Staphylococcal enterotoxin B (SEB ) - induced microRNA...
Transcript of Staphylococcal enterotoxin B (SEB ) - induced microRNA...
![Page 1: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/1.jpg)
1
Staphylococcal enterotoxin B (SEB) - induced microRNA-155 targets suppressor of cytokine signaling-1
1 (SOCS1) to promote acute inflammatory lung injury. 2
3
Roshni Rao*, Prakash Nagarkatti* and Mitzi Nagarkatti*# 4
*Department of Pathology, Microbiology, and Immunology, University of South Carolina School of 5
Medicine 6
7
8
#Address correspondence to: Mitzi Nagarkatti, [email protected] 9
10
Running Title: SEB-induced miR-155 promotes inflammatory ALI 11
12
13
14
15
16
17
18
IAI Accepts, published online ahead of print on 28 April 2014Infect. Immun. doi:10.1128/IAI.01666-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 2: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/2.jpg)
2
ABSTRACT 19
Staphylococcal enterotoxin B (SEB) causes food poisoning in humans. It is considered a biological 20
weapon, and inhalation can trigger lung injury and sometimes respiratory failure. Being a superantigen, 21
SEB initiates an exaggerated inflammatory response. While the role of microRNAs (miR) in immune 22
cell activation is getting increasing recognition, their role in the regulation of inflammatory disease 23
induced by SEB has not been studied. In this investigation, we demonstrate that exposure to SEB by 24
inhalation results in acute inflammatory lung injury accompanied by altered miR expression profile in 25
lung infiltrating cells. Amongst the miRs that were significantly elevated, miR-155 was the most over-26
expressed. Interestingly, miR-155-/- mice were protected from SEB-mediated inflammation and lung 27
injury. Further studies revealed a functional link between SEB-induced miR-155 and pro-inflammatory 28
cytokine IFN-γ. Through the use of bioinformatics tools, suppressor of cytokine signaling -1 (SOCS1), a 29
negative regulator of IFN-γ, was identified as a potential target of miR-155. While miR-155-/-mice 30
displayed increased Socs1, the overexpression of miR-155 led to its suppression, thereby enhancing 31
IFN-γ levels. Additionally, the inhibition of miR-155 resulted in restored Socs1expression. Together, our 32
data demonstrate an important role for miR-155 in promoting SEB-mediated inflammation in the lungs 33
through Socs1 activation, and suggest that miR-155 may be an important target in preventing SEB-34
mediated inflammation and tissue injury. 35
36
37
38
39
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 3: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/3.jpg)
3
INTRODUCTION 40
Staphylococcal Enterotoxin B (SEB), a superantigen produced by Staphylococcus aureus has 41
deleterious effects in humans such as food poisoning (1) and toxic shock (2). Because it can be easily 42
aerosolized, SEB is classified as a Category B agent by the Centers for Disease Control and Prevention 43
(3). Upon inhalation exposure, SEB can trigger acute inflammatory lung injury characterized by immune 44
cell infiltration, excessive cytokine production, tissue damage and pulmonary edema (4, 5). 45
Due to the distinct manner in which SEB binds to the non-polymorphic regions of MHC II on 46
antigen presenting cells and the specific Vβ regions of the T-cell receptor (TCR) such as murine Vβ8 47
(6), SEB exposure leads to the activation and proliferation of a large population (5-30%) of T-48
lymphocytes (7). Activation of such a substantial number of T-lymphocytes results in the robust 49
production of inflammatory cytokines such as IL-2, TNF-α and IFN-γ (8, 9). In most cases, IFN-γ is the 50
main culprit in mediating the damaging and often lethal effects seen upon SEB exposure. For example, 51
transgenic mice deficient in IFN-γ, were protected from SEB-mediated Toxic Shock Syndrome (TSS) 52
and subsequent mortality(10). Additionally, the neutralization of IFN-γ, after SEB exposure was shown 53
to prevent lethal systemic inflammation (11) further suggesting the importance of SEB-mediated IFN-γ 54
production. While the interaction between SEB and TCR, along with the subsequent T-cell proliferation 55
and cytokine secretion have been extensively studied (12-14), the role of miRNA in mediating SEB-56
induced inflammation has not yet been elucidated. 57
MicroRNA (miR) are ~21-23 nt long, single stranded non-coding RNA molecules that can 58
translationally repress or target mRNA for degradation, thereby acting as primary modulators of gene 59
expression (15). Several studies have demonstrated a role for miR in modulating immune responses 60
under various inflammatory conditions (16). For example, while miR-125b is highly expressed in naïve 61
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 4: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/4.jpg)
4
CD4+ T-cells, it becomes significantly downregulated upon T-cell activation (17). Similarly, studies 62
have demonstrated that overexpression of miR-17-92 cluster in T-cells leads to lymphoproliferative 63
disorder due to the repression of the pro-apoptotic molecule, BIM (18). Furthermore, mice deficient in 64
miR-155 are resistant to developing experimental autoimmune encephalomyeltis, a mouse model of 65
multiple sclerosis (19), while the overexpression of miR-155 exacerbates the symptoms associated with 66
the disease. Taken together, these studies strongly suggest that miRs play a major role in modulating 67
immune cell activation, particularly T-cells, as well as promoting pro-inflammatory responses. 68
In the current study of SEB-induced acute inflammatory lung injury, we applied microarray 69
analysis and quantitative real time PCR (q-RT PCR) to establish important miRs that are dysregulated in 70
response to SEB. Further, our data identified miR-155 as a major contributor to SEB-mediated lung 71
inflammation. While it is known that SEB exposure leads to inflammation and the production of copious 72
amounts of IFN-γ, we provide mechanistic insight through gain and loss of function experiments, into 73
the role of miR-155 in this process. Our results may present an opportunity to further therapeutically 74
target miR-155 in the treatment of SEB-mediated acute inflammatory lung injury. 75
76
MATERIALS AND METHODS 77
Mice 78
Female C57BL/6 mice (6-8 weeks) were purchased from the National Cancer Institute (NCI). miR-155-/- 79
(B6.Cg-Mir155 tm1.1 Rsky/J) were purchased from The Jackson laboratory. All mice were housed under 80
pathogen free conditions at the Animal Resource Facility (ARF), University of South Carolina (USC) 81
School of Medicine. The use of vertebrate animals in the experiments performed was pre-approved by 82
the Institutional Animal Care and Use Committee (IACUC) at USC. This study was carried out in strict 83
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 5: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/5.jpg)
5
accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the 84
National Research Council (20) 85
Induction of SEB-induced acute lung injury (ALI) 86
SEB was obtained from Toxin Technologies (Sarasota, Florida). SEB dissolved in sterile PBS (2 87
mg/mL) was administered by the intranasal (i.n) route in a volume of 25 μL for a dose of 50 μg per 88
mouse, as described (4, 21, 22) . Mice were euthanized 48 hours after SEB exposure. 89
Lung histopathological analysis 90
At the time of euthanasia, lungs were obtained and fixed in 10% formalin. The tissue was then paraffin 91
embedded and serial sections (5 μm) were made. The sections were subsequently deparaffinized by 92
dissolving with xylene, followed by rehydration in several changes of alcohol (100%, 95%, and 90%). 93
The slides were then stained with hematoxylin and eosin (H&E) and evaluated with a Nikon E600 light 94
microscopy system. 95
Antibodies 96
Fluorescein isothiocyanate-conjugated anti-CD8 (clone: 53.6.7) and phycoerythrin-conjugated anti-CD4 97
(clone: GK1.5) Abs were purchased from Biolegend (San Diego, CA). 98
Preparation of lung-infiltrating cells and flow cytometry 99
Mice were exposed to SEB as described above. Forty eight hours after SEB exposure, lungs were 100
harvested and homogenized using Stomacher® 80 Biomaster blender from Seward (Davie, FL) in 10 ml 101
of sterile PBS. After washing with sterile PBS, the cells were carefully layered on Ficoll - Histopaque 102
®-1077 from Sigma-Aldrich (St Louis, MO) and separated by density gradient centrifugation at 500 x g 103
for 30 minutes at 24°C with brake off. The mononuclear cell layer isolated was then enumerated using 104
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 6: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/6.jpg)
6
the Trypan blue exclusion method. To determine the subsets of immune cells infiltrating the lung, cells 105
were stained with fluorescent conjugated antibodies (anti-CD4, anti-CD8) and analyzed using the 106
Beckman Coulter 500 Flow cytometer (Indianapolis, IN). 107
Recovery of broncheoalveloar lavage fluid (BALF) and cytokine detection 108
Forty eight hours after SEB exposure, mice were euthanized and tracheae from vehicle or THC-treated 109
mice were tied with a suture and the lung was excised as an intact unit. With 1 ml sterile ice-cold PBS, 110
the trachea was lavaged to collect the BALF fluid. Cytokine analysis for interferon-γ (IFN-γ) was 111
carried out using BALF. All cytokines were measured using Biolegend (San Diego, CA) ELISA 112
MAX™ Standard kits. 113
Total RNA isolation 114
Total RNA (including small RNAs) was isolated from lung-infiltrating mononuclear cells or in vitro 115
from lymph nodes or splenocytes using miRNeasy kit from Qiagen (Valencia, CA) following 116
manufacturer’s instructions. The purity and concentration of the RNA was confirmed 117
spectrophotometrically, while the integrity of miRNA was further assessed using Agilent 2100 118
BioAnalyzer (Agilent Tech, Palo Alto, CA). 119
miRNA expression profiling and analysis 120
To profile miRNA expression in the lung, the Affymetrix GeneChip ® miRNA 1.0 array platform was 121
used. The array which comprises of 609 mouse miRNA probes makes use of FlashTag™ Biotin HSR 122
hybridization technique and was carried out according to manufacturer’s instructions (Affymetrix, Santa 123
Clara, CA). Fluorescent intensities obtained from hybridization were log-transformed and visualized in 124
the form of a heatmap. Hierarchical clustering was carried out using Ward’s method and Similarity 125
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 7: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/7.jpg)
7
measurement was calculated using half square Euclidean distance. miRNA expression fold change 126
obtained from the microarray were then further analyzed using the commercially available analysis tool 127
Ingenuity Systems®-Ingenuity Pathway analysis –(IPA), (Mountain View, CA, USA.) In brief, the 128
dataset of 609 miRNA were uploaded into IPA and only miRNA that were 3 fold or higher were 129
considered for analysis. Core analysis was carried out and a ‘Top Network’ of miRNA and its associated 130
molecules was generated. All microRNA microarray data were deposited in ArrayExpress database 131
(www.ebi.ac.uk/arrayexpress) under accession number E-MTAB-2379. 132
Analysis of miRNA target genes 133
IPA was also used to determine and collate the highly predicted, moderately predicted and 134
experimentally observed mRNA target genes of those miRNA that were highly (≥3 fold) upregulated 135
using IPA’s miRNA target filter tool. These targets were further sorted based on their role in cytokine 136
signaling, cellular growth and proliferation and cellular immune response. Additionally, to assign 137
Immunological functions to our list of miRNA targets, Gene Ontology (GO) mapping of miRNA target 138
genes was carried out using Cytoscape 3.0.1 equipped with ClueGO and CluePedia applications. 139
Quantitative real-time PCR (qRT-PCR) 140
Total RNA (miRNA and mRNA) were converted to cDNA using the miScript cDNA synthesis kit 141
(Qiagen) according to manufacturer’s instructions. For miRNA validation, the miScript SYBR Green 142
PCR kit (Qiagen) was used and fold change of miRNA was determined using 2-ΔΔCt method. Snord 96a 143
was used as small RNA endogenous control. For mRNA validation, SSO advanced™ SYBR Green 144
PCR kit from Biorad (Hercules, CA) was used according to manufacturer’s instructions and β-actin was 145
used as the endogenous control. The following primers were used: β-actin (F) 5’-146
GGCTGTATTCCCCTCCAT G-3’ and (R) 5’-CCAGTT GGTAACAATGCCATGT-3’; SOCS-1 (F) 5’-147
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 8: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/8.jpg)
8
GGTTGTAGCAGCTTGTGTC-3’ and (R) 5’-AATGAAGCCAGAGACCCTC-3’; IFN-γ (F) 5’-148
GCGTCATTGAATCACACCTG-3’ and (R) 5’-GAGCTCATTGAATGCTTGGC-3’ 149
Transfection with miR-155 mimic and inhibitors 150
Lymph nodes (axillary and inguinal) from naïve C57Bl/6 mice were harvested and cultured in 10 ml of 151
complete media at 37° C and 5% CO2. Complete media comprised of RPMI 1640 medium (Gibco 152
Laboratories, Grand Island, NY) supplemented with 10% FBS, 10mM L-glutamine, 10mM Hepes, 50 153
μM β-Mercaptoethanol , and 100 μg/mL penicillin. Cells were seeded at 2x105 cells in 24 well plates 154
and transfected with either 40 nM synthetic mmu-miR-155 -3p miScript miRNA mimic 155
(CUCCUACCUGUUAGCAUUAAC) or AllStar negative control siRNA. For inhibition of miR-155, 156
cells were activated with SEB (1 μg/ml) and treated with 100 nM Anti-mmu-miR-155-3p miScript 157
miRNA inhibitor (CUCCUACCUGUUAGCAUUAAC) or miScript Inhibitor negative control for 24 158
hours using HiperFect transfection reagent(Qiagen) according to manufacturer’s instructions. 159
Luciferase assay 160
The following plasmids were purchased from GeneCopoeia (Rockville, MD) – 3’UTR- Socs1 161
(MmiT028883) and control plasmid (CmiT000001-MT01). Chinese Hamster Ovary (CHO) cells were 162
co-transfected with 100 ng of plasmid and 100nM of miRIDIAN microRNA mmu-miR-155-5p mimic 163
or miRIDIAN microRNA mimic negative control using DharmaFECT DUO transfection reagent 164
following manufacturer’s instructions (Thermo Scientific, Pittsburgh, PA). 24 hr following transfection, 165
Luciferase activity was measured using LucPair ™ miR-Duo Luciferase Assay kit from GeneCopoeia. 166
167
168
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 9: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/9.jpg)
9
Statistics 169
All statistical analyses were carried out using GraphPad Prism Software (San Diego, CA). In all 170
experiments, the number of mice used was 4-5 per group, unless otherwise specified. Results are 171
expressed as means ± SEM. Student’s t-test was used to compare WT and miR-155-/- data, whereas 172
multiple comparisons were made using one-way analysis of variance (ANOVA), followed by post hoc 173
analysis using Tukey’s method. A p-value of <0.05 was considered statistically significant. Individual 174
experiments were performed in triplicate and each experiment was performed independently at least 175
three times to test reproducibility of results. 176
177
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 10: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/10.jpg)
10
RESULTS 178
SEB exposure triggers inflammation in the lung. 179
Previously, a single dose of SEB (50 μg) by intranasal delivery was found to induce cellular infiltration, 180
increase cytokine production, cause histopathological lesions and edema in C57BL/6 mice (4, 21, 22) 181
mimicking the symptoms of acute inflammatory lung injury in humans (23). In this study, we first 182
sought to investigate the inflammatory effect of SEB-exposure in the lungs. Forty eight hours after SEB 183
exposure, H&E stained sections of the lungs from SEB-exposed mice showed massive infiltration of 184
cells and signs of edema as evidenced by fluid filled bronchioles (Figure 1A). Because SEB is a potent 185
activator of T-cells, we examined the effect of SEB on T-cell subsets within the lung. Immediately after 186
euthanasia, the lungs were harvested and mononuclear cells were isolated from the lungs by density 187
gradient centrifugation to determine the phenotypic characteristics of the cells. SEB exposure not only 188
led to an overall increase in mononuclear cells but specifically, an increase in CD4+ and CD8+ T cells 189
(Figure 1B) was seen. Because SEB exposure triggers an increase in IFN-γ, a major pro-inflammatory 190
cytokine previously reported to orchestrate the inflammatory cascade and cause tissue damage(10, 24, 191
25), we analyzed the concentration of IFN-γ in the broncheoalveolar lavage fluid (BALF) and found a 192
high concentration (upto 3000 pg/ml) of IFN-γ in the lungs of SEB exposed mice (Figure 1C). These 193
data suggested that SEB administration via the intranasal route triggers acute inflammation in the lungs. 194
SEB exposure modulates miRNA expression in the lungs. 195
The dysregulation of specific miRs in response to SEB exposure has not been elucidated. 196
Because miRs play a critical role in mediating inflammation, we examined the miR profile after SEB 197
exposure. Total miR was isolated from lung-infiltrating mononuclear cells and the relative abundance of 198
miR in SEB exposed and vehicle treated mice was determined using microarray miRNA analysis. A 199
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 11: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/11.jpg)
11
heatmap was generated based on hierarchical clustering of miRNA highlighting a stark difference 200
between vehicle- and SEB-exposed mice (Figure 2A). Further examination of miR expression revealed 201
that of the 609 miR assessed, most remained unchanged, but a few showed significant up- or 202
downregulation as seen in the fold change distribution plot (Figure 2B). Ingenuity Pathway Analysis 203
(IPA) generated a ‘Top Network’ of miR that comprised of five upregulated miRs, including miR-155, 204
miR-31, miR-182, miR-20b, and miR-222 and their associated molecules (Figure 2C). This network was 205
characterized by IPA as responses involving inflammation, cellular development, cellular growth and 206
proliferation. To assign significant Immunological functions to the genes in the aforementioned ‘Top 207
Network’, Cytoscape (ClueGO+CluePedia application) was employed. Gene Ontology (GO) mapping 208
revealed that the genes associated with the miR in the ‘Top Network’ were functionally relevant to T-209
cell activation (GO: 0042110) and proliferation (GO: 0042098), Interferon-γ signaling (GO: 0060333) 210
and Toll-like receptor signaling (GO: 0002224) (Figure 2D). Next, we validated the expression levels of 211
these miRs in lung infiltrating mononuclear cells by q-RT PCR , which corroborated the expression 212
patterns seen using the microarray (Figure 2E). Amongst the miRs we validated, miR-155 was the most 213
highly expressed (~ 8 fold) in the lungs upon SEB exposure. Based on this, the role of miR-155 in the 214
development of SEB-induced ALI was further investigated. 215
miR-155 is important for SEB-mediated inflammation 216
Because miR-155 was highly upregulated in response to SEB, we hypothesized that it might play 217
a crucial role in facilitating the inflammation observed during the disease. To that end, WT and miR-218
155 -/- mice were exposed to SEB to determine the effects on disease parameters. H&E stained sections 219
of the lung revealed that WT mice exposed to SEB exhibited numerous layers of infiltration interspersed 220
with edema. Interestingly, miR-155 -/- mice exposed to SEB presented with almost normal lung 221
architecture (Figure 3A). Additionally, the miR-155 deficient mice expressed significantly decreased 222
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 12: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/12.jpg)
12
total numbers of mononuclear cells within the lung upon SEB exposure when compared to their WT 223
counterparts. Upon closer examination of the mononuclear cell phenotype within the lungs, absolute 224
numbers of CD4+ and CD8+ in the miR-155 -/- mice were decreased compared to WT mice (Figure 3B). 225
Additionally, cytokine analysis of the broncheoalveolar lavage fluid (BALF) in the lungs of WT mice 226
demonstrated high concentrations of pro-inflammatory cytokine IFN-γ. In contrast, IFN-γ levels were 227
significantly diminished in miR-155-/- mice (Figure 3C). Taken together, these results provided clear 228
evidence that miR-155-/- mice were protected from SEB mediated ALI, suggesting that miR-155 plays a 229
critical role in SEB-induced inflammation. 230
miR-155 expression is critically linked to IFN-γ production 231
Because SEB exposure leads to the release of copious amounts of IFN-γ and also results in 232
increased miR-155 expression, we considered if there was a positive correlation between IFN-γ 233
secretion and the expression of miR-155. To explore this possibility, we first assessed the expression of 234
IFN-γ after transfection of LN T-cells with a synthetic miR-155 mimic. Interestingly, we found a 235
substantial increase in IFN-γ levels not only in WT mice (Figure 4A) but also in miR-155 deficient mice 236
that were transfected with the mimic (Figure 4B). Additionally, inhibition of miR-155 with a synthetic 237
inhibitor conversely resulted in the diminished expression of IFN-γ (Figure 4C), suggesting a crucial 238
link between miR-155 expression and that of IFN-γ after SEB exposure. 239
miR-155 targets Socs1, a negative regulator of IFN-γ 240
miRs regulate the expression of genes by binding the 3’UTR of their respective target mRNA. 241
To examine the link between miR-155 and its potential target genes, we undertook a bioinformatics-242
based approach. First, IPA miRNA target filter tools were used, selecting only those miR-155 target 243
genes that were relevant to cytokine signaling, cellular immune response, and cellular growth and 244
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 13: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/13.jpg)
13
proliferation. Thirty six targets common to the filtering criteria applied were selected (Figure 5A). Next, 245
an IPA generated network was used to sort the targets based on those that were highly predicted and 246
experimentally observed (Figure 5B). Conclusively, a gene known as suppressor of cytokine signaling-247
1 (Socs1) was found to be a prominent miR-155 target due to miR-155’s ability to bind to the 3’ UTR of 248
the Socs1mRNA (Figure 5C). Because Socs1 is induced by IFN-γ and acts a negative regulator of IFN-249
γ, the relationship between miR-155 and Socs1 in the context of IFN-γ production was examined. miR-250
155-/- mice that were exposed to SEB had significantly increased expression of Socs1 mRNA in lung 251
infiltrating mononuclear cells when compared to WT (Figure 5D). Accordingly, we hypothesized that 252
miR-155 may target Socs1 to promote IFN-γ-mediated inflammation during SEB-induced inflammatory 253
ALI. To confirm Socs1 as a miR-155 target, we first measured relative luciferase activity after co-254
transfection of miR-155 mimic and plasmid containing the 3’ UTR of Socs1. Compared to mimic 255
control, miR-155 mimic led to a significant decrease in luciferase activity (Figure 6A) validating Socs1 256
as a target for miR-155. Next, the impact of miR-155 mimic on Socs1 levels was explored. We found 257
that both, in WT (Figure 6B) and miR-155 deficient cells (Figure 6C) that were transfected with miR-258
155 mimic, Socs1 levels remained suppressed .On the other hand, whereas SEB activation continued to 259
lead to a repression in Socs1, miR-155 inhibition of SEB-activated cells, resulted in its derepression 260
(Figure 6D), confirming the role of miR-155 in suppressing Socs1 during SEB-mediated activation of 261
immune cells. 262
263
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 14: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/14.jpg)
14
DISCUSSION 264
With the discovery of miR, a novel and exciting mechanism of gene regulation has arisen. miRs 265
are small non-coding endogenous RNA molecules that bind 3’ UTR of genes carrying complimentary 266
sites. A single miR usually targets several mRNA, acting as a fine-tuner of gene regulation rather than 267
an on-off system (26). In the context of inflammation, miRs have been found within a variety of immune 268
cells often targeting genes involved in the regulation of inflammatory response (27). In the current 269
study, we closely examined the miR profile after inhalation exposure to SEB. We observed that amongst 270
the miRs that were dysregulated in response to SEB, miR-155 was one of the most significantly altered. 271
It has been reported that naïve CD4+T cells initially display low levels of miR-155, which is increased 272
after the engagement of TCR by an antigen (28, 29). This is consistent with our observation that miR-273
155 was upregulated following SEB activation. 274
Recent studies have reported that miR-155-/- mice are resistant to EAE, demonstrating its 275
importance in mediating disease development (30). In other studies, miR-155-/- mice failed to control H. 276
pylori infection due to defective Th1 signaling (31). Moreover, in a mouse model of collagen-induced 277
arthritis (CIA), the deficiency of miR-155 led to a decrease in pathogenic T-cells. In humans, it has also 278
been reported that soldiers undergoing a battle-field like stress program demonstrated an increase in hsa-279
miR-155 levels in leucocytes exposed to SEB ex vivo (32) indicating that stress- related inflammation 280
could also potentially lead to the increase in miR-155. The current study further suggests that the acute 281
inflammatory response in the lungs to a bacterial superantigen is also regulated by miR-155, inasmuch 282
as, SEB-exposed miR-155-/- mice having fewer infiltrating T-cells and almost normal lung 283
histopathology. 284
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 15: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/15.jpg)
15
Usually an appropriate regulation of IFN-γ is necessary for mediating Th1 responses and 285
blunting infection (33). SEB exposure, however, causes an excessive release of IFN-γ. T-cells exposed 286
to IFN-γ, proliferate further, thus perpetuating a cycle of inflammation (34, 35). Studies carried out with 287
SEB activation of splenocytes have demonstrated that early cytokines released include IL-2 and TNF-α, 288
followed by the massive production of IFN-γ by T-helper cells (36). Additionally, in vitro SEB 289
activation of rat splenocytes results in the release of IFN-γ for up to 48 hours post-activation and 290
promotes the proliferation of CD4+ T-cells, similar to that seen in mice and humans (37). We have 291
noted in the current model (unpublished) that the peak of acute inflammatory lung injury occurs at 48 292
hours after SEB exposure. In line with the typical kinetics of cytokine release seen with SEB activation, 293
we did not detect early cytokines, TNF-α and IL-2, in the BALF at this time point (data not shown). 294
However, our data indicated substantial release of SEB-induced IFN-γ in WT mice suggesting that this 295
particular cytokine may significantly contribute to SEB-induced inflammation. Moreover, the 296
correlation between decreased IFN-γ in the BALF of miR-155-/- mice exposed to SEB and lack of 297
significant inflammation in the lungs is suggestive of a major role for IFN-γ in our model. 298
The relationship between miR-155 and IFN-γ has been briefly explored in previous studies. For 299
example, when miR-155 is overexpressed in human NK cells, the subsequent downregulation of a 300
target, SHIP-1, promotes IFN-γ expression (38). During collagen-induced arthritis, miR-155-/- mice 301
display significantly lower number of IFN-γ producing cells than WT (39). Likewise, our data 302
demonstrated that while transfection with a synthetic miR-155 mimic, leads to the induction of IFN-γ, 303
the blockade of miR-155, diminishes IFN-γ production. Our results clearly indicate that the SEB-304
mediated induction of IFN-γ can be explained, at least in part, by the induction of miR-155. 305
To uncover the relationship between miR-155 and IFN-γ in response to SEB exposure, we 306
employed bioinformatics tools and conducted extensive literature search. These efforts suggested 307
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 16: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/16.jpg)
16
suppressor of cytokine signaling 1 (SOCS1) as a possible link between miR-155 and IFN-γ. SOCS1 308
belongs to a family of eight proteins (SOCS1–SOCS7) that regulate the production of several cytokines 309
(40). In particular, SOCS1 is induced by IFN-γ for auto regulation of the IFN-γ pro-inflammatory 310
response by inhibiting the JAK/STAT1 signaling pathway (41). Recent experiments in numerous cell 311
types have revealed that miR-155 targets SOCS1 (42-44). For example, macrophages infected with an 312
RNA virus demonstrated enhanced Type I interferon production due to miR-155 targeting of Socs1 313
(45). In the current study we noted that the miR-155-/- mice that are exposed to SEB, showed increased 314
expression in Socs1 mRNA levels compared to SEB exposed WT mice. The expression of Socs1 315
correlated inversely with IFN-γ production in the BALF. In addition, our gain and loss of function 316
studies with miR-155 mimic and inhibitor, clearly demonstrated that miR-155-mediated targeting of 317
Socs1 regulates IFN-γ production. 318
The results of the present study highlight the role of miR-155 in SEB induced acute 319
inflammatory lung injury. Specifically, we demonstrate that the high levels of IFN-γ production 320
associated with SEB exposure can be attributed to the miR-155 mediated repression of Socs1, a critical 321
regulator of IFN-γ (Figure 7). Furthermore, the importance of miR-155 is made particularly evident as 322
miR-155 deficient mice were found to be protected from SEB-mediated inflammation and acute lung 323
injury, thereby suggesting that therapeutic targeting of miR-155 may be useful in the treatment of SEB-324
triggered acute inflammatory lung injury. 325
326
ACKNOWLEDGEMENTS 327
This work was supported by NIH grants P01AT003961, R01AT006888, R01ES019313, 328
R01MH094755, P20RR032684 and VA Merit Award BX001357. 329
330
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 17: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/17.jpg)
17
REFERENCES 331
1. Pinchuk, I. V., E. J. Beswick, and V. E. Reyes. 2010. Staphylococcal enterotoxins. Toxins 332
2:2177-2197. 333
2. Savransky, V., V. Rostapshov, D. Pinelis, Y. Polotsky, S. Korolev, J. Komisar, and K. 334
Fegeding. 2003. Murine lethal toxic shock caused by intranasal administration of staphylococcal 335
enterotoxin B. Toxicol Pathol 31:373-378. 336
3. Ulrich, R. G., S. Sidell, T.J.Taylor, C.L Wilhelmsen and D.R Franz. . 2001. Textbook of 337
military medicine: medical aspects of chemical and biological warfare. 338
4. Saeed, A. I., S. A. Rieder, R. L. Price, J. Barker, P. Nagarkatti, and M. Nagarkatti. Acute 339
lung injury induced by Staphylococcal enterotoxin B: disruption of terminal vessels as a 340
mechanism of induction of vascular leak. Microsc Microanal 18:445-452. 341
5. Neumann, B., B. Engelhardt, H. Wagner, and B. Holzmann. 1997. Induction of acute 342
inflammatory lung injury by staphylococcal enterotoxin B. J Immunol 158:1862-1871. 343
6. Bavari, S., and R. G. Ulrich. 1995. Staphylococcal enterotoxin A and toxic shock syndrome 344
toxin compete with CD4 for human major histocompatibility complex class II binding. Infection 345
and immunity 63:423-429. 346
7. Kozono, H., D. Parker, J. White, P. Marrack, and J. Kappler. 1995. Multiple binding sites 347
for bacterial superantigens on soluble class II MHC molecules. Immunity 3:187-196. 348
8. Miethke, T., K. Duschek, C. Wahl, K. Heeg, and H. Wagner. 1993. Pathogenesis of the toxic 349
shock syndrome: T cell mediated lethal shock caused by the superantigen TSST-1. European 350
journal of immunology 23:1494-1500. 351
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 18: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/18.jpg)
18
9. Bette, M., M. K. Schafer, N. van Rooijen, E. Weihe, and B. Fleischer. 1993. Distribution and 352
kinetics of superantigen-induced cytokine gene expression in mouse spleen. The Journal of 353
experimental medicine 178:1531-1539. 354
10. Tilahun, A. Y., M. Holz, T. T. Wu, C. S. David, and G. Rajagopalan. 2011. Interferon 355
gamma-dependent intestinal pathology contributes to the lethality in bacterial superantigen-356
induced toxic shock syndrome. PLoS One 6:e16764. 357
11. Florquin, S., Z. Amraoui, and M. Goldman. 1995. T cells made deficient in interleukin-2 358
production by exposure to staphylococcal enterotoxin B in vivo are primed for interferon-gamma 359
and interleukin-10 secretion. European journal of immunology 25:1148-1153. 360
12. Fleischer, B., R. Gerardy-Schahn, B. Metzroth, S. Carrel, D. Gerlach, and W. Kohler. 361
1991. An evolutionary conserved mechanism of T cell activation by microbial toxins. Evidence 362
for different affinities of T cell receptor-toxin interaction. J Immunol 146:11-17. 363
13. Herman, A., J. W. Kappler, P. Marrack, and A. M. Pullen. 1991. Superantigens: mechanism 364
of T-cell stimulation and role in immune responses. Annual review of immunology 9:745-772. 365
14. Saeed, A. I., S. A. Rieder, R. L. Price, J. Barker, P. Nagarkatti, and M. Nagarkatti. 2012. 366
Acute lung injury induced by Staphylococcal enterotoxin B: disruption of terminal vessels as a 367
mechanism of induction of vascular leak. Microsc Microanal 18:445-452. 368
15. Cai, Y., X. Yu, S. Hu, and J. Yu. 2009. A brief review on the mechanisms of miRNA 369
regulation. Genomics, proteomics & bioinformatics 7:147-154. 370
16. O'Connell, R. M., D. S. Rao, and D. Baltimore. 2012. microRNA regulation of inflammatory 371
responses. Annual review of immunology 30:295-312. 372
17. Rossi, R. L., G. Rossetti, L. Wenandy, S. Curti, A. Ripamonti, R. J. Bonnal, R. S. Birolo, M. 373
Moro, M. C. Crosti, P. Gruarin, S. Maglie, F. Marabita, D. Mascheroni, V. Parente, M. 374
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 19: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/19.jpg)
19
Comelli, E. Trabucchi, R. De Francesco, J. Geginat, S. Abrignani, and M. Pagani. 2011. 375
Distinct microRNA signatures in human lymphocyte subsets and enforcement of the naive state 376
in CD4+ T cells by the microRNA miR-125b. Nature immunology 12:796-803. 377
18. Xiao, C., L. Srinivasan, D. P. Calado, H. C. Patterson, B. Zhang, J. Wang, J. M. 378
Henderson, J. L. Kutok, and K. Rajewsky. 2008. Lymphoproliferative disease and 379
autoimmunity in mice with increased miR-17-92 expression in lymphocytes. Nature 380
immunology 9:405-414. 381
19. O'Connell, R. M., D. Kahn, W. S. Gibson, J. L. Round, R. L. Scholz, A. A. Chaudhuri, M. 382
E. Kahn, D. S. Rao, and D. Baltimore. 2010. MicroRNA-155 promotes autoimmune 383
inflammation by enhancing inflammatory T cell development. Immunity 33:607-619. 384
20. 2011. Guide for the Care and Use of Laboratory Animals, 8th ed., Washington (DC). 385
21. Rieder, S. A., P. Nagarkatti, and M. Nagarkatti. Multiple anti-inflammatory pathways 386
triggered by resveratrol lead to amelioration of staphylococcal enterotoxin B-induced lung 387
injury. Br J Pharmacol 167:1244-1258. 388
22. Rieder, S. A., P. Nagarkatti, and M. Nagarkatti. CD1d-independent activation of invariant 389
natural killer T cells by staphylococcal enterotoxin B through major histocompatibility complex 390
class II/T cell receptor interaction results in acute lung injury. Infection and immunity 79:3141-391
3148. 392
23. Wheeler, A. P., and G. R. Bernard. 2007. Acute lung injury and the acute respiratory distress 393
syndrome: a clinical review. Lancet 369:1553-1564. 394
24. Miyata, A., M. Natsuaki, and K. Yamanishi. 2008. Staphylococcal enterotoxin B enhances a 395
flare-up reaction of murine contact hypersensitivity through up-regulation of interferon-gamma. 396
Exp Dermatol 17:843-848. 397
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 20: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/20.jpg)
20
25. Plaza, R., J. L. Rodriguez-Sanchez, and C. Juarez. 2007. Staphylococcal enterotoxin B in 398
vivo modulates both gamma interferon receptor expression and ligand-induced activation of 399
signal transducer and activator of transcription 1 in T cells. Infection and immunity 75:306-313. 400
26. Sonkoly, E., and A. Pivarcsi. 2009. microRNAs in inflammation. Int Rev Immunol 28:535-561. 401
27. Lindsay, M. A. 2008. microRNAs and the immune response. Trends Immunol 29:343-351. 402
28. Thai, T. H., D. P. Calado, S. Casola, K. M. Ansel, C. Xiao, Y. Xue, A. Murphy, D. 403
Frendewey, D. Valenzuela, J. L. Kutok, M. Schmidt-Supprian, N. Rajewsky, G. 404
Yancopoulos, A. Rao, and K. Rajewsky. 2007. Regulation of the germinal center response by 405
microRNA-155. Science 316:604-608. 406
29. Stahl, H. F., T. Fauti, N. Ullrich, T. Bopp, J. Kubach, W. Rust, P. Labhart, V. Alexiadis, C. 407
Becker, M. Hafner, A. Weith, M. C. Lenter, H. Jonuleit, E. Schmitt, and D. Mennerich. 408
2009. miR-155 inhibition sensitizes CD4+ Th cells for TREG mediated suppression. PLoS One 409
4:e7158. 410
30. Murugaiyan, G., V. Beynon, A. Mittal, N. Joller, and H. L. Weiner. Silencing microRNA-411
155 ameliorates experimental autoimmune encephalomyelitis. J Immunol 187:2213-2221. 412
31. Oertli, M., D. B. Engler, E. Kohler, M. Koch, T. F. Meyer, and A. Muller. MicroRNA-155 is 413
essential for the T cell-mediated control of Helicobacter pylori infection and for the induction of 414
chronic Gastritis and Colitis. J Immunol 187:3578-3586. 415
32. Muhie, S., R. Hammamieh, C. Cummings, D. Yang, and M. Jett. Transcriptome 416
characterization of immune suppression from battlefield-like stress. Genes Immun 14:19-34. 417
33. Schoenborn, J. R., and C. B. Wilson. 2007. Regulation of interferon-gamma during innate and 418
adaptive immune responses. Adv Immunol 96:41-101. 419
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 21: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/21.jpg)
21
34. Krakauer, T. Update on staphylococcal superantigen-induced signaling pathways and 420
therapeutic interventions. Toxins 5:1629-1654. 421
35. Lee, C. L., S. H. Lee, F. T. Jay, and K. R. Rozee. 1990. Immunobiological study of interferon-422
gamma-producing cells after staphylococcal enterotoxin B stimulation. Immunology 70:94-99. 423
36. Assenmacher, M., M. Lohning, A. Scheffold, R. A. Manz, J. Schmitz, and A. Radbruch. 424
1998. Sequential production of IL-2, IFN-gamma and IL-10 by individual staphylococcal 425
enterotoxin B-activated T helper lymphocytes. European journal of immunology 28:1534-1543. 426
37. Huang, W., and L. D. Koller. 1998. Superantigen activation and kinetics of cytokines in the 427
Long-Evans rat. Immunology 95:331-338. 428
38. Trotta, R., L. Chen, D. Ciarlariello, S. Josyula, C. Mao, S. Costinean, L. Yu, J. P. Butchar, 429
S. Tridandapani, C. M. Croce, and M. A. Caligiuri. miR-155 regulates IFN-gamma 430
production in natural killer cells. Blood 119:3478-3485. 431
39. Kurowska-Stolarska, M., S. Alivernini, L. E. Ballantine, D. L. Asquith, N. L. Millar, D. S. 432
Gilchrist, J. Reilly, M. Ierna, A. R. Fraser, B. Stolarski, C. McSharry, A. J. Hueber, D. 433
Baxter, J. Hunter, S. Gay, F. Y. Liew, and I. B. McInnes. MicroRNA-155 as a 434
proinflammatory regulator in clinical and experimental arthritis. Proc Natl Acad Sci U S A 435
108:11193-11198. 436
40. Krebs, D. L., and D. J. Hilton. 2001. SOCS proteins: negative regulators of cytokine signaling. 437
Stem Cells 19:378-387. 438
41. Tamiya, T., I. Kashiwagi, R. Takahashi, H. Yasukawa, and A. Yoshimura. Suppressors of 439
cytokine signaling (SOCS) proteins and JAK/STAT pathways: regulation of T-cell inflammation 440
by SOCS1 and SOCS3. Arterioscler Thromb Vasc Biol 31:980-985. 441
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 22: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/22.jpg)
22
42. Cardoso, A. L., J. R. Guedes, L. Pereira de Almeida, and M. C. Pedroso de Lima. miR-155 442
modulates microglia-mediated immune response by down-regulating SOCS-1 and promoting 443
cytokine and nitric oxide production. Immunology 135:73-88. 444
43. Zhang, M., Q. Zhang, F. Liu, L. Yin, B. Yu, and J. Wu. MicroRNA-155 may affect allograft 445
survival by regulating the expression of suppressor of cytokine signaling 1. Med Hypotheses 446
77:682-684. 447
44. Jiang, S., H. W. Zhang, M. H. Lu, X. H. He, Y. Li, H. Gu, M. F. Liu, and E. D. Wang. 448
MicroRNA-155 functions as an OncomiR in breast cancer by targeting the suppressor of 449
cytokine signaling 1 gene. Cancer Res 70:3119-3127. 450
45. Wang, P., J. Hou, L. Lin, C. Wang, X. Liu, D. Li, F. Ma, Z. Wang, and X. Cao. Inducible 451
microRNA-155 feedback promotes type I IFN signaling in antiviral innate immunity by targeting 452
suppressor of cytokine signaling 1. J Immunol 185:6226-6233. 453
454
455
456
457
458
459
460
461
462
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 23: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/23.jpg)
23
FIGURE LEGENDS 463
464
Figure 1. SEB induces lung inflammation (A) Representative H&E images (20x) of cross sections of 465
the lung from mice exposed to either Vehicle or SEB. (B) Lung infiltrating mononuclear cells obtained 466
by density gradient centrifugation and total number of viable cells were counted using a hemocytometer. 467
Cells were further stained with mAb to identify CD4+ and CD8+ cells and analyzed on a flow 468
cytometer. The percentage of the immune cell subsets was multiplied by the total number of cells found 469
in the lung and divided by 100 to yield the absolute cell numbers shown. (C) The concentration of IFN-γ 470
protein present in the BALF was determined using a standard ELISA kit. Data are mean ± SEM (n=5) 471
and are representative of three independent experiments. Statistical significance as compared to SEB + 472
Vehicle is indicated as *p<0.05, ** p<0.01, *** P<0.001, **** p<0.0001. 473
474
475
476
477
478
479
480
481
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 24: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/24.jpg)
24
482
Figure 2. SEB exposure leads to dysregulation of miRNA. Forty eight hours after vehicle or SEB 483
administration, miRNA was isolated from lung infiltrating mononuclear cells. (A) Heatmap depicting 484
differential expression of miRNA in the lungs of mice exposed to SEB +vehicle as compared to vehicle. 485
(B) Fold change distribution of the 609 miRNA indicating several upregulated and downregulated 486
miRNA (C) Ingenuity Pathway analysis generated ‘Top network’ with network function denoted as 487
‘inflammatory response, cellular development, cellular growth and proliferation’. (D) Cytoscape 488
generated Gene Ontology (GO) network based on Immunological processes for the molecules associated 489
in ‘Top Network’ using ClueGo 2.0.7 application. Analysis criteria consisted of two-sided 490
hypergeometric test with Benjamini Hochberg correction. Only results with kappa score = 0.3 are 491
displayed. (E) qRT PCR validation of the IPA generated ‘Top upregulated miRNA’. Total RNA was 492
isolated from lung infiltrating mononuclear cells. Snord96a was used as the small RNA endogenous 493
control and the expression level of SEB-induced miRNA shown here was normalized to vehicle. Data is 494
represented as mean ± SEM from replicate samples (*p<0.05, **p <0.01 as compared to vehicle). 495
496
497
498
499
500
501
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 25: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/25.jpg)
25
Figure 3. miR-155 plays a critical role in SEB-induced ALI. WT (C57BL/6) and miR-155-/- (B6.Cg-502
Mir155 tm1.1 Rsky/J) mice were exposed to SEB and euthanized 48 hours later. (A) Representative H&E 503
images (20x) of sections of lung indicating immune cell infiltration. (B) Phenotypic characterization of 504
cells infiltrating the lung was determined by staining of mononuclear cells with fluorescent conjugated 505
mAb against CD4 and CD8. (C) Levels of IFN-γ cytokine in the BALF was determined by ELISA. Data 506
are mean ± SEM (n=5) and are representative of two independent experiments. Statistical significance as 507
compared to WT is indicated as *p<0.05, ** p<0.01. 508
509
510
511
512
513
514
515
516
517
518
519
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 26: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/26.jpg)
26
Figure 4. IFN-γ forms a critical link between SEB and subsequent miR-155 induction. (A) Lymph 520
node (LN) T cells obtained from naïve wildtype (WT) mice were transfected either with miR-155 mimic 521
(Mimic) or mimic control (Control) for 24 hours. IFN-γ levels were determined by RT-PCR. (B) LN T 522
cells obtained from miR-155-/- were also transfected with 10nM miR-155 mimic or mimic control as 523
indicated for 24 hours and IFN-γ levels were assessed. (C) LN cells were activated with SEB (1μg/ml) 524
for 24 hours. Cells were then transfected with 50nM miR-155 inhibitor (Inh) or Inhibitor Control (Inh 525
Control) for another 24 hours. IFN-γ levels were determined via RT-PCR. Data is represented as mean ± 526
SEM from replicate samples. Statistical significance is indicated as *p<0.05, ** p<0.01, *** P<0.001, 527
**** p<0.0001. 528
529
530
531
532
533
534
535
536
537
538
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 27: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/27.jpg)
27
Figure 5. Identification of SEB-induced miR-155 targets. (A) miR-155 targets were filtered based on 539
their role in cytokine signaling, cell growth and proliferation and cellular immune response using IPA. A 540
proportional Venn diagram indicating the miR-155 targets common to all three filtering criteria was 541
generated. The list of targets is indicated within brackets and Socs1, a highly predicted target is 542
highlighted (red). (B) IPA network was generated highlighting the highly predicted (yellow) and 543
experimentally observed (brown) miR-155 targets, in addition to Socs1 (red), the target of interest. (C) 544
Schematic illustration of the predicted target site for miR-155 within the 3’ UTR of Socs1 mRNA. (D) 545
Total mRNA was isolated from lung-infiltrating mononuclear cells of WT and miR-155 -/- mice exposed 546
to SEB. Relative expression of Socs1 mRNA was determined by qRT PCR using β-actin as endogenous 547
control. Data is represented as mean ± SEM from replicate samples .Statistical significance is indicated 548
as *p<0.05, ** p<0.01, *** P<0.001, **** p<0.0001. 549
550
551
552
553
554
555
556
557
558
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 28: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/28.jpg)
28
Figure 6. miR-155 targets Socs1. (A) Chinese Hamster Ovary (CHO) cells were co-transfected with 559
miR-155 mimic or mimic control along with plasmid containing either the 3’UTR of Socs1 or control 560
plasmid for 24 hours. Relative luciferase activity (firefly normalized to renilla) was determined 561
following transfection. (B) Lymph nodes (LN) cells obtained from naïve wildtype (WT) mice were 562
transfected either with 40nM miR-155 mimic (Mimic) or mimic control (Control) for 24 hours. Socs1 563
levels were determined by RT-PCR. (C) LN cells obtained from miR-155-/- were also transfected with 564
40nM miR-155 mimic or mimic control as indicated for 24 hours and Socs1 levels were assessed. (D) 565
LN cells were activated with SEB (1μg/ml) for 24 hours. Cells were then transfected with 100nM miR-566
155 inhibitor (Inh) or Inhibitor Control (Inh Control) for another 24 hours. Socs1 levels were 567
determined via qRT-PCR. Data is represented as mean ± SEM from replicate samples statistical 568
significance is indicated as *p<0.05, ** p<0.01, *** P<0.001, **** p<0.0001. 569
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 29: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/29.jpg)
29
Figure 7. Schematic of SEB-mediated downregulation of Socs1 via miR-155. SEB exposure leads to 570
the release of IFN-γ and subsequent expression of miR-155. miR-155 mediated suppression of Socs1 571
prevents appropriate control of IFN-γ leading to cell proliferation and sustained cytokine signaling and 572
damage to the lung. 573
574
on May 20, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
![Page 37: Staphylococcal enterotoxin B (SEB ) - induced microRNA …iai.asm.org/content/early/2014/04/22/IAI.01666-14.full.pdf · 23 cell activation is getting increasi ng recognition, ...](https://reader031.fdocuments.in/reader031/viewer/2022022503/5ab14e637f8b9a6b468c555b/html5/thumbnails/37.jpg)
Correction for Rao et al., Staphylococcal Enterotoxin B-InducedMicroRNA-155 Targets SOCS1 To Promote Acute Inflammatory LungInjury
Roshni Rao, Sadiye Amcaoglu Rieder, Prakash Nagarkatti, Mitzi Nagarkatti
Department of Pathology, Microbiology, and Immunology, University of South Carolina School of Medicine, Columbia, South Carolina, USA
Volume 82, no. 7, p. 2971–2979, 2014. Page 2971: The byline should read as given above.
Copyright © 2014, American Society for Microbiology. All Rights Reserved.
doi:10.1128/IAI.02193-14
AUTHOR CORRECTION
3986 iai.asm.org Infection and Immunity p. 3986 September 2014 Volume 82 Number 9