Probing the Local Solvation Environments in an Oxygen-Binding Heme protein using pCNF as a Spectroscopic Reporter

Daniyal Tariq, Scott H. Brewer, and Christine M. Phillips-Piro Franklin & Marshall College, Department of Chemistry, Lancaster, PA 17604-3003

Abstract:

Heme Nitric Oxide and/or Oxygen (H-NOX) binding domains are gas-sensing domains found in both eukaryotic and prokaryotic cells, and are involved in vital functions such as chemotaxis and signal transduction. The heme-binding pocket of the H-NOX protein from Thermoanaerobacter tencongensis (Tt) has been shown to bind diatomic molecules such as O2, NO, and CO and the protein has been proposed to be able to sense O2 in its native environment. Crystal structures of Tt H-NOX have provided static structural images of the protein that suggest the heme pocket is inaccessible to solvent. Our current study focuses on probing the nature of the local hydration state of the heme pocket in addition to other sites in the protein by genetically incorporating the spectroscopic reporter unnatural amino acid (UAA) p-cyano-L-phenylalanine (pCNF) in a site-specific manner. pCNF is an effective vibrational reporter of local protein environments due to the sensitivity of the nitrile symmetric stretching frequency of this UAA to local environment. We report our IR studies that illustrate the uniqueness of the heme pocket environment compared to other areas of the protein. Future studies based on these findings will involve solving crystal structures of the UAA-containing proteins as well as obtaining IR for these constructs in different ligation states.

Introduction:

The past two decades has seen a significant increase in the number of known heme-based sensors from the initially known FixL (sensor protein FixL) and sGC (soluble guanylate cyclase). It was during this time that an ncBI search for sequence homology to that of the sGC protein found in mammals led to the discovery of H-NOX domains. sGC is a vital signaling protein, containing an H-NOX domain that binds NO and regulates vasodilation, a fact that highlights the biological important of the H-NOX domain.1

Today, H-NOX domains are now recognized as one of the 4 distinct families of heme-based sensors.2 Broadly speaking, bacterial H-NOX domains fall into two distinct classes: O2-binders and non-O2 binders. In facultative aerobes, these domains are found in an operon with a histidine kinase (HK) or diguanylate cyclase (Figure 1B) and do not bind diatomic oxygen.3 Homologous O2-binding domains are found in obligate anaerobes, where they fuse through a membrane-spanning region to a predicted methyl-accepting chemotaxis protein (MCP) domain (Figure 1A), allowing the bacterial cells to swim away from oxygenated environments.2 Owing to their ability to selectively and reversibly bind oxygen, making them similar to globins such as hemoglobin and myoglobin, these domains have therapeutic potential as oxygen-delivery drugs. In fact, a biotechnology company Omniox is currently working on tuning the oxygen-binding capabilities of H-

NOX domains in order to optimize their potential as drugs to treat hypoxia.4 Moreover, these domains also selectively bind CO, enabling them to act as cyanide sensors and currently work is being done to optimize their potential to achieve the latter goal.5 In short, the gas-binding capabilities of H-NOX domains make them crucial biological molecules.

Thermoanaerobacter Tencogensis Nostoc Sp

Figure 1: Oxygen and Non-oxygen binding H-NOX domains have similar structures but different functions.

Pellicena et al. (2004) reported the crystal structure of the O2-bound H-NOX domain from T. tengcongensis (Tt H-NOX). Structural analysis reveals the H-NOX family to have a protein fold consisting of seven -helices and a four-stranded anti-parallel β-sheets. Other major findings from the structure of the Tt H-NOX domain include a deeply buried heme pocket and the hydrogen bonding network within the heme pocket that surrounds the bound O2 molecule, involving the Y140, N74 and W9 residues.3,6-8 Also unique to the Tt H-NOX system is the lack of discrete tunnels within the protein to act as channels for gaseous ligands to reach the heme pocket.9 The crystal structure, however, only provides a static snapshot of the protein in time and further studies are needed to probe the dynamic nature of the protein and local environments found within it. Previous experiments on the Tt H-NOX system have predominantly involved mutational studies using naturally occurring amino acids to try and elucidate structural features that are critical for ligand binding.10-13 These studies have been rather illuminating. For instance, the Y140L mutation, which resulted in the loss of the protein’s oxygen-binding ability, highlighted the importance of the distal pocket tyrosine for O2-binding. Similarly, the P115A mutation revealed the importance of heme conformation with regards to oxygen-affinity, since the resulting decreased heme distortion increased oxygen affinity.11 However, there are inherent limitations to mutational studies with naturally occurring amino acids, since they lack many vital organic moieties. To make

use of these vital functional groups, unnatural amino acids must be incorporated into the Tt H-NOX system. The genetically encoded method for incorporating unnatural amino acids (UAAs) has allowed the thoughtful addition of a plethora of functional groups, site-specifically in proteins.14-16 One important application of this addition is the incorporation of UAAs like pCNF (Figure 2A) that can act as spectroscopic reporters of local protein environments. The present study sought to utilize the potential of pCNF to probe local protein environments of Tt H-NOX. This particular UAA has successfully characterized local solvation environments in the sfGFP and biological lipid systems since its native CN group produces an IR stretch in an otherwise quiet region of the protein that is sensitive to hydration environment (Figure 2B).15-18 The aforementioned studies have enabled the establishment of clear pCNF IR signals of 2228-2232 cm-1 for buried sites and 2233-2236 cm-1 for solvated sites. Moreover, the nitrile stretch arising from this spectroscopic reporter can be unambiguously assigned via isotopically labeled UAAs that lead to a specific shift in the nitrile peak.15 The purpose of our study was two-fold. First, comparing the local solvation environments of residues within the Tt H-NOX system as determined by the GETAREA software with results from IR studies utilizing pCNF as a spectroscopic reporter of local environments (see Appendix D) Specifically, we wanted to assess whether the heme pocket of the Tt H-NOX was inaccessible to solvent molecules. Since, there are no tunnels in this system (Figure 2), we hypothesized a conformational change occurring in the protein to allow for ligand entry, especially as earlier molecular dynamic simulations have shown fluctuation around the heme as a possible ligand entry mechanism.21 Further down the line, we want to assess the dynamic nature of the protein by seeing whether different ligation states cause significant conformational changes in the protein and determining the structural basis for these changes. Previous studies done in the So H-NOX system have revealed a mechanism involving Fe-histidine bond lengthening/cleavage that occurs upon NO binding, thereby causing conformational changes in the protein with a specific spectroscopic readout.19

The long-range goals of our systematic structure-function study will be focused on dissecting such gas-binding mechanisms with the help of various UAAs.

(a) (b)

Figure 2: Cut away images of space-filling models for (a) Tt and (b) So H-NOX domains, highlighting the absence of tunnels for ligand entry into the heme pocket of Tt H-NOX domains.

(a) (b)

Figure 3: (A) Crystal Structure of the Tt H-NOX highlighting the sites their predicted local solvation environment (according to GET AREA) showing the sites where pCNF was incorporated. (B) Representative IR Spectra of free pCNF in different solvents and structure of the cyano-phenyl moiety present in the pCNF molecule.20

Thus far, using known crystal structures and GETAREA data, sites of different protein environments (fully buried, partially-buried, solvent exposed) were chosen (Figure 3a), TAG mutants were created, and pCNF was incorporated at each of these sites. Our IR studies illustrated the truly buried and therefore unique nature of the heme pocket environment compared to other areas of the protein. Future studies based on these findings will involve solving crystal structures of the UAA-containing proteins to complement these vibrational studies and obtaining IR spectra for mutant Tt H-NOX constructs in different ligation states to assess the conformational flexibility of the Tt H-NOX domain. Additionally, we plan to begin similar work with the So system.Work on the aforementioned crystallographic studies is underway and was the main focus of the current semester, in addition to confirming pCNF-incorporation into the Tt H-NOX system for the D46 site via mass spectrometry analysis and uncovering the basis for background signal in the samples expressed without pCNF.

Materials and Methods:

SDM to create Tt H-NOX Amber (TAG) mutants. Successful cloning of Tt H-NOX out of pCW and into pBAD had been achieved two summers ago. In this study, TAG was inserted at the 5 site in order for the pDULE vector – containing both the tRNA and the aminoacyl-tRNA synthetase – to add UAAs (Appendix A). The end result of the multiple rounds of SDM was a non-His6-tagged Tt H-NOX construct with TAG at the 5 site (Tt H-NOX-I-5-TAG). All other TAG mutants (V36, D46, F78) were created in the same manner – using the QuikChange® protocol (Appendix A). His6-tagged mutants Y140,

F78, Y85, F151, F169, F183, Y185, I127, M129, F169, D46, V36, I5 were created in a similar manner last summer.

Tt H-NOX Expression.

The following expression protocol was used for both His6-constructs and non-His6

constructs:

Appropriate pBAD_Tt H-NOX expression construct and desired pDULE synthetase construct were dual-transformed into chemically competent DH10B E. coli cells in the afternoon and then plated on LB/Ampicillin/Tetracycline Agar plates and incubated at 37 C overnight (Appendix D). The next morning, the plates were taken out of the incubator, parafilmed, and stored in the refrigerator at 4 C. Expressions were performed in a yeast extract media; the starter cultures were made with 2XYT media. The yeast extract media was prepared the day before the expression. Expression volume was 1 L in a 2 L baffled flask and the content was as follows: 45 g yeast extract, 10 ml glycerol, and 900 ml ddH2O were added to each flask and autoclaved. Before inoculation 100 ml of a 170 mM KH2PO4, 720 mM K2HPO4 phosphate buffer was added to each expression culture. Cultures were inoculated with 10 mL of starter culture and allowed to grow at 37 C and 250 rpm. Once the OD600 reached ~ 0.7-0 .8 the incubation temperature was dropped to 18 C and the cultures were induced with 2.5 mL of 20% arabinose, UAA (1mM) and 5-aminolevulinic acid (1mM) solution were added (1 hr after induction). Cultures grew at 18 C and 250 rpm overnight and the next morning the cell pellet was collected.

Tt H-NOX Purification.

His6-Constructs:

Cell Lysis – Cell pellets were thawed on ice, re-suspended in 30 mL Buffer (50 mM Tris, pH 7.8, 20 mM NaCl), and lysed by adding Lysozyme (0.25 mg/ml). PMSF (0.5 mM) and DNAse (3.75 mM) were also added in order to inhibit endogenous proteases from degrading our protein and breaking down the DNA, respectively. This lysis solution was then sonicated at 40 % amplitude for 2 min (2 s pulse on, 2 s pulse off) and heat-shocked at 70 C for 30 min. Subsequently, the samples were spun down at 20,000 rpm for 45 min and the resulting supernatant and pellet samples were taken, which were later used in SDS-PAGE gels to confirm the presence of our desired protein.

Nickel-Affinity Chromatography- The supernatant obtained was then subjected to nickel-affinity chromatography in order to obtain purified protein. This procedure was used since our protein contained a His6-tag in its structure that enabled it to bind to the nickel ions found in the resin. To accomplish this, firstly, purification columns were equilibrated with 2CV of nickel resin and 100mL re-suspension buffer (50 mM Tris, 300 mM NaCl, pH 7.8) used above. The supernatant was poured over the equilibrated columns and left to batch-bind in the fridge for 30 minutes. After the batch-binding process, the flow through was collected. Then, 20 CV of resuspension buffer (50 mM Tris, 300 mM NaCl, pH 7.8),

10CV of wash buffer (50 mM Tris, 300 mM NaCl, 30 mM Imidazole, pH 7.8) and 5CV (50 mM Tris, 300 mM NaCl, 200 mM Imidazole, pH 7.8) of elution buffer were poured over the column, collecting the sample from each wash in a separate tube each time. We expected our protein to be in the sample collected from the wash with the elution buffer (50 mM Tris, 300 mM NaCl, 200 mM Imidazole, pH 7.8). The latter fact was confirmed by running SDS-PAGE gels and looking for a band ~22kDA in the lane containing the elute.

Note: CV refers to column volume, which varies depending on the size of the expression culture.

Non-His6 Constructs:

Cell Lysis- Cells were lysed in the same manner as outlined in the His6 constructs section.

Fast Protein Liquid Chromatography- The supernatant was first run through a cation exchange column (Mono S 10/100 GL column; Amersham Biosciences) and the fractions absorbing at 420 nm (heme absorption) were isolated. These fractions were then run on a size exclusion chromatography column  (Superdex 75 HR 10/30 column; Amersham Biosciences) pre-equilibrated with TEA Buffer (50 mM TEA, pH 7.5, 50 mM NaCl, 5% glycerol). The fractions containing the protein of interest i.e those that absorbed close to 420 nm were pooled together and analyzed by SDS-PAGE.

Oxidation-Reduction of the Heme Protein.

The purified protein constructs were cycled into an anaerobic glove-bag to first be oxidized by KFeCN and subsequently reduced by sodium dithionide in order to get the heme in the Fe2+-O2 state. A 100x excess concentration of KFeCN was used vis-à-vis the protein’s concentration and the protein was left in this solution for 10 minutes. The protein KFeCN solution was then desalted into an anaerobic buffer (20% TEA, 20% NaCl, 5% glycerol) using a PD-10 desalting column. The UV-Vis spectrum of the oxidized protein was obtained, after which it was cycled into the anaerobic glove-bag again to be re-reduced. A 100x excess of sodium dithionide was added to the protein, after which it was desalted into an anaerobic buffer (20% TEA, 20% NaCl, 5% glycerol) using a PD-10 desalting column.

Preparation of Mass Spectrometry Samples.

The purified protein was concentrated to ~1 mL and buffer exchanged with Ammonium Acetate Buffer (20 mM Ammonium Acetate, pH 7.0.) Using centricons, the protein was spun down with the ammonium acetate buffer at 13000 rpm for upto 5 rounds. The protein was subsequently flash-frozen using liquid nitrogen, and lyophilized for 24 hours. Finally, the lyophilized protein samples were sent to UC Irvine for ESI-Q-TOF mass analysis.

IR Spectroscopy.

Equilibrium FTIR absorbance spectra were recorded on a Bruker Vertex 70 FTIR spectrometer equipped with a globar source, KBr beamsplitter, and a liquid-nitrogen-cooled mercury cadmium telluride (MCT) detector. The spectra were recorded using a temperature-controlled transmission cell consisting of calcium fluoride windows with a path length of ∼100 μm. The temperature was measured using an embedded thermocouple in the transmission cell. The spectra were the result of 1024 scans recorded at a resolution of 1.0 cm-1. The intensity normalized and baseline corrected absorbance spectra were fit to a line shape function that consisted of a linear combination of a

Gaussian and Lorentzian function42 in Igor Pro (Wavemetrics).

Crystallization Studies.

The sitting-drop vapor diffusion method was used for crystallization. The lower well of the crystal tray was given 50 uL of the precipitant solution. A 1 uL sample of the protein was then added to the upper well, as well as 1 uL from the corresponding solution present in the lower well. Two 96-well trays (PEGION ½ and WIZARD 1) were set up using the I5 and D46 His6 constructs. Two 24-well tray screens were set around the hits obtained for the PEGION screens (A6 and A7) and the Wizard screen utilizing the same vapor diffusion method. The lower well of the crystal tray was given 500 uL of the precipitant solution. A 1 uL sample of the protein was then added to the upper well, as well as 1 uL from the corresponding solution present in the lower well.

Results and Discussion:

Successful Incorporation of pCNF at various sites in the H-NOX protein.

To show successful pCNF incorporation along various sites of the protein, an SDS-PAGE gel with positive and negative protein controls for each site was run, and the resulting bands were compared to that of the WT protein. To the positive controls pCNF was added, while no pCNF was added to the negative controls; the rest of the expression and purification protocol was identical for each type of control. The resulting SDS-PAGE gel (Figure 3) showed successful pCNF incorporation at the I5, V36, D46, F78 and Y140 sites (Figure 3, lanes 3,5,7,9.11.) The idea here was that the mutant proteins would not express well in the absence of pCNF as the resulting truncated protein would presumably bedegraded by the cell’s endogenous protease machinery. However, light bands can be seen in each of the (-) lanes suggested some contamination by the WT plasmid. The incorporation of this UAA was also confirmed by ESI-Q-TOF mass analysis (Appendix E) wherein the expected MW difference from WT was assessed based on pCNF-incorporation and the residue that was mutated. We also sent the samples expressed in the absence of pCNF for ESI-Q-TOF mass analysis to unambiguously discern what the bands

in the (-) reflected and due to the lack of sample material provided got back results that showed a lot of noise.

Figure 3: Coomassie blue stained SDS-PAGE Gel illustrating efficient, site-specific incorporation of pCNF with high fidelity into Tt H-NOX at the I5, V36, D46, F78 and Y140 sites. Note: the (+) indicates the constructs to which pCNF was added during the expression protocol and the (-) denotes those to which pCNF was not added during the expression protocol.

Assessing Ligation States.

For the sake of consistency and eliminating ligation state as a variable in our results, the purified Tt H-NOX proteins were subject to oxidation-reduction in an anaerobic glove-bag to get the heme in the Fe-unligated state. However, due to the difficulty in maintaining anaerobic conditions, it was decided to continue with the Fe2+-O2 state. Uv-Vis spectra for each construct were obtained and soret maximum band was inspected as well as the α/β bands, both of which are indicative of ligation state. The main purpose of the spectra, however, was to confirm heme incorporation, which they did as all constructs showed a peak ~ 420 nm, along with the 280 nm peak for conjugated amino acids (Figure 4.) As per the Karow et al. (2004) paper the soret maxima was expected to occur ~416 nm, and α/β splitting occurring close to 561 and 591 nm .21 While the V36, D46 and F78 constructs all yielded maxima at 416nm, the I5 and Y140-F78A mutants yielded maxima at lower values of 410 and 413 nm respectively. (Figure 4 and Table 1) Moreover, only the V36 and D46 constructs displayed α/β band splitting close to 561 and 591 nm, (Figure 4) which only enabled the confident assertion that the Fe2+-O2 state for these two constructs, wherein the Fe2+ formed a stable six-coordinated, low spin complex with O2. While the maxima at 416 nm for the F78 construct seemed to suggest a Fe2+-O2 state, the markedly reduced α/β band splitting made this assertion problematic. Furthermore, the larger deviations of the I5 and Y140 mutants from the expected 416 nm soret seemed to

suggest an altered heme electronic environment due to various possible side-chain interactions resulting from pCNF incorporation.

Figure 4: Electronic Absorption Spectra for Tt H-NOX mutants. The soret maxima occur at 416 nm for the both the V36 and D46 reflecting the six-coordinated bound Fe ion. The α/β splitting at 561 and 591 nm is also indicative of the O2-bound state. The soret maxima at 416 nm for F78 mutant reflects the six-coordinated bound Fe ion, whereas the 410 nm peak for the I5 and the 413 nm for the Y140-F78A suggest distorted heme planarity. Only minor α/β can be seen for the F78 mutant and none can be observed for the I5 and Y140-F78-A mutants.

Table 1: Uv/Vis peaks for samples used in IR studies.

Construct Soret Maxima (nm) α/β BandsI5 410 N/AV36 416 556/591D46 416 556/591F78 416 N/AY140-F78-A 413 N/A

Unambiguous assignment of the nitrile stretch.

In order to correctly attribute the perceived nitrile stretch on the IR spectra to the pCNF incorporated within the protein, the F78pCNF, D46pCNF, V36pCNF and Y140-F-78-ApCNF mutants were re-expressed, but this time isotopically labeled pC13NF was incorporated within them. A ~56cm-1 peak shift was expected to result from this isotopic labeling.15 The 56,54,56,55,56 cm-1 isotopic shifts (Figure 5) exhibited by the I5, V36, D46, F78 and Y140 mutants respectively were in good agreement with the direction and magnitude of the DFT calculated red shift in the gas phase resulting from 13C labeling. Since each of the mutants showed the expected shift, unambiguous assignment of the nitrile bands as the result of pCNF incorporation was successfully achieved.

Figure 5: FT-IR spectra of the I5, V36, D46, F78 and Y140-F78-A p13CNF (Red) and pCNF (Blue) mutant Tt H-NOX constructs.

Heme Pocket Residues are the most buried sites within the protein.

All three residues in the heme pocket that were examined, namely the I5pCNF, Y140pCNF and F78pCNF produced nitrile stretches corresponding to buried sites, in agreement with what was predicted using the crystallographic data. (Figure 6) This finding was particularly significant because only the predicted buried sites found within the heme pocket produced a corresponding signal; other buried sites appeared to be solvated according to the IR signals (Figure 7). The Y85 (2233.1cm -1), F52 (2232cm-1), I127 (2232cm-1), M129 (2234cm-1) and F151 (2235cm-1) were predicted to be buried sites according GETAREA (Appendix D) data calculated from the crystal structure of Tt H-NOX. However, these sites produced signals that as indicated above were well past the

solvent accessibility cutoff value of 2232 cm-1. Initially it was hypothesized that sites on helices would be more likely to undergo a conformational change as opposed to those on β-sheets. We conjectured that since helices are more flexible secondary protein structures as opposed to β-sheets, predicted buried residues found on the former might have undergone a conformational change causing them to report as solvated. However, since both the I127 and M129 residues, which were located on β-sheets reported as solvated, we had to discard this idea as we had hypothesized that only helical residues would show altered solvation environments. These results seemed to accentuate the importance of the heme pocket by highlighting the uniqueness of the solvation states of the residues found within it. Taken together with the fact that O2-binding H-NOX domains lack tunnels, these results indicate a unique mechanism at play within the protein that allows that gaseous ligands to reach the buried heme pocket.

Figure 6: FT-IR spectra of the I5, F78 and Y140-F78-A Tt H-NOX mutants showing that these sites are buried. The frequencies for the Y140-F-78-ApCNF, F-78pCNF and I5pCNF are as follows: 2229.3 cm-1, 2230.0 cm-1 and 2230.0 cm-1 respectively.

(a) (b)

Figure 7: Crystal structure of Tt H-NOX (PDB ID:1U55) shown with (a) predicted environment according to GETAREA software and (b) IR-reported environment. Note: Buried sites shown in red, solvent-exposed in blue and partially buried in yellow.

Predicted Solvent Accessible Sites produce Corresponding Signals Across the Board.

The D46 and V36 were predicted to solvated sites according to the GETAREA (Appendix D) calculations on the crystal structure of Tt H-NOX. These sites produced signals at 2232.8 cm-1, 2235.3 cm-1 and 2233.9 cm-1 (Figure 8) respectively, indicating solvated environments as each of the aforementioned values is above the solvent accessibility cutoff value of 2232 cm-1. These results highlighted the utility of pCNF as reporter of the nature of local protein environments in the Tt H-NOX system.

Figure 8: FT-IR Spectra of the Y185, D46 and V36 Tt mutants showing that these sites are solvated. The frequencies for the Y185, D46 and V36 were as follows: 2232.8 cm -1, 2235.3 cm-1 and 2233.9 cm-1 respectively.

Initial Crystallization studies

The focus of this semester was to obtain crystallographic data of the pCNF-incorporated constructs to complement our vibrational studies and assess any structural perturbation that may have arisen.

Optimizing the Purification for non-H6 constructs using the FPLC Previous attempts to purify non-His6 Tt H-NOX constructs using a ml Q-650 column (anion exchange) followed by a CM-650 (cation exchange column) proved extremely inefficient so a new purification procedure was needed for non-H6 constructs. The new proposed purification procedure that we tried over two semesters involved running the protein over a Mono S (cation exchange) , followed by an S75 (size exclusion) column on an FPLC machine. The supernatant following lysis was run on the Mono S column (Buffer A: 50 mM HEPES, 5 % glycerol, pH 6.5; Buffer B: 50 mM HEPES, 500 mM NaCl, 5 % glycerol, pH 6.5). Then, the fractions absorbing at 420 nm were pooled and were run on the S75 column (Buffer: 50 mM TEA, 5% glycerol, pH 7.5) The FPLC protocol and column seemed to work perfectly for the WT Tt H-NOX protein as indicated by the SDS-PAGE gel image following the S75 column run, which prompted us to use this procedure for the mutants. (Figure 9)

A B

CFigure: (9) FPLC Chromatogram following the Mono S run for the WT Tt H-NOX. The majority of the protein seems to be in the FT. (B) FPLC Chromatogram following the S75 column for the WT Tt H-NOX showing that good separation was achieved. (C) SDS-PAGE for fractions following the WT Tt H-NOX run on the S75 column. Pure WT Tt H-NOX appears in the C11 fraction. Note: the solid blue line on the FPLC chromatograms refers to samples absorbing at 280 nm and the solid red line refers to samples absorbing at 420 nm. We isolated fractions where both peaks were present.

The beginning of the semester was plagued with unsuccessful purification attempts of the F78 non-His6 construct, using the FPLC due to column overloading and other problems with the machine, so we resorted to try and crystallize the I5 and D46 His6 constructs since they expressed the best. The chromatogram for the Mono S column looks the same for both cases, with the majority of the protein in the FT. This is what we expected since we run it over this column to reduce the contamination from stray proteins before loading it onto the main S75 column. The F78 chromatogram looks markedly different from that of the WT with no smooth 420 nm peaks. This is evident in the SDS-PAGE gel that shows that the fractions containing the H-NOX protein contain large amounts of other proteins as well. On a positive note, the contamination reduces considerably as compared to the Mono S column; indicating that separation is being achieved just not as well as we’d like it to.

(a) (b)

C

Figure: 10: FPLC Chromatogram following the Mono S run for the F78 pCNF Tt H-NOX. The majority of the protein seems to be in the FT. (B) FPLC Chromatogram following the S75 column for the F78 pCNF Tt H-NOX showing that good separation wasn’t achieved. (C) SDS-PAGE for fractions following the WT Tt H-NOX run on the S75 column. F78 pCNF Tt H-NOX appears in the C5-C10 fractions along with several other proteins. Note: the solid blue line on the FPLC chromatograms refers to samples absorbing at 280 nm and the solid red line refers to samples absorbing at 420 nm. We isolated fractions where both peaks were present.

Setting Crystal Trays

Two 96-well trays were set up (PEGION and Wizard 1) for these constructs to try and get crystals. Potential crystals were seen in the PEGION screen for the I5 construct in the A6 and A7 wells (Figure 11), but they were not reproducible in the 24-well trays, due to protein aggregation. Moreover, D46 crystal hits (not shown) were seen in the WIZARD screen (D4), but were also not reproducible in a 24-well tray.

Figure 11: Potential crystal hits for the I5 pCNF construct from the PEGION screen wells A6 (left) and A7 (right.)

The findings of this study are highly informative. By successfully incorporating pCNF into the H-NOX system, an entirely novel avenue for the engineering of H-NOX has opened up. Moreover, the results shed light on the complexity of structure of the Tt domain. The heme pocket residues reported as buried and those that were expected to be solvent-exposed reported as hydrated confirming what was observed in the crystal structure, and allowing the application of pCNF as a spectroscopic probe for local solvation environments for the H-NOX system. Furthermore, the IR data for non-heme pocket buried sites is at odds with crystallographic data, suggesting the protein structure is dynamic and that a static snapshot may not provide the entire picture. Although the preliminary data indicate that pCNF is an effective probe of local solvation environments for the Tt H-NOX system, much work still remains to be done in

order to verify and assess our results. Although, these results suggest that the protein is very dynamic and so conformational changes within it alter the nature of local protein environments. However the possibility that the incorporation of pCNF significantly perturbed the structure, thus dramatically changing the nature of local protein environments, also had to be entertained. Firstly, CD spectra are needed to confirm that pCNF doesn’t cause significant structural perturbation within the protein. Moreover, crystallographic data of the expressed pCNF-incorporated mutants is needed in order to complement these vibrational studies and for further confirmation that pCNF-incorporation doesn’t cause significant structural perturbation. Moreover, structural water molecules found within the protein may be altering the frequencies of these residues and causing them to report as solvated. Thus, it was decided that the possibility of the protein unfolding needed to be eliminated by carrying out other assays and the crystal structures of these pCNF-incorporated constructs needed to be solved to check whether any structural water molecules may be causing our constructs to report as solvated before developing a working hypothesis to explain our results. Furthermore, these crystal structures may help shed light on some inexplicable Uv-Vis spectral data by enabling a direct visualization of the impact of pCNF-incorporation within the H-NOX protein. As a result, much of the work this semester was focused obtaining crystals for the sites focused on in the IR studies. Since non His6-tag constructs are needed for setting crystal trays, the expression and purification procedure had to be started from scratch, beginning with SDM to get the desired TAG mutants. Moreover, the purification procedure for these constructs needed to be optimized as previous attempts with purifying non-His6 Tt H-NOX constructs using a ml Q-650 column (anion exchange) followed by a CM-650 (cation exchange column) proved extremely inefficient. The beginning of this procedure was plagued with failed SDMs, but finally all, but the Y140 TAG mutants, lacking the His6 tag were successfully created and a new purification protocol was tested with the FPLC machine. Using the latter machine with a cation exchange column and a size exclusion chromatography column  (Superdex 75 HR 10/30 column; Amersham Biosciences), WT non-His6 Tt H-NOX was successfully purified (confirmed by SDS-PAGE analysis), leading to a novel and successful approach for purifying non-His6

constructs. However, we didn’t achieve the same level of success with pCNF-incorporated mutant constructs, so we tried crystallizing His6 constructs, which did show potential hits. The immediate future goals for this project are to repeat the Uv-Vis analysis of the mutant constructs to help de-convolute the ambiguous spectra for the pocket sites as well as pushing forward with crystallization studies. Additionally, more work on obtaining IR data for the Tt H-NOX and So H-NOX mutants in various ligation states will be carried out to tackle one of the long-range goals of assessing ligand entry and conformational flexibility in the H-NOX domains.

References:

(1) Insights into the distal pocket of H-NOX using fluoride as a probe for H-bonding interactions. J Inorg. Biochem. 126, 91-5.(2) Gilles-Gonzalez, M. A., and Gonzalez, G. (2005) Heme-based sensors: defining characteristics, recent developments, and regulatory hypotheses. J. Inorg. Biochem. 99, 1-22.(3) Pellicena, P., Karow, D. S., Boon, E. M., Marletta, M. A., and Kuriyan, J. (2004) Crystal structure of an oxygen-binding heme domain related to soluble guanylate cyclases. Proc. Natl. Acad. Sci. 101, 12854-12859.(4) Therapeutic Approach. (n.d.). Retrieved December 24, 2015, from http://www.omniox.com/index.php/drug-development/therapeutic-approach(5) Dai, Z., & Boon, E. (2010). Engineering of the Heme Pocket of an H-NOX Domain for Direct Cyanide Detection and Quantification. J. Am. Chem. Soc, 11496-11503.(6) Schmidt, P. M., Schramm, M., Schröder, H., Wunder, F., and Stasch, J. P. (2004) Identification of residues crucially involved in the binding of heme moiety of soluble guanylate cyclase. J. Biol. Chem. 279, 3025-3032.(7) Weinert, E. E., Plate, L., Whited, C. A., Olea, C. Jr., and Marletta, M. A. (2010) Determinants of ligand affinity and heme reactivity in H-NOX domains. Angew. Chem., Int. Ed. 49, 720-723.(8) Martin, E., Berka, V., Bogatenkova, E., Murad, F., and Tsai, A. (2006) Ligand selectivity of guanylyl cyclase: effect of the hydrogen-binding tyrosine in the distal heme pocket on binding of oxygen, nitric oxide, and carbon monoxide. J. Biol. Chem. 281, 27836-27845.(9) Winter, M., Herzik, M., Kuriyan, J., & Marletta, M. (2011). Tunnels modulate ligand flux in a heme nitric oxide/oxygen binding (H-NOX) domain. Proceedings of the National Academy of Sciences.(10) Boon, E. M., Huang, S. H., and Marletta, M. A. (2005) A molecular basis for NO selectivity in soluble guanylate cyclases. Nat. Chem. Biol. 1, 53-59.(11) Olea, C., Boon, E. M., Pellicena, P., Kuriyan, J., and Marletta, M. A. (2008) Probing the function of heme distortion in the H-NOX family. ACS Chem. Biol. 3, 703-710.(12) Derbyshire E. R., Deng S., and Marletta M. A. (2010) Incorporation of tyrosine and glutamine residues into the soluble guanylate cyclase heme distal pocket alters NO and O2 binding. J Biol Chem. 285, 17471-8.(13) Tran R., Boon E. M., Marletta M. A., and Mathies R. A. (2009) Resonance raman spectra of an O2-binding H-NOX domain reveal heme relaxation upon mutation. Biochemistry. 48, 8568-77.(14) Miyake-Stoner, S. J., Miller, A. M., Hammill, J. T., Peeler, J. C., Hess, K. R., Mehl, R. A., and Brewer, S. H. (2009) Probing protein folding using site-specifically encoded unnatural amino acids as FRET donors with tryptophan. Biochemistry 48, 5953–5962.(15) Bazewicz, C. G., Lipkin, J. S., Smith, E. E., Liskov, M. T., and Brewer, S. H. (2012) Expanding the utility of 4-cyano-L-phenylalanine as a vibrational reporter of protein environments. J Phys Chem B 116, 10824–10831.(16) Taskent-Sezgin, H., Chung, J., Patsalo, V., Miyake-Stoner, S. J., Miller, A. M., Brewer, S. H., Mehl, R. A., Green, D. F., Raleigh, D. P., and Carrico, I. (2009) Interpretation of p-cyanophenylalanine fluorescence in proteins in terms of solvent

exposure and contribution of side-chain quenchers: a combined fluorescence, IR and molecular dynamics study. Biochemistry 48, 9040–9046.(17) Horness, R., Basom, E., & Thielges, M. (n.d.). Site-selective characterization of Src homology 3 domain molecular recognition with cyanophenylalanine infrared probes. Anal. Methods, 7234-7241.(18) Shrestha, R., Cardenas, A., Elber, R., & Webb, L. (2015). Measurement of the Membrane Dipole Electric Field in DMPC Vesicles Using Vibrational Shifts of p -Cyanophenylalanine and Molecular Dynamics Simulations. The Journal of Physical Chemistry B J. Phys. Chem. B, 2869-2876.(19) Xu, C., Ibrahim, M., & Spiro, T. (n.d.). DFT Analysis of Axial and Equatorial Effects on Heme−CO Vibrational Modes:  Applications to CooA and H−NOX Heme Sensor Proteins †. Biochemistry, 2379-2387.(20) Dippel, A., Olenginski, G., Maurici, N., Liskov, M., Brewer, S., & Phillips-Piro, C. (2016). Probing the effectiveness of spectroscopic reporter unnatural amino acids: A structural study. Acta Cryst Sect D Struct Biol, 121-130.(21) Karow, D., Pan, D., Tran, R., Pellicena, P., Presley, A., Mathies, R., & Marletta, M. (n.d.). Spectroscopic Characterization of the Soluble Guanylate Cyclase-like Heme Domains from Vibrio cholerae and Thermoanaerobacter tengcongensis †. Biochemistry, 10203-10211.

Appendix:

A. SDM to create appropriate expression constructs

His6-Constructs

Construct Primer-F (5’ to 3’) Primer-R (5’ to 3’)TtH-NOX-V36TAG-H6 GGGTTGGGAACCAGATAGGTAGA

TTACACCTCTGGAGGCCTCCAGAGGTGTAATCTACCTATCTGGTTCCCAACCC

TtH-NOX-D46TAG-H6 CCTCTGGAGGATATTGATGACTAGGAGGTTAGGAGAATTTTTGC

GCAAAAATTCTCCTAACCTCCTAGTCATCAATATCCTCCAGAGG

TtH-NOX-F52TAG-H6 GAGGTTAGGAGAATTTAGGCTAAGGTGAGTGAAAAAACT

AGTTTTTTCACTCACCTTAGCCTAAATTCTCCTAACCTC

TtH-NOX-F78TAG-H6 GGCAGAACATAAAAACTTAGAGCGAATGGTTTCCCTCC

GGAGGGAAACCATTCGCTCTAAGTTTTTATGTTCTGCC

TtH-NOX-Y85TAG-H6 CGAATGGTTTCCCTCCTAGTTTGCAGGGAGAAGGCTAGTG

CACTAGCCTTCTCCCTGCAAACTAGGAGGGAAACCATTCG

TtH-NOX-I127TAG-H6 GCCTGTTGCAAAAGATGCCTAGGAAATGGAGTACGTTTC

GAAACGTACTCCATTTCCTAGGCATCTTTTGCAACAGGC

TtH-NOX-M129TAG-H6

GCAAAAGATGCCATTGAATAGGAGTACGTTTCTAAAAGAAAG

CTTTCTTTTAGAAACGTACTCCTATTCAATGGCATCTTTTGC

TtH-NOX-Y140TAG-F78AH6

GGCAGAACATAAAAACTGCCAGCGAATGGTTTCCCTCC

GGAGGGAAACCATTCGCTGGCAGTTTTTATGTTCTGCC

TtH-NOX-F151TAG-H6

ATAGAGGGTAGTTCTAAATAGTTCAAGGAAGAAATTTCAG

CTGAAATTTCTTCCTTGAACTATTTAGAACTACCCTCTAT

TtH-NOX-F169TAG-H6

CGAAAGAGGCGAAAAAGATGGCTAGTCAAGGCTAAAAGTC

GACTTTTAGCCTTGACTAGCCATCTTTTTCGCCTCTTTCG

TtH-NOX-Y185TAG-H6

CCCCGTTTTTGAGTAGAAGAAAAATCTCGAGCACCACC

GGTGGTGCTCGAGATTTTTCTTCTACTCAAAAACGGGG

Non His6-Constructs

Construct Primer-F (5’ to 3’) Primer-R (5’ to 3’)TtH-NOX-V36TAG GGGTTGGGAACCAGATAGGTAGA

TTACACCTCTGGAGGCCTCCAGAGGTGTAATCTACCTATCTGGTTCCCAACCC

TtH-NOX-D46TAG CCTCTGGAGGATATTGATGACTAGGAGGTTAGGAGAATTTTTGC

GCAAAAATTCTCCTAACCTCCTAGTCATCAATATCCTCCAGAGG

TtH-NOX-F78TAG GGCAGAACATAAAAACTTAGAGCGAATGGTTTCCCTCC

GGAGGGAAACCATTCGCTCTAAGTTTTTATGTTCTGCC

TtH-NOX-Y140TAG-F78A

GGCAGAACATAAAAACTGCCAGCGAATGGTTTCCCTCC

GGAGGGAAACCATTCGCTGGCAGTTTTTATGTTCTGCC

QuikChange® SDM Protocol10 ng plasmid reaction (ul) 50 ng plasmid reaction (ul)

E2K-primer-F (1 uM) 6.8 6.8E2K-primer-R (1 uM) 6.96 6.96pBAD_Tt H-NOXY140 0.648 3.24Pfu Ultra II 10 X Buffer 5 5dNTPs (10 mM) 1 1ddH2O 28.6 (29.6 for control) 26 (27 for control)Pfu Ultra II Polymerase 1 (0 for control) 1 (0 for control)

50 ul Total Reaction 50 ul Total Reaction

Ran PCR program “PIRO-SDM” (subdirectory 1, program 3)1. 95 C for 30 s.2. 95 C for 30 s.3. 55 C for 30 s.4. 68 C for 4 min, 30 s.5. Repeat steps 2-4 (18x)6. 10 C forever

Following PCR - Add 1 ul DpnI and incubate (37 °C) for 1 hr and then transform SDM product

Sequencing results following SDM reactions

TtH-NOX-V36TAG-H6

TtH-NOX-D46TAG-H6

TtH-NOX-F52TAG-H6

TtH-NOX-F78TAG-H6

TtH-NOX-Y85TAG-H6

TtH-NOX-I127TAG-H6

TtH-NOX-M129TAG-H6

TtH-NOX-Y140TAG-F78AH6

TtH-NOX-F151TAG-H6

TtH-NOX-F169TAG-H6

TtH-NOX-Y185TAG-H6

B. Dual-transformation of pBAD and pDule constructs

Dual-transformation 1. Thaw chemically competent DH10B E. coli cells on ice2. Pipet 50 ul DH10B cells into 15 ml culture tube3. 1 ul pBAD_TtF52 and 1 ul pDULE construct pipetted into cells4. Allow cells to incubate on ice for 20 min.5. Heat shock cells in water bath (42 C) for 45 s.6. Put cells back on ice7. Rescue cells by adding 200 ul SOC media8. Place 15 ml culture tubes in incubator (37 C, 250 rpm) for 1 hr.9. While cells are incubating warm up LB/Amp/Tet plates

a. Place plates right-side up with lid cock-eyed for 5-10 min.b. Put lid on and turn plates over for remainder of incubation.

10. Plate 50 ul of cells and place in 37 C bench-top incubatora. Place plates right-side up with lid cock-eyed for 5-10 min.b. Put lid on and turn plates over and leave overnight

11. Next morning take plates out of incubator, parafilm, and store in 4 C refrigerator

(Performed under sterile conditions)

C. Expression and Purification of Tt-H-NOX constructs.

Expression protocol 1. Prepare necessary quantity of expression media. (45 g yeast extract, 900mL

ddH2O and 10 mL glycerol)2. Autoclave media3. Inoculate expression media with 10 ml of starter culture4. Incubate (37 C, 250 rpm) till OD600 ~ 0.7-0.8

SDS-PAGE gel showing the successful expression (left) and purification (right) of both TtH-NOX-D46TAG-H6-pCNF and TtH-NOX-Y185TAG-H6-pCNF. (Left) Successful expression is evidenced by band ~ 22 kDa in lanes 4, 6. (Right) Successful purification is evidenced by band ~ 22 kDa in lanes 6,10.

5. When OD600 ~ 0.7-0.8 add 2.5 mL of 20% arabinose, followed by 1 mL of 1mM ALA and 1 mM UAA solution 1 hour later .

a. UAA solution is prepared as follows:i. UAA will have 1 mM final concentration.

ii. Weigh out 1/4th of the MW of desired UAA in mgs.iii. Add 1 ml sterile ddH2O and 8 M NaOH (dropwise) to help solution

dissolve. iv. Add entire solution to expression culture.

6. Expression cultures continue to grow overnight at 180C.

SDS-PAGE Gels confirming successful purification and Expression of Protein

TtH-NOX-D46TAG-H6-pCNF & TtH-NOX-Y185TAG-H6-pCNF

SDS-PAGE gel showing the successful expression (left) and purification (right) of TtH-NOX-Y140TAGF78A-H6-pCNF. (Left) Successful expression is evidenced by band ~ 22 kDa in lane 6. (Right) Successful purification is evidenced by band ~ 22 kDa in lane 10.

TtH-NOX-Y140TAG-F78A-H6-pCNF

SDS-PAGE gel showing the successful expression (left) and purification (right) of both TtH-NOX-Y85TAG-H6-pCNF and TtH-NOX-F169TAG-H6-pCNF. (Left) Successful expression is evidenced by band ~ 22 kDa in lanes 4, 6. (Right) Successful purification is evidenced by band ~ 22 kDa in lanes 6,10.

TtH-NOX-Y85TAG-H6-pCNF & TtH-NOX-F169TAG-H6-pCNF

SDS-PAGE gel showing the successful expression (left) and purification (right) of both TtH-NOX-F78TAG-H6-pCNF and TtH-NOX-F151TAG-H6-pCNF. (Left) Successful expression is evidenced by band ~ 22 kDa in lanes 4, 6. (Right) Successful purification is evidenced by band ~ 22 kDa in lanes 6,10.

TtH-NOX-F78TAG-H6-pCNF & TtH-NOX-F151TAG-H6-pCNF

D. Data showing solvation environments of sites within Tt H-NOX that were chosen for mutation

Residue Total Apolar Backbone

Sidechain

Ratio (%) In/Out

V36 (l) 130.66 116.90 17.72 112.94 92.3 oD46 (a) 59.44 23.58 0.02 59.42 52.6 oF52 (a) 1.34 1.34 0 1.34 0.7 iF78 (a)* 34.66 34.66 0 34.66 19.2 iY85 (a) 27.54 25.75 0.38 27.16 14.1 iI127 (b) 0 0 0 0 0 iM129 (b) 3.12 3.12 0 3.12 2.0 iY140 (a)* 19.42 19.18 0 10.42 10.1 iF151 (a) 81.78 71.86 18.02 65.76 35.4F169 (a) 84.71 84.64 0.14 84.58 47.0Y185 (l) 184.83 133.69 26.98 157.84 81.7 oTable I. GETAREA data for Tt H-NOX residues that were used in the study. Predicted buried sites: F52, F78, Y85, I127, M129, Y140. Predicted partially buried sites: F151, F169. Predicted solvent exposed sites: V36, D46, Y185. (l) refers to residues on a loop, (a) refers to residues on an alpha-

helices, (b) refers to residues on a beta-sheet, * refers to residues in the heme-pocket.

E. Mass Spectra Confirming pCNF incorporation

TtH-NOX-V36TAG-H6-pCNF

TtH-NOX-D46TAG-H6-pCNF

TtH-NOX-F78TAG-H6-pCNF

TtH-NOX-Y140-F78A-TAG-H6-pCNF