treated as indicated.

Supplementary Table 1 Primers used for F9 amplification, real-time PCR and off-

target detection

Primer name Sequence (5’ – 3’)

F9LF CAGTGAAGCCAACCAGACTG

F9LR CAGTTGACGTACCGGGAAAC

F9SF GGAGACAGGCTTCCATTCTTC

F9SR TTCACCCCAGCTAATAATGC

F9 qPCR F TTGAGGCATTCTGTGGAGGT

F9 qPCR R CCAGCAAGGCAATGTCATGA

mActb qPCR F AGTGTGACGTTGACATCCGT

mActb qPCR R GCAGCTCAGTAACAGTCCGC

Unlabeled probe GATCCTTCACACGAATCTTTGCCTCCGG

Hybri-probe DIG-CCACTATCTCCTTCACACGAAT

OFT1-F TCGGTCAACTGTTTACCACTG

OFT1-R GTGGGGCAGGTAGGAGAAAT

OFT2-F CAAACGTAGGCTGAGCACTG

OFT2-R CTTGACCGAGCCTTCCAAAG

OFT3-F GCATGGGTTCAGAGGGCATA

OFT3-R CTGTCCCAGCTCTCTAACCC

OFT4-F AGACTAAACTACAGACACCACGA

OFT4-R GTTCCCTTTTGCCTTGGTGA

OFT5-F CTCCTGACTGAGTTGGGAAC

OFT5-R AGACCCTTGCTTCCTCGTAG

Supplementary Table 2 Treatment effect of Cas9 mediate germline gene therapy

(Based on tail DNA form born mice)

Bornrate

DNA correctionEfficiency

Effective Treatment

Gene Rpaired Sampleshomozygot

e/hemizygote

hetero-zygote

mosaic

mRNA11.7%

(6)36.1%

66.7%(4)

0 0 100%

Cas9-wt41.6%(17)

59.2%82.4%(14)

42.8%(6)

21.4%(3)

35.7%(5)

Cas9-wt, wild type SpCas9 protein. Cas9-HF, high-fidelity SpCas9 protein. All

embryos that can detected to carry corrected gene by Sanger sequencing is signed as

“Gene Repaired Samples”. The treatment effective rate is determined by hemostasis

of born mice. The amount of each type of mice is label in brackets.