Special Article Mapping Epidemiology's Past to Inform Its Future ...
Transcript of Special Article Mapping Epidemiology's Past to Inform Its Future ...
Special Article
Mapping Epidemiology’s Past to Inform Its Future: Metaknowledge Analysis of
Epidemiologic Topics in Leading Journals, 1974–2013
Ludovic Trinquart* and Sandro Galea
* Correspondence to Dr. Ludovic Trinquart, Department of Epidemiology, Mailman School of Public Health, Columbia University,
722 West 168th Street, New York, NY 10032 (e-mail: [email protected]).
Initially submitted July 29, 2014; accepted for publication January 28, 2015.
An empiric perspective on what epidemiology has studied over time might inform discussions about future direc-
tions for the discipline. We aimed to identify the main areas of epidemiologic inquiry and determine how they evolved
over time in 5 high-impact epidemiologic journals. We analyzed the titles and abstracts of 20,895 articles that were
published between 1974 and 2013. In 5 time periods that reflected approximately equal numbers of articles, we iden-
tified the main topics by clustering terms based on co-occurrence. Infectious disease and cardiovascular disease ep-
idemiology were the prevailing topics over the 5 periods. Cancer epidemiology was a major topic from 1974 to 2001
but disappeared thereafter. Nutritional epidemiology gained relative importance from 1974 to 2013. Environmental
epidemiology appeared during 1996–2001 and continued to be important, whereas 2 clusters related tomethodology
and meta-analysis in genetics appeared during 2008–2013. Several areas of epidemiology, including injury or psy-
chiatric epidemiology, did not make an appearance as major topics at any time. In an ancillary analysis of 6 high-
impact general medicine journals, we found patterns of epidemiologic articles that were overall consistent with the
findings in epidemiologic journals. This metaknowledge investigation allowed identification of the dominant topics
in and conversely those that were absent from 5 major epidemiologic journals. We discuss implications for the field.
bibliometrics; knowledge; periodicals as topic; terminology as topic
The definition of epidemiology has not changed significantlysince it originated. A review of 70 epidemiology textbooks pub-lished between 1931 and 2014 shows that epidemiology hasconsistently been defined as the science of understanding thedistribution and determinants of population health to be ableto intervene to control or prevent disease (Web Table 1 andWeb Figure 1, available at http://aje.oxfordjournals.org/). How-ever, the scope of epidemiologic study and practice has ex-panded substantially over the past few decades. Between 1974and 2013, there was a nearly 6-fold increase in the use of theterm epidemiology in papers indexed by MEDLINE.
Motivated in part by changes in funding opportunities andin the scale of population-based studies, several recent com-ments have been concerned with potential future directionsfor epidemiology as a discipline (1–7). However, much ofthis soul-searching has been informed principally by expertopinion, with little evidence to guide our thinking. An em-piric perspective on the field’s evolution may be useful tohelp guide our collective thinking about future research direc-tions for the field (8, 9). A large-scale content analysis cantrack how areas of epidemiologic research evolve, with various
areas gaining or losing importance. Underrepresented researchpaths might be due to a lack of attention to important areas thatneed to be looked at in the future.
Metaknowledge investigations can complement the ongo-ing self-reflection in the field (10). Because they involveanalyzing large quantities of texts, metaknowledge investi-gations have the potential to allow the investigation of thedistribution and relative influence of topics over time (11).Considering that what we, as epidemiologists, write shouldreflect our vision of the discipline, such analysis may helpus shape the discipline. Therefore, we aimed here to providean empirical perspective on the field of epidemiology byidentifying the main topics in 5 major epidemiology journalsand assessing how they had evolved over the past 40 years.
METHODS
Selection of articles
We considered 5 high-impact epidemiology journals: theAmerican Journal of Epidemiology, the International Journal
93 Am J Epidemiol. 2015;182(2):93–104
American Journal of Epidemiology
© The Author 2015. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of
Public Health. All rights reserved. For permissions, please e-mail: [email protected].
Vol. 182, No. 2
DOI: 10.1093/aje/kwv034
Advance Access publication:
May 14, 2015
Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018
of Epidemiology, the Annals of Epidemiology, Epidemiology,and the European Journal of Epidemiology. Their impactfactors are among the highest for the category public, envi-ronmental, and occupational health of the Journal CitationReports, and these journals are widely considered the jour-nals of record (12).We retrieved from MEDLINE via PUBMED the records
of all indexed articles published in these 5 journals up to2013, without any restriction on article type but includingonly articles for which an abstract was available. The se-lected articles were categorized into 5 time periods, andwe aimed to have approximately equal numbers of articlesin each time period. Data were analyzed separately for eachperiod of time.
Linguistic processing
For each article, we extracted the title and abstract and thencombined them into a single string. We discarded the wordsused to denote the structure of the abstract. Grammatical tag-ging allowed us to identify the part of speech (e.g., noun, pro-noun, adjective, noun, or verb) and assign the lemma (itscanonical form) of each word of a string. For instance, “genes”and “gene” would be assigned the lemma “gene.”Moreover,we developed a thesaurus that allowed for merging of differ-ent spellings of the same word (“ischaemic” and “ischemic”)and for merging an abbreviation with theword or phrase itself(PTSD and “posttraumatic stress disorder”). Each string wasthen reduced to a set of noun phrases, that is, single nouns orsequences of adjectives plus nouns or nouns that belong to-gether (e.g., “cardiovascular disease” or “relative risk”). Inthe remainder, noun phrases were referred to as terms.Terms that occurred multiple times within a string were
counted only once, and we discarded the terms that occurredin fewer than 10 articles. The relevance of each term was esti-mated as the degree to which the occurrences of the term wereoriented towards 1 or more topics underlying the articles. For agiven term, it was measured as the Kullback-Leibler distancebetween the distribution of (second-order) co-occurrences be-tween that term and all other terms and the overall distributionof co-occurrences over all terms. We selected the top 60% ofthe terms with the highest relevance (13).
Mapping and clustering of terms
The selected terms were positioned on a 2-dimensionalco-occurrence plot and were grouped into clusters based onthe co-appearance of terms. A normalized co-occurrence fre-quency was derived for each pair of terms. The locations ofterms on the plot were determined by minimizing a weightedsum of the squared distances between all pairs of terms. Min-imization was achieved through stress majorization (14).Consequently, terms with high co-occurrence tend to be closeto each other, whereas terms that are far away from each otherdo not or rarely occur together in the same article (15). Theterms were also assigned to clusters using a weighted variantof modularity-based clustering (16, 17). We characterizedeach cluster by providing a heading based on the terms inthe cluster. We assessed the relative importance of clustersaccording to their share of terms relative to the total number
of terms. Clusters of terms are interpreted as major epidemi-ology topics, and clusters located close to each other in themap indicate related topics.For each time period, the resulting maps show terms as la-
beled nodes in the co-occurrence network. Node size is pro-portional to the term frequency of occurrence, so that thelarger the node, the more articles include the term. The clus-tering of the terms is displayed on top of the map by coloringnodes based on the cluster to which they belong. Analysis in-volved the use of the VOSviewer software, version 1.5.7(Centre for Science and Technology Studies, Leiden Univer-sity, The Netherlands) (18).
Identification of bursts
To identify topics that attracted attention in epidemiologyresearch but eventually faded away, we used Kleinberg’sburst detection algorithm to identify words that experiencedsudden increases in use (19, 20). The algorithm assessesstates of the document stream, with different frequencies ofindividual words, and identifies state transitions, that is,years around which the frequency of a word’s usage changessignificantly. The analysis generates a list of burst words, to-gether with the intervals of time during which each burst oc-curred and the intensity of the burst. We visualized the top100 burst words graphically on a horizontal bar chart, withpublication year on the x-axis, burst words on the y-axis,and a bar from the start to the end of the burst. The barwidth is proportional to the intensity of the burst. Barswere color-coded according to the major epidemiology top-ics, as previously. Some words did not belong to any partic-ular cluster, and the corresponding bars were left uncolored.Analysis involved the use of the Science of Science Tool,version 1.1 β (Cyberinfrastructure for Network Science Cen-ter, Indiana University, Bloomington, Indiana, http://sci2.cns.iu.edu).
Ancillary analysis of high-impact general medicine
journals
Because many epidemiologic articles are published out-side of epidemiology journals, we performed the followingancillary analysis. We considered 6 high-impact generalmedicine journals: The New England Journal of Medicine,The Lancet, The Journal of the American Medical Associa-tion, The BMJ, Annals of Internal Medicine, and PLoS Med-icine. To identify articles most likely of relevance to the fieldof epidemiology, we analyzed how the articles published inthe 5 epidemiology journals were indexed with MeSH termsin MEDLINE and we derived the following sensitivity-maximizing search filter: “epidemiology” (Subheading) OREpidemiologic Factors (MeSH) OR Epidemiologic Methods(MeSH) OR epidemiologic studies (MeSH). Using this filter,we retrieved from MEDLINE the records of articles with ab-stracts that were published in these 6 general medicine jour-nals during the same time period that the other articles in the 5epidemiology journals. The selected articles were catego-rized into the same 5 time periods. We applied the same lin-guistic processing to the titles and abstracts, and we mappedand clustered terms into major topics, as previously.
94 Trinquart and Galea
Am J Epidemiol. 2015;182(2):93–104
Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018
RESULTS
Characteristics of selected articles
We selected 20,895 articles. Overall, 42.7% were publishedin the American Journal of Epidemiology, 21.7% in the Inter-national Journal of Epidemiology, 10.2% in the Annals ofEpidemiology, 10.9% in Epidemiology, and 14.5% in the Eu-ropean Journal of Epidemiology. Figure 1 shows the evolutionover time of the yearly number of articles across the 5 journals.In all, 3,725 (17.8%) articles were published between 1974and 1989; 3,948 (18.9%) were published between 1990 and1995; 4,492 (21.5%) were published between 1996 and 2001;4,180 (20.0%) were published between 2002 and 2007; and4,550 (21.8%) were published between 2008 and 2013.
Mapping and clustering of terms
Figure 2 shows the mapping and clustering of terms overtime. Table 1 shows a summary of the clusters of terms andthe evolution of major epidemiology topics. The map for1974–1989 contained 5 main clusters of co-occurring terms,which corresponded to infectious diseases epidemiology,cardiovascular diseases epidemiology, cancer epidemiol-ogy, reproductive and perinatal epidemiology, and nutritionepidemiology.
These 5 major topics were identified consistently over the1990–1995 and 1996–2001 periods. In addition, a clustercorresponding to female cancer epidemiology was identifiedfor 1990–1995 but disappeared thereafter, whereas a clusterrelated to environmental appeared during 1996–2001 andpersisted in the subsequent periods.
For the period of 2002–2007, infectious and cardiovascu-lar diseases epidemiology remained among the top majortopics. However, the cluster related to cancer epidemiologydisappeared, and the nutritional epidemiology cluster gaineda larger share of the term map. Moreover, a cluster related tomethodology appeared during 2002–2007, ahead of repro-ductive and perinatal epidemiology and environmental epi-demiology, and persisted in the subsequent period.
Finally, 2008–2013 saw the appearance of another clusterrelated to meta-analysis in genetics, and the period included atotal of 7 clusters. Cardiovascular diseases, nutrition, and in-fectious disease epidemiology remained the top major topics.Reproductive and perinatal epidemiology and environmentalepidemiology completed the picture.
Identification of bursts
The analysis of the 100 top burst words showed similarpatterns (Web Figure 2). From 1974 to 1999, all of the bursts
0
200
400
600
800
1975 1980 1985 1990 1995 2000 2005 2010
Publication Year
No.
of A
rtic
les
Journal
American Journal of EpidemiologyInternational Journal of EpidemiologyAnnals of Epidemiology
EpidemiologyEuropean Journal of Epidemiology
Figure 1. Number of articles published per year from 1974 to 2013 by journal.
Metaknowledge Analysis of Epidemiologic Topics 95
Am J Epidemiol. 2015;182(2):93–104
Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018
liver ciciiiirrhorrrrrrr sis
invasive cerrrrrvicavvvv l cancer
respiratory syncsynsynsynsysy ytial virus
older pepepepepepepeppp rson
hohohohomiohomihomimih imih mimh ihh cidecicicicicc
equaequaequaequaequaquaequaequaal nnnul nnul nul nl numberbebebbeebe
yeararararararararar old
seeeroese logiogiogigiogiogog c testststst
Los AngeAnAnAnAnAn les
ill perspepepeep on
control l oll lll l wwwomawwwww n
compcompcompcompcompcompco lemeemeemeemelemelemelementntntnt fntntnt ixation
ChinChinChininneseee
reeeeinrere fectfecfecfececece ion
healheaeaeaeaalalalalth cth thth th h h are emeremerememermermermergencencencenencgencg ee
downowowowowow
case fatfafafafafafafaffa alitlitlitlitllitititittyyyyyyy
packpacpacpackpacacacacac
cupcupcupcupcupcupcupcupcuc
C.trachochochohochochochomatis
beveveveveveeragerageragerageragerageragerage
Upstatee NNNew NN York
estiestiestiestieseses matomatomatomatoooomatoomama rrrrrrr
adennnnnnovovovovovoviro us
typepepepepepepe B
beerbeebeeeebeebeeeeee
H1N1H1NH1NH1NNH1NH1N
Cauucucucuucucccaaaasiaaaaaa n
dididiardiardiardi rhearhearheaaaal didididil dil didid seaseaseaseaseaseaseassees e
caffffffffffffffcacacaca eieieiineieiei
uriccccccccc aaaciaaaaa dddddddd
Tecucucucuummmmsehmm
presssssschoochoohchoochoochoochool child
mousmoumoumousmoumou eee
H3N2H3N2H3N2H3N2H3N2H3N2H3NN
Taaaiaaiaiwanwanwanwanwanw
nosnosnosnnosnosn snosnosococococococococoococcomiamiamiamial iiil il infenfenfenfenfenfefeccctcticct onononononono
Washinhinhinhinhiinhinhinhinhingtogtogtogtogtogtogtogtog n Stattattattattata eeeee
sssttrtrtrstrttrttsstttstsss atificficficficficficficficaatiaaaaaa ononononononononononnnnnnnnnnsststaststataayyyyyyyyprinnncincincincinciplepppleppleppleple
parpaparparrparrtnnnnetntn r
IndIndIndnddII iiaiaiaaaaiacururururururrenrerererr t tt st st t st sssmmmmmokmm er
codododododo eeee
trtrtrrararararararaitititititititti
ovaoooooo rian cn cn cn cn cn cn cn cancananananananan er
miidididididididdledledleddd -agagagagagagagagagaged eee man
chechecheemicmimimimi al
Mexicann An An An An An An An AAAn Amermemermermermemememericaiiiii n
hoshoshoshoshososttttt
subbbbbbbbtytytyptytytytyyy e
hepatitis BeBeBeBeBeBe annnnntigtigtigtigigtigtigene
gaigaigaigaigaigaigaigaigaigainnnnnnn
efficcciccicieeenceee y
dogdogdogdogdogdogdogdodo
cononononononononcepcecepcepceppppcepcepceeppttiot n
altaltaalta ernernrnaaatttiaatiaativeveeeeeeve
babbabbabbabbabbabbabababy
USAUSAUSAUSAUS
lymphophophophophoma
Indnddndddndiaaaanaiaiaia
asttstststttthmmmmamhmhmhm
postmenopopopopopopppaaauauaususausaa sal al l alll al womwomwomwomaaaan
Meeexeexexicoicoicocococococo
insinsinsinsnstiiitiittuttttitutut onnnnnn
deeefeeefeefecececctctctctcteccecc
biabiabiabiabibbiasseeeseessseseee
wiwiwiininnteeeertete
sssserss ococococococoonvenvenvenvenveeeeersrsirsirsirsirsisiononononononon
mmmmormmmore ye yye yeareararrrrraa HIVHIVVHIVVHIVVHH
BBBraBraBraBBraBrB zilzilzizilzilzili
total chhhhohohhoooleeeseleelele terrrrrrrrroooolooooo
respiratoooooooryy y y ryry illillillillllillillness
perperperperperperpepepepe foororrorrmaamaanamm ce
iscccccccisi ci ci chaehaehaehahaaeaehaaeaehaahaemiciicicciiicmiccmiccm cmmicccm ccm ccccm hhhhheheheehehhehhhhehhhhhhhhhehheartartaartartaaaartartaartartart didididididdddd seaseeeeeeee
coooouoouoououggghggggggg
cccofcofcofccofofcoffeeeeefeefeef
boyboyboyboyboyboyboyboyboy
birbirbirbirbirth th th hh cocoohohcohhhhhortorortrtrtoortortrtortort
higggghighh h rh rh rh rh rh rh rrrateateateateataaa
AIDAIDAAIDAIDAIDAIDAIDS
preeeeeeeeessussuuuuuusssssss re
girgirgirgirgirgirgirgirgg lllllll
accaccaccaccaaa cideeeideidentntntntntn
colcocococollo ononononnnnnnn
fffalf lfalfalf lllllll
fatf ttfatfat
dririiirirrrrrinkenkekekekekekenker
prooootttectecttectecte ttiotttt n
deeeleeeleeliveiveeeeeiveeeiveeveryryryryry
islisisisislislssssss anndanannnddddaannandnd
cancancancananccerccercercece ririririrrririskssssssstumuumtumumorororororo
resrrr piratooooory ry ry y disease
anananiannininia mmmalmammm
proprororoproproropropp op tectectecteteccccecteccccccctivttivtive eee ee ee ee ee ee ffeffeffeffeffeffeffeffef ct
orgorgorgorgrgorgorgrorgorgaananianianianismsmsmsmsmsmsmsm
schhhhhhooooloooloolccchiccc ld
TTTexTTexTexaaasaaa
assssssumpumpumpumpumpumpppption
maymaymaymaymayymayma
cancananancancanananaanccececer inininncicidcidcidcic encencencncccceeeeeeleueueueukemkemmmkemkemmmmkemmmiaaa
innnfnfnfnnffluluelueluel nnnzannn
biririrthhthhh hthh hhh weieieiiweiieieiweiweie ghtghtghghtghtghtghtghghghghtghththt
oral cl cl cc cl cconononontonntonntn racracracaccccraceptepteptepteptiveveevevevevevve
sepsepsepppsepppseptemtemtemmmtemmberberberbbberererraugaugaugaugaugu ustustustustustststus
preprepreprepreeeprepredidicdicdicdictortotttortotortortortotorto
regregregregregregreegrere resrerereree sssiosssiosion m m mmn mn odeeeeelllllll
ppappapaparppp ityyyyty
highhhhhhihhh h-ddddddddddensensensensensensensensensitititityityityityityy lililililiipoppoppppppopppoppopo rotrotrorotrotrotrotrotrototeineineineineineinein chchchchchchchchcholeoooooooo sterol
ememempemppeee ployloyloyloyyyyyyeeeeeeeeeeeeeeee
seseeenensenseseseeeenensenensitsitsitivviviviviiviv tyyyyyytytytt
cucuculcuululcu turturturureeee
synsynsynsynsynsynsyndrodrodrodroooodrommmmmemm
myoooooooooocarcarcarcarcarcarcararcarardiadiaddddiaddiadiadial iil il il l infarcttttttionionionnioniono
houhouhouhouhouhouhouhouoo sehsehsehhhhhholdoldoldolddd
hephephephephephephhhepatiatiatiatiatataa tistististist B B B B sursursursurfacfacfacfacfacff e ae e eee ntintintitntigengegegegegg
scscscschschschsccc oolooloololololool
ddidieddieieied ttttt
alllllllcocohohoooooohol
brbrbrbrbrbrbrbrbreaeaeaeaeaeaaaeaeaastststststssss ccccananannnnnnanancecccc r
apapapappppprprprpppp oaaaaaoaoachchchchch
hyyhyhyhyyyyyyyypepepepepepepepepeerttrrrrtrrtennnnnnenennsisisisisisississisiononooo mmmmemememmmmemmmememmmmemememmmmemeasaaaaasasurrururreeeeeememmmmeemmeeee ennnnnnnnnnnnnnttttttttttttt
sususuusuusurvrvrvrvrveieieeilllll ananananaannncececeee
mmomooom rtrtrtrttrtrtrtrrttalalalititityyyyy yy yy yyyyyy rararararararararrararararararaaaaatetetetettte iinniinnfafafaaff ntnttttnttnnttttntttttttttttt
cocococococoorororororoonnnanananaaaanarryryyyyyrryrry hheaeaeae rrtrtrtrtrtrrr dddddddddisssssseaaaaaeaaaaeasssesesessesse
ccoccocococcocccc nnnsnsnnnsnnnnsnnsnsnsnn umumumumumumummumptptptptptppp iooooooonnnnnn
illllllnlnlnlnesesesssssssououououououououo tbtbtbbtbrererer akakakakakaka
blblblblblblblbllllooooooooooooooooooooooo d ddddd ddd prprprp essssssssssuuuusuuuuuurererererererererre
vivivirururussssmsmsmsmsmsmsmsmsmsmsmsmsmokokkkkokokkiinniininiininingggggggggg
rerereeererereeererreeeeer lalalalalalaalala ititiiveveveee rrrrrrrrrissisisiisisisisisiskkkkkkkkkkkkkk
anananananaannntitititibbobobodydydyyyydyy
caaaaaaaaasesesesesesesesesse ccccccccconntrtrrooollolooolo sssstututututuuuuuuudydyddydydydydddydydydy
mmmmmmmmmmorrtttaaalllliiiiittttttttttttyyyyyyyyyyyyyyyyyyyyyyyyy iiiinnnnffffeeeeecccctttiiiooooooonnnn
mmmaaannn
A)Cancer
Infectious Disease
Cardiovascular Disease
Reproductive and Perinatal
Nutritional
Figure 2 continues
96
Trin
quartandGalea
Am
JEpidem
iol.2015;182(2):9
3–104
Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018
B)
C)
b-caaarororototeneenenene
dietary cholchochchochchch esterollll
cancer cer cerer cr ontrol
ruberubeberuberuberuberubbbb lla
pancncncncncn reareareaa
maternalalalaalalalalal eexpeeeee osure
maccronutononuonuonono rient
loowow oow ow ow rararaterrarrra
lungunglunglunglunglungunglungunungununnuuuun funffufunfunfunfufufunfunfunfufunffffunfufffffunnnnfunctioctictictictctcctcttctioctioioioctiotioion
soutsoutousousousoutsoutououououthhhh
rectal cl cl cl cl cl caaancer
lower prrrrrrrrrevevevaleveveveveee ence
futufufuuutttutuututufututufutufutuutuuttufu urrererere
FlorFlorFFlorFlorFlorFlorFlorFlorloFloloFlo idaidaidaiidi
chilhilhilhilhilhilhilhilhi d mod mod md md mod mod mod mm rtality
urinurinurinurinurinurinr e
sporsporsposporsporsposporp ttttttt
rQ feQ feQ fefefefefeevevv
paststaststststt yyyyeayyy r
migrmigrmigrgrgrmigrrratioatioatioatiotiotiotioatiotitiooatiotiotiotioatiot oa oationnnnnlowelolloweeeel elo eer rar rr rar rararar rar rararar atetettetetetettet
expeexexexpeexxpexpepeexpexxexpeexpeexpeertrtrtrrrrt
bronbronbrobronnnnbronnbrbb nbbrbbb chchitchchitchitchitchitchitchitchitiiisisisisis
n Gimmmummimmimmmimm nogloglogogoglogogoggg obulobuobu i
betabetetaetaetaetbetbetbee
stilstilstilstilililstilstillblblbilbilbirbilbbilb th
ratiatiratiratiratatiratiatiratira onalonalonalonalnalonalnonalonalonalononoooonooooonon eeeeeee
condondondondondondcondndom uom uom uom uom uom uom uuom uom ssesesesesse
ccarocarocarocarocarocaroottetenetettt
non-Hispspspspspspppppaaanananicaanaaa white
malamalamalamalamalamalaal ria
fetal grgrgrgrgrgrgrgrg owowtowthowowtowtowtoww
minminminminminminininnnuuuteuteuu eeu eu eee
KapKapKapKappapapaposososiosioosos
vitamamamiamiamamiam n En En E
serserserserserserrserolololooloolooloolooololo gygygygygygyggy
offoffofffoffffo iceicececeiceiceiciceee
stostostostostostostoooooooloooo
concoocononoccocococ gengengengengengengengg itaitititiit l ml ml mml mml mmmmaaaalfaaaa ormationblablablalaaablablalaalaaaaaddeddeddeddeddeddded rrrrr
TexTexTexTexTexTexTexexexexaaasa
potassassassassassassas iumii mmmm
malmmmm forororoorororrmammmmatmmm ion
fibfibfibfibffibibereeerereerer
secsss ulaulaulaulaaulaulaulalaularr tr tr tr trrrrr renrenrenrerenrenrenddddddddd
ticccticcticticcickkkkkkk
newwwwwwwwwbboboboborbbobb n
radadadradradrada iati tiiatiatttia ionionionionononionnpppppp
goagoagoagoagoagoaoagooo llllll
sexuaualualualualuaualuaa acacacacacccccctivtivtivtivtivvtivt ityityityityityityityityy
paspasassspasppp sivsivsivsivsivssivsivvsive se se se se see se se se se ssmokmokmokmokmokmokmokmokmokmokmomomokokmookmo inginiinininiiii
attattattattattattattackackackackkckckckac rrrarararraaatetete
first trrririrririmmemesmemememm ter
cascacaasaasscaascaaaasasasasscaaascacaaaascacaccc e pe pe pe pe pe pe pe ppe aaaaatiatiatiaa iatiaaaaaatiaataaa enteentntnt
serum total alalalalal al alall chchchocchccccc lesterrrrrrrrrrolololooo
ovavaovaovovaovovavaoo riariariariariariariarian cn cn cn cn cn cn ccn ancncncncereee
instrrurururururummenmmmmm ttttt
Hissssssssspapanpanpanpapanpapapap ic
hephh atiitististististististisisis CCCCCCC C C CC vvirv us
babbabbabbabbabbabbababbbabyyyyyyyyyy
milmilmilmilmilmilmilm kkkkkkkkkkk
plaplaplaplaplaplapppplplapplannntnn
energygygygygygygy iininintakke
trarararararrararansmnsnsnsmnsnsmms ittittittittttttttteded ed ed eded eeddee disdissdissdissssseeeaseaeeeaee eeeyyyyy
MarMararMaarMarMarararrylaylaylaylaylaylaylaylylylyy ndndndnnnd
faaatatataaaaatheherheertt
higher prprprprprprprprppp eevaeveveee lenleneneneenenennnccececcc
rerererelllrerelrelreelrre atatititiiiatiitiatatatiiatiaa veveveveveveveveeve
concoconcononoononoooo ccepcepcepcepcepepepeppepce ttttttttttt
meameammeameaeaeasleslesleslesleslesle
frufrufrufrufrffffffffffruuuiitititittttttttiitt
intravenoenoenooooous us us s s drdrudrudrudrdrrddd g user
arartaartaarta iclclliclclllicllleeeeeeeeeeeefatfatfatatatttttttattttfatttattfatt
anianiaaaniaa imamalmalmalmalalalalmalal
preeeegnagnagnagnagnagnagnaagnant ntntntt tt wowowomwowomwomwomwwo annnnnnn
HIIVIVIVIIVI ttytytyttt pe
boyboyboyboyboyboyboyboybobobooyy
serserseresersesesseserruummumumumummumumuuu
empempmpmpmpempmployloyloyloyloyloyyymenmenmenmemenmene ttttt
ffevfevfevffffefef erererereree
sigsigsigsigsigggggnnnnnnnnn
geggesgesesesese tatatatatttattatttatattationiononnioniono al alalalalal aall ageageagegegegegegeagag
druuuuuuug ug ug u uuuug ug uusssesesesss
deaaaaaaaaththththth rratrratratrrrrara e
diediediedieed tartarrtartatatatatatarrtt rttttarta y iy iy iy y y y iyyyyyyyyyyy ntantantantaatatatanntat kekkkkekekkekekeke
vegggggggetataetataetaetaableblebleblebleeee
eeeueueurururee ropeopeopeppopepoppeop
carcarcarcarcarrcarrrcincincincincicincc omomaomomomom
cocofcocococofcococoo feeeeeeeeeeefeeeee
culculculculcuccuccucuc turturturururururru eee
serseseseresese opropopopopropoproprevaevaevaevav lenlenlenlenlenlenlenlelennccec
teteteesesessestintintintintinnnggggg
mismmismismismmmissclaaclaclaclaclassissisisss ficficficfff atiatiatiatiationnononnnnn
eeerrerrrreerrer orororororrrrorrooor
prprroprorororororrororrroteeieieietetet n
lolloowowowowowlol bibbibiibbiibirthhrthrth wwwewwwww ight
nutnutnutnununununutn rieeeerierierieentntntttntttttt
ccccaccc rdrdrdrdrdrdrdrdddioiii vavavavavavavavavaascscscscccscsccscccululululularararraraaa rrrrrrrrrrisisisisiii kk k factor
cacaacacancnccncereeeerereereeeeeeerere mmmmmmoooroo taliliilililliilitytytyttytytttyyyyyyyyy
ccececelllllllllll
diaaaraaara rhrhhhhrhheaeaeaeaeaaeaea
cacccc nnncncnccerrererrrerr rrrrrriiisisisiisi k
ppppapapappapappapaareeeeeeentntnnn
alalallllallcocococooococoooohohohohhohohohohohholll ininininininnnnntatttt ke
sststssstsstsssssstsssststrorrororrorokkekekkekkk
pppappappappppppapp ririritytytytytytytytyttytytyttyty
spspspspspspspspspsssssssppspecececececceeeee ifififififificcccicicciiccicccciiiciciici ititittittitiittityyyyyyyyyy
nononononononononnn-n-nnnn smsmmmsmmmmmsmmmsss okokokokkkokokkokokkokkkokokerererererrrereerreerrr
AIAIAIDDSDSDSDDwwhwhwwwwhwhwhwhitititititeeeeeeeee
mmmamamammm rkrkrkrkkereerererererr
high-ddddddddenenenenenenee sissisisisisitytytytytytytytytyyy lllllliipipipipippopopopopopopopopoppopoprororororororoooororor teteteteteteteteteteeeinininiinininini cccccccccchohohohohohh leleleleleleleleeststststststssss erol
ssssususssss rvrvrvveieieillllllanananananananancecececececececececeaanianana mmm
vvavavavvaavvv liliililiddididiiiitytytytyyyytytytyyty
tetetetetetetetetechchchchchninininiququququqq eeee
phphphphhhhhhyyysyyysyyy iciciciciciiccalalalall aaaaaactctctcttivvvvvvivivvivivititititityyyyy
chhhhhhhhhoolololoo esesessstetetetetett rorororoororooroollllllllll
stsststssssts rararainnnini
ItIItItt lalalalaa yyyyyyyyyccccocococcccccocorrrrrrrrrrrrrrrrrelelelelelelelele attatttttttatattatatatttatatatata ioioiooioioioiooionnnnnnnnn
mommmmm rttttt lalalaliititty y y y y y yyy y yyyy rararaaaaaaaraaaaraaaaaaaaaratteteetetetetetetettttteeettetttetetettt
lllaalallalalalaaaaaaaaaaaaaa cocococococooohohoooohoooooooooooohooohohoohhoh llllll
wwwewweweweewewwewwweigiiiigghthththththhthhht
didididididiidiiabababaa etetetttttteseseseses HIHIHIHIHIVVVVVVVVVV
apapapappapapappppapappppppppapppprprprproaoaaaaaaoaaaaaaaaachchchccchccccchchch
bbblblbblb oooooooooood ddd ddd prprpprp esesessessee sususususususususuuusurererererereerrrr
ananananananana titititibobobobobooodydydyddydydydyd
momomom ththerereereeeeee
cicciciciciccccccciccccccccciccicciiiiiggagggagagagagg rrrrerreerrerrrereerrererrererrrrereetttttttttt eeeee smsmsmsmsmmsmmmmmmmokokokkokkokokokokkokokokokkokokiinininiiiniii gggggggggg
pprprprprp eegeeeegeeeeegnananannnncncnnncnnncncncn yyyyyy
cococococococooooonsnsnnnnsnsnnnnsnsnnsnsnsnnnnnnnn umumummumummmmptpptptptpttttppttptptttpptpptptptptppppp ioiioiiooioi nnnnnnnnn
booooooobooboooboobobobooodddydydydydddydydydydydddydyy mmmmmmass ss s s ss ininininininininndedddd xxx
cccacacacccacccac nnccncn ererererere
iiiiiiiiinnnnnnnnfffeeeecccctttiiiooooonnnn
nitnitnitrtrrateateateateate
B.gagagagagagarinirr i
standardrdrdrdrdrdrddd method
HIV epidemic
Egypgygygygygy t
westwestwestwestwestwestwesteererernern eern ern ern popuopuopuopupopupopupopupopupupopupulalalalatillalll ononononnononnn
Q feQ feQ feQ feQ feQ fevvervvvvv
nighnighhttt
HIVHIHIHIHHIVHIVHIVHIV HIV seroeroeroeroeroeroeroeroor ststststastattsst usssss
weatweatweatweatweatweatweathherherherherhhhherherhhh
ruraruraruraruraurarrurarrr l pol pol pol pol pol po popupupulapuppu tion
Japanesee AmeAmAmAmAmAmmAm rican mmammamamamamannnnnnn
hohohomihomihomiomimmmm cidecidecidecidee
tis Chepahepahepahepahepahepatittittittititit
early prrrrrrrregegegegnaegegegg ncy
dietary ary ryry ry ry ry fiber
tranranranranransfusfussfussfusfussfussfusionnnnionio
recoecoecoec gnitgnitgnitgnitgnitgngn ioniononionon
fat distststststttttribibbbubribribriri tionnnnnnn
congconggcononconconggcon eeenitee al mmmmmmmmalformation
catcatcatcatcatcatcat
CARDDDDDDDDDDIA sIA sIA sIA sIA sIA sIA sIA sIA sI sttttudyttt
itemm food frequeueueueueuency ncy ncy ncy ncy ncncy quesquesquesququesquesquesueuesuesuesuesssstiontiontiontiontiontionnairnairnairnainairainai ee
folic acc ac ac ac ac ac ac a id
ArgeArgeArArAArgArgeergA eennntinnnn a
ThaThaThaThaiaiaiiTha lanlanlanlandandandandlannneckkknneecnecckcckckneckcecceecneeneeecec
recrecrecctcctctumumumumu
neural tube ubeubeubeubeubeubeube defects
TurTurTurTururTurkeykeykeykeykeyk
hhhhhhhighhhhhhhighiggheshesheshehehheheheehesheheehhheshesh sst tt tt tt tt tttttttttttttterterterterterterte iiilei
resresresessresrespirpipipirpirpppirrpirpirraatoaatoatooatoaaaaaaaatoaatoryryryy
pplalaaapppppppppppppppppp cebcecececece o
eggeggeggeggeggeggeggggggggggggggggg
CARARARARARARARARARDIA
plalalalaaantntntnnn
multivvvvvvvvitaaaaaitaaitaminnnnnnnn
lung fg fg g fg fg ffg fg funununununcunununnuu tion
adeadededeeeadeeeeeennonoococnonn arcarcarcarcarcinoinoinoinoinomamamammamaammaa
userintntntntintntn ravravravravravvenenoenoenoee uuusus us us dddrudd g uggg
CD4CD4CD4CD4CCD44 cccoccc unt
biobiobiobiobiobioibioiopsypsypsypsypsypsyy
bbebebeeeeeebeeebebbbebbbbb r
fetal grogrogrogrogrogrogrogrogrogrog wth
rrecrecrecrecrecrecrectaltalllltaltaltaltaltall caaacacac ncececececececececerrr
WaWWWalWalWalWWalalWWWWW eesesesesseseeseshoo
oooiloiloilo
liiititlittlititlitlitittletletleletleetletle eeevevevevee idddedddidid ncececececececeee
bevbevbevbevbevbevbevveraeraeraeraeraeraeraeraeraer ge
insuliuliulilililiulililiin ln ln lllln leveeveeveeveeeeveeveellll
smsmsmsmmmmmosmsmmomokkkekekkekkekekkk
parpapapapapapa ticulaulaulaulaulaulaulalatetete e e e te matter
winwiniiinwinwinwiwinwinnnneeeeeeeee
utiutiutiutiutuuu littlitlityyyyy
tictictictictickkkkkkk
ccccororororororo recrecrecreeccecreeccrre tititiotittiottiotttiottttionnnnnnnn
adult popopopoppopopopopoppuulaulauuuulaulalatiotiotiotiotiotioionnnnn
neural tutututututuuuuubeeee eebebebb defectectecectectectctct
teateateateateateateat
impmpmpmpimpimpimpimpm lemlemlemlememlemlemlemlee entententententntntntatiatiatiatitititiatt ononononononnn
warwwwwwawarwarwwwarwamalmalmalmalmalallignignignignigig aancanca ccca cyyyyyyy
Hisssssssssssssspapapapaaananaananpapapaanaaapaap iiiic
energgygygyggy ininininininnntaktaktaktaktaktaktakktaktakktatata eeeeeee
wwwaiwwaiwaiwaissstsssss
intintintinttintnintintrodrodrorodrororodo uctuctuctctctcttuc ionionionionionionoi
ccrocrcrocroccroroocc ssssssssssssssssssss
biabiabiabiabbbb seeesesesees
abbobobobbobbortiiiiiirtirtion
memelmelmelelelelelele aaanoanoanoaaanoanomamammamama
diadiadiadiai rrhrrhrrhhrrheaeaeaeaeeae
resresesr sr spirpirpiririrrirrpppp atoatoatoatoatoatoatoatoatatataatatoaaat ry ry ryry ry ry ddddddidisdisdisdisddisdiseeaeaeaseaseaseaeaseaeaaseaeaaeae eeeeee
spospospospospospospospontantantantantantantant neneoneoneoneoneneeooousss usssusuus aboaboaboaboaboaboabortirrrr on
excessessessessessessessessesses momomoommomoooooooortartartartaarrtartartaalilitlitlitlitllilii yyyyyyy
vitvitvitvitvvitvitamiaaaaamiamin nn Cn Cnn n C
higggggggggh-dh-dh-dh-d-dh-dh-dhhh ensensnsnsensensen iityityityityyy liliiliililipoppoppoppoppopoppo rotein
fevfevfevfevfeveveee eerererer
lunlunlululu gggggg
stastastastatastastastandandandadadadadaaadadardrdddidirddirdrdirdrddrddrdrd zedzedzededzedzeddzezezzeedeed momomooooomooooooortrtrtartartartrtartrtarrt litlitititlittlitititlitlitittlitity ry ry ry ry ry ryyy atiatiatiatiatiattiatat ooooo
insinsinsinsinssssinsssinsnsnsstrrrrrurrtrtrtrttrtrrrurummmmenmenmenennenmenmenmmmmmennmmemmmenennm nnenmem ttttt
horhorhorhorhorhorhorhoro momoomooonmooo eeeee
detdetdetdetdetdetectectectttec ionionionioon
coooofooofofofofcccc feeeeeeeeeefeefeefeefe lyymymymymlyymmymlymlymymmphophophophophop ma
enenzenzenznnenzymeymeymmeymyyyy
seseeeeaaeaaeeseeeasososoooonononsooononso
leuleuleuleuleuuleuleuukemkemkemmkemkemiaii
tumumumtumumumtutuumtuututut morororooror
sersersererseropropropropropopropp evaevaevavalenennnnlenlele ce
eleeleeleeleeeleeleeleleee vavavaatatavavaatedd dedddd dedd risssrisiskkk
corcorcorcorcorcorcorcororcc lrelrelrelrelateateattateateateateateateateateeatateeataatateateateate
insininnnininssinsnsssuliuliuliuliliuliulinnnnnnnnnnnnn
admadmadmadmadmadmadmaa ississsssissssionionionionononi
nuuuutuututrieeeerieerientntntntntntnt
matmatmatmatmatmatmatmatatatereeernernernerne al alal alalalalaa agagageageageageageageee
pospospoposposostmetmetmetmemmmenoopopopopopooppnnn pausauussssusaua ssssssssssssaaaalaaalalalalalalalaaaaa wwwowomomomomomomomomwomwomwomomomwommmananananannana
aairairairaairirirairirr pppppoppopollululluuuuuuluuuuuuul tttiotiotiotiotttiotiotionnnnnn
exxxcxcxcx essssssssessess
gengengengegeggegeg eeeeeeeeeeeee
coecoccoecocoecoeooecoeeeeeeeeeffiffifffiffffifficciiieiicccic ntntntntntntnntntnt
brereerererereastastastastastastastaast cacaccccc nccecenccecececer rr rr rr rr rr rr rr rriskiskiskiskiskiskskkk
AIDAIDAIDAIDSSSSSSSS
ststststss rarararainnnnininin
bblblbbbblbbb acacacackkkkkkkkk
aaaagagagaa eenenennnntttt
asasassssassasassa thhththhmamammmaaamaammamaa
highhhhhh-d-dd-d-dddenenenenenenennennsssisisisisisississ tytytytytytyty lllllliipipipipipopoppopopopo rrrrrororrroooteeeteeteeeett ininininininininn cccchohohohohohohohohoolelelelllllll stststerererererrerrrerolllololololololololo
apapapapplplplpp icici atattatioioioionnnnyyyy
nnnnonnonnnnnnnon nnnssnsnsnsmmommooooomomokekekekekekekeeekeeekek rrr
eeereeererrorororrrrrrr
lulll nnnngngnggngngg ccccananancecececeecerrrrr
vvvavavvvalililidididitytytytyytytyy
ststststststrarararatetetetegygygygyg
oooboboboobbbbesesesesitittttttitityyyyyyyyyyyy
alaalalalalallcococoohoohohohollldididididddieteteteteeet
ccccacacaccacarrdrdrdrdiioioiioiooooiovvavavavavaaaassscscscs ululularararararr ddddddddddddisissisisssisisiseaeaeaeaeaeaeaeaeaasesesesesesesesesee
HIHIHIHIVVVininn
ala cohol lll lll cccocococccocococoonsnnsnssumumummmmummmptptpttpttttttptpttptptptioioiooooiooooioioioioiioiooi nnnnnnnnnnnnnnnnnnnnnnnn
brrrrrreaeaeaeaeaeaeaeastsstst cccaananaancecececececeeececeeecececerrr
apapapapapapapappprprp oaoaachchchchchchchh
bbibiib rtrtrtrthhhh
prprprprrprprprprprpregegegegeeeeee nanananaancnncnncncncccncncncncnncncyyyyyyyyyyyy
cocccccoconsnsnnnssnsnsnnnnnnnnn umumumummmumumppptpppttp ioioioioiioioioooionnnnnnirrrrireeeeere
bbbbbbbbbbbbboooooodyyyyyy mmmmmmmmmmaaaassssssssss iiiiinnnnnnnnnnnnnddddddddddddeeeeeeeeexxxxxxxxxxiiiiiiiinnnnnnfffeeecccctttiiioonnn
Cancer
Infectious Disease
Cardiovascular Disease
Reproductive and Perinatal
Nutritional
Environmental
Cancer
Infectious Disease
Cardiovascular Disease
Reproductive and Perinatal
Nutritional
Female Cancer
Figure 2 continues
Metaknowledge Analysis of Epidemiologic Topics 97
Am J Epidemiol. 2015;182(2):93–104
Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018
D)
ankle brachiachachachachchach al index
winewinewinewinewinew
readadadadadadermultivariatteeeeee relrelrelrr ativaa e risk
chromosomomomomomo me
tototototatototot l efefef efefeffect
meanananananannnssssss
low-w--w----densnsdensdensdensdensdensensdensdensitytyyytyyty lipolipolipolipolipolipopolipolipolipoprotprotprotprotprotprotprotprotprotprotprotprotproproteineineineineineineineinne
inseininii cticcticctictcticcticccticideedededdeeideidediddedeedddeideeidede
fefefetutututufetuufe ufe uuuuf sssessessesessss
ndistinctincncncncncncc io
casecasecaasasasas -crossovsovsovsovsovssover dee esign
aaaacycaaaa lic c c c cc ggrapggggg hdi ti
poisoisiiiisiiisssssonssssss
Norwegiaiaiaiaiaaaannn monnnn ther
large ste ste se se se stee ste stse ste se s udyudud
inflnflnfllnfluenzuenzenzuenzenzenzza via via via via va va via viv rusrrrr
recreceeecerecrecerececerececeiptiiptiptiiptiipipparepapareareareareparepareareea earerentaltttt llll edededuedueddududduedededddduduedddd catititionononnnnnn
pancreeatttic cc cc cc ccc cc canceaaaa r riskskskkskkkNNIH-NIHNIHNINIH AARPAARPAARPARPAARPAAAA diediediediediediettttt
miscccccarriarriarriarriarriarriarriarriageageageagegeageagageagagageagaggeagaagg
idedeideadeedeadeaideaaideaiddedeadeaed ad addddeadea
HIV HHHHH testtestestetestestes ingngnggg
child cooooohorthohohohorthohohort ttstutststststststsst dyddydyddydydyy
viololololllatatioatatatat n
micrcrcrrrrogogog mogogog
mendmemmmmm eliaaaan rn rn ran rn rarandomnnnnn ization
auauauuutitiutiutiaututiautautaaauuutiaaaaaauaaa sssmmmsmsmss
actactactactactaact
HIVHIVHIVHIV/IV/IV/VV AIDSAIDSAIDSAIDSAIDSDSAIDSSS
sstttstudstudstustustudstsssssstudy rey ry reeeererereesultsultsultsultultsss tsss
rrrruuraruraruraru l arl arl arl arl arl arl araa ea
wintwintwintwintwinwinwintinteeeereee
neural tubeubeubeubeubeubeubeubebebe ddddefedd ct
medimemmmm ation an an an ann an aa alysis
folafolafolafolafolalaatttetetet
fetuetuetuetueetetuetusssssssss
pestpestpestpestpestpestpestpestpestpestpestpestpestestpestpesepespestestspestp icidiiiiicicidiicidicidicidicidcideeeeeeee
discisciscscscscsscipliipliipliipipliipliplliiplplp ne
seasseasseasseasseseasseassesss onalonaonononononon ity
intententententeiinnteiintentei lliglliglliglliglliglliglliglliggeeenceencencenceenceeeenceeeeeeee
firsfirsfirsirsfirsrsrsrsst bit bit bit bit bit bt biit rthrthrthrthrthovarovaovarovarararrv ianian iann nnn n canccanccanccancanccanccanann erererrr
hhhhhh
genetic assooooooociaiatiaaciacia ion ion ion ion onon study
evolevolevolevolvoevoevoevollo utitiutioutioitiotiotioonnnn
breareareaeaeaeaae st csssss anceaanceanceanceanceancancer car cr car car car car car asesesesee
ARICARIARIARIARARIARIARARARAR
formrmrmrmmmulaulaulaulauu
alleallealleeaaaalleealleeeergrggyggygggrggrgrggggyg
acciccicciccccicciacciaac dentdentdenddentdentdeententeneen
sucsucsuccsuccucccccessssssessssesss
genetitictic tiic ic eeffeeeee ct
urinrinrinrinrinrinnneeeeeee
communinitniitniititieeees ieeie stustuststustustustudstust y
parparpartrtrtrtrticicclecicicicc
calicacccccaaccaa bratbratbratatb attioioioononononononioonnioioidddddddididdidddiddddid
H1NH1NH1H1H1N1H1N1H1N1H1N1H
arsarsarsarsarssessearssarsrsesea nnnicnnnn
preeclamclamclamlamclamcllamlampsiapsiapsiapsiapsipsisispsispsisssspsipsipsipsip
ccccarcarcararcarcaccarrrrrrdiodiodiodiodioddiodiodiodiodididiodioddiodiodiooood vasvasvasvasvasvasvasasvasvasasasv svasscuuulcululcuulllaaaar aaaaaa eveevevev ntntnt
calalallallcciuciuciucciuciummmmm
hhhhheahhhhh rt rtrtrtt tt faaaaiafafa lurrreeeeeeee
deadeadeadeaeadeadeadeadeadeaeadeaadeaddeadeaeaddeddead aadd ttttth thtthth th th rraraaatrrarararaararrr eeeeee
aggggegegeeeeegg nntntntntntntntnntntntntnttnntnnntnnnnn
estesestesestestestrogggrogrogoggenenenenenenen conconnnnnononcononcononceepppppppepceeeptttttt
cohorororrtrtrtr pprpprprrrrrpppprrooofiofiofiofiofiofio iofioooooo lelelelelele
thththhhhethhehhehethethhhthehhhhthhthtt ooororrryorrrfrffrufrururuititttiit
gengengennnegenngenngengeneee-eeeeeeeeeee nvironnnnmememenmememe t interaction
altaltaltaltaa ttererernerrnrnrnrneeeeer aaatiaaaaa ve
ccancacancancacancancanancancaaacancccccancccancccercerrrrrcercerccerrrrrr moooooooooooommommortartartartartartartaalititttlitlitlitlittti yyyyyyyyy
scsscsciciciiiiscsciiciiiiencencccenceencenen e
sususuupssusu pplpleplppleleplpleemmmenmennnnnnm nmmmennnmm tttttttt
ssuiisuisuisuisuiss cidcididciddciddddc ddeeeeeeeeee
mmmmmenmeneneenmenmenenenenennmenmmenmenemenmmeneenmm tttatat ltaaltaaalltallttala hhheheheheehhhhhhhehhheehhehhehheehhehealtaltaltltltlttthhhhhhhhhhhh
outouttttttbrebrebrebrebrebrebreakakakakakakakkk
mmismmmmmmm claaaaaaaa issssssississsssissssiss ififiicfiifi atiiiioononononono
goagoagoagoagoagoaggggggg llllll
p p p vvvvvp vp alualuluuuualualuuuuualuluuueeeeeee
lifliflifliflififfl e ce ce ccccce c cccce ce e ourururoururoururrrseseseseseseseeseeesesssessssesesse
temmmmmmmmperperpepeperpepperaaaatuaaa re
mmedmedmedmedmedmedmmmmeddm dmedmmedmme iaatiatatttiaiatiaiaiaatiooonioonoioooiooii
vvvvvirvirvirv usususssss
spespespepespeespeeeecifcicifcifcifcifcifcifcifcifcific ic ic iciccic iciciciic mormormormormormorororormorormooooormoooo taltaltaltaltaltaltaltalalityyyyyyyyyyyyyyyacciacciacciacccc dededenteent
samsamsamsamsamsampppleppleplep sisisisiisisiizezezezezezezeze
carcarcardiodiodiodiodiodidiodidioddd vasvasvasvasasasvasvasvasvvv ccculcculcculc llculculaaar raaarr r ar r r aa mormormormormormormormomomo ttatttaalalalalatataaltataalaalaa ityytyityityyityityi
gggirgirg rgirrrlllll
vacvacvvacvavacvacvacvva cinnnncincinc eee
epiepiepiepiepiepiepepepip demdemdemdemmmdemmmmicicicicicicc
tuuuumumumu ororororroofifififiefiefief ldddddlddld
covcovccovcovcovcovcovvcovvvvcovovovvvcovcovcovcovovveeraeraae aeraraagegegegegegegegege
sssssceesssceescss esss nnararrnararrrnn rarrrrarnarrrrnn ioiooioioioi
resesesresesssssr sourouroururou cecececeeeeee
aaaallaaaaaallaalleleeeeeleeleeeeeeeeeel
seseseeeaeasooooonononononononononnnonosoo
innnnineinenineininineiniii quaquaquaaaauaquaqu litlitlitttlitityyyyyyyy
sysysyssssssyssyssysy totoltoltotoltoltotototooo ic ic icicic bbbbblblobloblobloooodododddddoddodo prepreprepreprepreprerep ssussussussusussusussussusuuusurereereresspsppppp
sseseseseseseseseelseselselselseeleeeleeesee eeecectctectee ionioiononn
particcculaulaulaulaulauuu tete te te e matmatmatmatmatmatmatmatm tttterttt
simsimsimsimsimsimss lulaulaaatiotiotiotiotiotiot nnnn
lunuununlunnunnnnung cgggg cgg cg cggggggg cg cg cggg annncncncncnccnncccncnnnnnncannanncana eeeeererereeerre
cigiiicigcigciggarearearereeeereeeeeareeeareareeaaa ttttttttettetttttttetttt smsmmmmmmms oooookioo nngngngnggnnnnsususuuupppplplpleep mupppp
vvvvvaaaaararvavavavaaavaraavaaa iaannnniananniaaiaii t
ddddededeedeledeedeldeeldddeedddeeldeeeelede iveveeeeeiveeiveeei eryyyry
popopolpolpolpolpolpollyyymyymymoymymoymoymymomoymoymomoymymymmym rppphphrphphrprprrprprpp ismismsmsmsmsmmismsmm
grggggroggrgrogg wthwtthththwthththhwaywaywaywayy
eeerreeeerree rororor
pppopolpopolpololicyicycyyyicyicyy
eeeefeffeffeffe ortortortorttttttt
HIVHIVHIVVVVHIV
pepepepeperpepepepepepepeperperpere fofoforfoforororffffffofoooormanmananmanmanmmmama cececececeeececee
brebrebrebrebrebrebreb easasasastastastaasa caacac ncncncecececencerrrrrrr
airaiairairairirairairair pppppopopop llulluuutiotiotiotiotiotiotiotioonnnnnn
assssssssssssasasssssssumpumpumppppumpptiotiotiotiotiotiotion
bblblblblblblblblblblblblooooooooooooooooooooooodddddddddd pprprprprp esesesssessse sususususussusus rerererererererer
cacacacacacacacacacaaausususssssssuuu eeeeee ee e momomooooooomoo trttttttttalalalalalitititittititititityyyyyyyyyyyy
hehehehehhehhheaaalalalaa ththth ssssstutuutututututt dydyyyyyyyyydyyyydyyydydydyyyyyydydyy chchchchchchchchchcccccc iiiliiililii dhdhdhooooooooooooddddddddddddddddddd sesesseseseseseseseeseeesesessssssssss tttttttttt iniininnggggg
ggegegeggegeneneeneee
ppapapapaapepepepeppepepeppppp rrrrrrrr
cocooocococonsnsnsnsnsnnsnsn umumumptptptptptptpptioioioioioioonnnnnnnn
mommommmmmmmmmmmmmm ttththhererere
ininininininiiinininininnii ffffefefefefectctctctc ioioioionnn
bibibbiasasssasassprprprprprprpprp eeeegegegeeege nananaancncnccccccncncccccccyyyyyyy
reeeeeeeeseeseseseees araararararrchchchchchchchchchchhhhhcchhhhchhcchhhhhhbobobobobobobobobobbobobobobobobobobobobbobobbobbobbobboob dydydydydyddydydydydyydydyydydyddyydyy mmmmmmmmmmmmmmmmmmmmaaasaaaasss inininininnnninninnnnddddedeeedededeeeeededdd xxxxxxxxxxxx
memememmmmmmmmmmmmmmmmmm thththththhododdododddoddddddddo
E)
South Koh Kh Kh h Khh h h rea
P chloroororoorooroororororophenyl
dietary ry ry ry ry folaff te
yabdominanananananananananal obesity
IRRIRRIRRRRRRRRRRIRRRIRIIRRIIRRRIRIRR
ironironironironroironironiro
short teeeeermrmmm ermrmrmm ffect
resresresreseesstresrestresesstr sstesststresstsser
increaseeeeed mod mod d mod mod momod mod modd d d rtalrtartalrtalrtalalalrtalalaliiiityiii
dddaugdauaaugugugugd ugaugdaudauaugdauuauughterhterhtehterhterhterhterhtee
cigaccigacigarettrettttettttretrettrettrettr ttrettretttttetttettettette sme sme sme smssmme smme smmme sme sme smee smokeokekekekeokeeokeokeokeokoo eeee
chilcccc d momomomoortality
youtyoutyoutyoutyoutyoutyoutyoou hhhhh
younounououou g wog wg wg wg ww mmmmanmanmanmmaanannna
ttttreattt tmenenenenenenenenttt eft fect
EPICEPICEPICEEPICEPICEPICEEEE
poorpooroooooopoorpoorpoorpoorpoorpoorpoorpoor heheheeahhhehhh lth
LondndndLondLondLondLondndLonddndddnnddonnddn oooonononononoon
SeSSeSSeatSeaeattSeSeSeSSeeatSeeatatatttltltlettt
point esesesesesesese timat te
normal wal wal wal wal wal wal wal wal wal eeieieigeigheieigeiee t
growth fh fh fh fh fh fh fh fh fh factoaactoactoactaacta rrrr
CARDCARDCARDCARDARDARDCARDRDRR IAIAIAAIAAAAAAA
bodydydydydydydyy mass
time se see sssee sssseeeerieee es
HawHawHawawHawaawawaiiaiiaiiaiiaiiaiiaia
fooololollatattetatatatt
skkskkkiskskkikkikssssssskkks nnnnnnnn
nonnonnonnonnonnonnondddrdridririddririd nkenkenkeeenkkenkenknkeenkerrrrrrr
slemememeaeeameeam sssssss
feefeteefetfefeffettetetfetfettfetettffe aaaalaaalalaaaaaalaaaaaaaallaala
fatty y y y y y aciaciaciaciacia dddddddd
corcorcorcoroororcororcororcorroonanaonaonaonaonanaonaonaoonaoo ryryryry ry ryryryryry event
MEDMEDMEDMEDDDDDLLLINLLLLL E
weaweweweaeaweaeweaweweweweaweaw ththththheththt r
sprsprsprsprprsprsprsps eaeaadeaeaeaeae
genetic vc vc vc vc vc vc vc variant
carooteoototeoteeennoinnnnnn ddddd
tratraaratraatratraaaarafffififffiffffffffffffff cccccccsumsumsumsumsumsumsumumumummm
steststetestesstststetesteeteeteteeeeeeeeppppppp
nutriennntnnntnt intintintinti taakakeakaaaa
immmmmmmmimmimmm ununniunuu ty
happpplotlotlotlotlotlototlotypypypypypeypypyp
clecleclecleclecleeeleleft ftft ftft ft lip
aduaduaduaduaduduuuduaduuuduuuuuuuuudullttlllt ltltltt llife
genetic c c vc c vc vvvvaaariaaaaaaa ation
pubububbubblliclicliccatatatiatataa ononononott
polpolpoololpolololpp lutllutlutlutlututaananantanaaa
nnnneunnnn ral tuuuuuuuubeeee ebebee defect
plaplaplaaaaasmmmmaaaammmmmammamasmsmmmmmmma
ethethetheththethethnicnicniccccnininicccnn cnicnnnn dddiddiddididifffefefefeffffffff rennnnncececeecccece
raraaddraddr drarrradrararar ddiatiattiatiatttiationionionionnion
HuGE rE rE rE rE rE rEE evie ew
metmetmetmetmetmetmetmetaboaboaboaboaboaboaboaboababolilitlitlitlilitlittl e
jouuuuuuuurnnnnarnnrnrn l
genenenengengenengenene ee ee ee ee ee ee ee eenviviiivinnnnnvivivinnvivirrrronrrr menmenmemenmenmememe t interaction
dddddedeeebbdeebebdded bddedddeeebeebbateateateateateateateate
simsimsimsimsimimimsimmssimsssimsims ulaulaulaulaulaulaulaulatiotiotiotiotiotitt nn snnnnn tudy
cholessssterterterterterterterterterrrooloololoooooo levlevlevevlevlevlevlevllele el
validaidaaaaidaidaidadadattiotiotiottiotiotiotttitiotiottiotiotionnnnnnnnnnnn
uuurbuuuuuuuuuuurburbrbuur ananananaaa arareaarareararearearareararea eareaarea aaaaaaaaa
ccccooouououuuc ucoouuuoupppppleppppp eepppp eep
ststastatatasttaststass ndaaaaaandndnd rdrdrdrd rdrd eeerror
inffflulueluluueueueluennnnzannn
DNADNADNADNADNDNDN
cccucuulcuculuc lc turuturtururureeeeeeeee
preeeprpreprepreeepreeepreepreeeeeeeeetertteeeteteetetetetteteteetetett m dm dm dm dm dm dm dm dm dm dm deliliiiivevvvervevevvervvervv rvvveryyyyyyyyyyyyyyyy
corcorcorcorcocorcorcocococococococoococooococococoo relrelrelrelrellatitititiatatatataa ooonoononn cccoecoecoecoeccoecocoecoecoecoeccocoecoocoecocccc ffiffiffifffffffff ciiiciieiciieieeennnntttttntttnnntntnnntt
deadeadeadededeadeadeaeaeadeaeaeadeaadd tthth thththtththth ratratratratratatrratrrateee
rededededededdeduceucuceucuceucuucucuc d rd rd rrd rd d d iskiskiskkiskiskiskssk
ppeapeapeapeapeapeapeakkkkkkk
fatfatfattt
enenzenznzenze ymymmmmmmemmmyymmmymmmymmmy
cycyccycyccycyccyccyccyccycccycycyycccycycyccyyccc cleeeleeleleeleeeelellelelellelel
HHIVHIVHIVHIHIVHIVIHIHHH inininininfefeecfeceeee tiotiotiooooonnnnnnnnn
ruururrurrurrrurrurururuuurrurrurrrurrurr ralalalaa areareareareareraarararar aaaaaaaaa
supppplepppleplep menmenmenmenmmmenttt bbbiabiabiaiaiaseseseseese
vegvegvegvegvegvegvegegetaetaetaaaaaetableblelelele
maaatataataaaataataattattatttterneerernerneeereeereeereeeee aaal allllala ageagggegegeageageageageageageagegegegegeaggeageageeageggegegegggegeii ttttttttttteliveere yyyyyy
papparppaparparpararpparparppparpap ticttitticticttticttticticttictict cculaulauluululullulaulaulululaulululaulauulaatete e e etee teete mmamamamamatmammmm terrr
hheaeaaheaheeeaaaaheaheaheaeahhhhheheaaaahheaaeaaaaeaalttththtthttltthlttltlltltlttltttlttt eeefeffefeeeefefeeffecececcectttt
ccancaannancannncancancanccaanccanncaancacacancaancanaannnnannnanaaancercceeerrcereereececeerrcerccc rceceeeereerrrr momomomomomomooorrrtartartartarrrrrtarrrttar aarrrtrrrr ar alitlitlitliitlili y
leuuuuukemkemememmmmmmmmemmkemmmmmmmmkemkemia
ininineineeeeneeeinineineinii quaquaquauaquaquaaquaquaquaauaaaquaaquaquaq allllitlll y
tutututumtumtuummuumummuu orororror
boyboyboyboyyboyboyboyyysitsitsitsittitsitssitsitsitsitsitsitsits uatuauatuatuatttuaatuatuatataaauuuu ionionionoonononionononoonononnionooooooooo
iigirgirgirrgggg lllll
epiepiepiepiepiepiepepie demdemmmmdemdemde icicicciciciic
virvirvirviv ussssususs
CalCalCalCalla ififfoiffoooififoorrnirrnrnrnrniirnirnirniirniirnirnnrniiir iir aaaaaaaaaaaaaaaff
ccccccccocoucocouccc unnnntntntnnnn
pppparparppppppppppparrrrp ityityityyitytyityytytytyytytyittyt
CoxooCoxCoxCoxoooxCoxoooooxoooxoooCoxCoxC propoopoopooopooortirtirtirtitirtrtirtirtirtirt oooonaonaonaoo l hl l hhl hhhhl hl hhhhhhazzzaazzazzaazazazazaazazazazazzaa rdrdrdddddsdsdsdsdddrddddrdrddddr momomomomomoomommmommodeeeeeleleleldddddddelEEPEPEPICPEE
yyyyyy
dd ll ll
cacacanananca cercercercer riiiiiskskskskskskskskkskk ococcoccoccoococcococcocccoccoccoccccoccoccoccooccoooooo co upaupaupaupupaupaupaupaupaupaupaupaupaupaupaapaupuuupp tioitioiitiotiotiotiotiotioootiootioonalllnalnanalllnalnanalan exexexxxxxxexexxxexexexpopopopospospososopopopospppoopopopoosssurerereurereeureureeurlll
mmmmmorororommoorlitlitlitlitlitlitlll eeeeraraeraeraatuuturturtturt eeee
ggrgrogrogggggggg wttwtthttwtthllllllllll
sysysyyysysysysyststststttssststststss olololololololiciciciciicicicicicc bbbbbbbbbbbbbblolololloodddddddodo pppppppppprerererererereressssssssssssssurururururururrrreeeeeeeeee
foood freequququququuueneneneneenenencycycyy qqqqqqqqueueueueuessstsstsststtioioooooiooionnnnnnnaiaiaiaiaiaia rerererere
asasasassassassasthhththtt mmamamamaaaammaaamaaam
popppppppp lyyyyyymmmommmomm rppppprppphihihihismmmmmmmmmsmsmsm
mmemememeeeemeememeeeemmemm taatatatatatata a-a-a-ananaaaanaanaalylylylylylyyysssssiss sssssssppppppppppppp
lolooolololooooloolooloolololowewwewewwwwwweewerr rr rrriiriririiiirrrrrr ssskskkskskk
ofofofofofofofoffffffsfsfffsfsfffffssf prprprpriinnnninininnninininnni ggggggggggggggggggggggggllll
HIHHIHIVVVVV
asasasasssususussumpmpmpmppppptitititittitititiooonooooovavavavavavavavaalilidididididiiitttyttytytttytytyttytyttytyttytytytytyyyy
dididietetet
mommomooooomomomommooooooooortrtrtrrtr aalalaalittitityy y yy yyyyyyy rararaaaarararaaaaaaaaaraatetetetetetetete
bibibibibibibibirtrtrtrrtrrtrthhhhhhhhhhhhhhhhhhhhhhhh ewewweeeeeiigigigiigiigiiiiigighththththththh
ininnnniniiniiiiii ffafafantnttntntmmm
ggggegeggggggggggggggg neeeneee
pprprrrrrrprrrpppp obobobobobbbleleleleeeeemmmmmmmmm
cocococococococccccococorororororororororoonanananananananananananaaryryryryry hhhhhhheeaeaeaeaeaae rtrtrtrtrtrtrtrtt ddddddddddddddddisisisssssississiiississeeaeaeaeaeaeaeeeeeaseseseseeseeseeeee
wweweweweweigigigigigigghththhthhhthththhhhhththththhhthhttthhtththhthhhhh
epppepeppepeepepepepepididddddidddidddddememememmememioioiololoologygygyyyygygyygygygygg
ccacacacacccaaardrddrdrdrdddddr ioioioioioiooioioioioiovavavaaaavavaavavavasscssssssscculululularararrrrrrr ddddddddddisisisisisissiississeaeaeaeaeaeaeaeaeaeaeaeaeasesesesesesesesse
prprprrppprprrppprprprpprrrprprrrprprrrrpregegeegeeeeeeeee nannaanancncncncncccccncncccccnccccccccccyyyyyyyyyyyyyyyyyyy
ininnnininnnnnnnnninnnnnffeffefefefeffectcttctccc iooioioooooooooooooooooonnnnnnnnnnnnnnnncococoooooocooocoooococ nnnnnsnsnnsnnnnnnnnnnnsnsnsnnnnsummummmummmppppptptptpptppptptpppp ioioioioiioiioionnnnnnnnnnnnnnnnnnnnnn
bbbbbbbooooooodddddddddyyyyyyyyy mmmmmaaaassssssssss iiiinnnnnnnnnnnnndddddddddddddeeeeeeeexxxxxxxx
Cardiovascular Disease
Methodology
Infectious Disease
Nutritional
Environmental
Reproductive and Perinatal
Meta-analysisMethodology
Infectious Disease
Nutritional
Environmental
Reproductive and Perinatal
Cardiovascular Disease
Figure 2. Mapping and clustering of terms in 5 high-impact epidemiology journals for A) 1974–1989, B) 1990–1995, C) 1996–2001, D) 2002–2007, and E) 2008–2013. The maps show terms as labeled nodes. Some terms appear to be misspelled or truncated because of the tasks of lin-guistic processing that were performed before themapping and clustering of terms, as described in theMethods section. Node size is proportional tothe term frequency of occurrence (i.e., the larger the node, the more articles include the term). Terms that are far away from each other do not orrarely occur together in the same article, whereas terms with high co-occurrence are close to each other. The clustering of the terms is displayed ontop of the map by coloring nodes based on the cluster to which they belong. Clusters of terms are interpreted as major epidemiology topics, andclusters located close to each other in the map indicate related topics.
98 Trinquart and Galea
Am J Epidemiol. 2015;182(2):93–104
Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018
Table 1. Evolution of Major Topics in 5 High-Impact Epidemiologic
Journals and in a Subset of Articles Published in 6 High-Impact
General Medicine Journals, 1974–2013
Topica
1974–1989
EpidemiologyJournals 3,725Articles, 951Terms, %
GeneralMedicine
Journalsb 8,602Articles, 823Terms, %
Infectious diseaseepidemiology
36 24
Infection 14 13
Antibody 8 6
Virus 7
Outbreak 6
Illness 6 6
Prevalence 5
United States 4
Cardiovascular diseaseepidemiology
24 16
Man 15
Smoking 7 3
Blood pressure 6
Cigarette smoking 5
Adjust 5
Risk factor 6
Relative risk 3
Diabetes 3
Cohort 2
Cancer epidemiology 15 19
Mortality 12
Cancer 11
Mortality rate 4
Death rate 3
Lung cancer 2
Therapy 14
Survival 5
Cell 4
Chemotherapy 3
Recipient 3
Reproductive andperinatal epidemiology
12 5
Case control study 12
Relative risk 7
Confidence interval 6
Pregnancy 4 4
Infant 4 5
Mother 3
Birth 2
Delivery 2
Clinical trials 20
Trial 10
Placebo 8
Table continues
Table 1. Continued
Topica
1974–1989
EpidemiologyJournals 3,725Articles, 951Terms, %
GeneralMedicine
Journalsb 8,602Articles, 823Terms, %
Dose 7
Efficacy 6
Improvement 4
Health care quality 16
Physician 6
Care 4
Survey 4
Cost 3
Service 3
1990–1995
EpidemiologyJournals 3,948Articles, 1,116
Terms, %
GeneralMedicine
Journalsb 6,434Articles, 903Terms, %
Infectious diseaseepidemiology
32 15
Infection 12 14
Antibody 5 5
HIV 5 7
Italy 4
Sensitivity 4
Detection 4
HIV infection 3
Cardiovascular diseaseepidemiology
21 18
Body mass index 8
Cigarette smoking 6
Blood pressure 5
Coronary heart disease 5
Diabetes 5
Case control study 5
Baseline 5
Adjust 5
Smoking 4
Hypertension 4
Cancer epidemiology 18
Cancer 10
Approach 5
Mortality rate 4
Validity 3
Example 3
Reproductive andperinatal epidemiology
14 8
Pregnancy 6 4
Mother 5 3
Birth 5 4
Table continues
Metaknowledge Analysis of Epidemiologic Topics 99
Am J Epidemiol. 2015;182(2):93–104
Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018
Table 1. Continued
Topica
1990–1995
EpidemiologyJournals 3,948Articles, 1,116
Terms, %
GeneralMedicine
Journalsb 6,434Articles, 903Terms, %
Infant 5 5
Smoker 4
Screening 5
Nutritional epidemiology 8
Consumption 8
Diet 5
Alcohol 4
Correlation 4
Food 3
Female cancerepidemiology
8
Breast cancer 4
Parity 2
Family history 2
Oral contraceptive 2
Menopause 1
Health care quality 27
Care 9
Survey 8
Practice 6
Questionnaire 6
Physician 6
Clinical trials 21
Therapy 14
Trial 14
Placebo 9
Efficacy 9
Dose 8
Cardiovascular diseaseepidemiology
12
Sensitivity 5
Myocardial infarction 4
Stroke 3
Specificity 3
Acute myocardial infarction 2
1996–2001
EpidemiologyJournals 4,492Articles, 1,346
Terms, %
GeneralMedicine
Journalsb 6,891Articles, 1,009
Terms, %
Infectious diseaseepidemiology
36 25
Infection 11 13
Approach 5
HIV 4 6
Antibody 4
Table continues
Table 1. Continued
Topica
1996–2001
EpidemiologyJournals 4,492Articles, 1,346
Terms, %
GeneralMedicine
Journalsb 6,891Articles, 1,009
Terms, %
Strategy 4
Survival 8
Cell 4
Sensitivity 4
Cardiovascular diseaseepidemiology
21 29
Body mass index 10
Baseline 5
Physical activity 5
Hypertension 4 4
Alcohol consumption 4
Diabetes 5
Case control study 5
Infant 4
Birth 4
Cancer epidemiology 15
Lung cancer 3
Cigarette 3
Nonsmoker 3
Cancer registry 2
Cancer risk 2
Reproductive andperinatal epidemiology
13
Pregnancy 7
Birth 7
Mother 5
Infant 5
Breast cancer 4
Nutritional epidemiology 10
Consumption 7
Diet 4
Validity 3
Error 3
Agreement 2
Environmentalepidemiology
6
Asthma 2
Air pollution 2
Season 2
Respiratory symptom 1
Respiratory disease 1
Health care quality 25
Care 9
Quality 7
Survey 7
Practice 7
Table continues
100 Trinquart and Galea
Am J Epidemiol. 2015;182(2):93–104
Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018
Table 1. Continued
Topica
1996–2001
EpidemiologyJournals 4,492Articles, 1,346
Terms, %
GeneralMedicine
Journalsb 6,891Articles, 1,009
Terms, %
Physician 7
Clinical trials 22
Trial 21
Placebo 11
Efficacy 10
Dose 7
Double blind 6
2002–2007
EpidemiologyJournals 4,180Articles, 1,236
Terms, %
GeneralMedicine
Journalsb 6,283Articles, 978Terms, %
Nutritional epidemiology 24
Consumption 9
Diet 3
Inverse association 3
Incident case 2
Lower risk 2
Cardiovascular diseaseepidemiology
22 20
Body mass index 10 4
Cardiovascular disease 6 5
Weight 5
Coronary heartdisease
5
Height 5
Stroke 5
Hypertension 5
Case control study 4
Infectious diseaseepidemiology
20
Infection 8
Mortality rate 3
Transmission 3
HIV 3 4
Setting 2
Gene 4
Cell 4
Progression 3
Vaccine 3
Methodology 16
Approach 7
Epidemiology 5
Bias 5
Paper 5
Problem 4
Table continues
Table 1. Continued
Topica
2002–2007
EpidemiologyJournals 4,180Articles, 1,236
Terms, %
GeneralMedicine
Journalsb 6,283Articles, 978Terms, %
Reproductive andperinatal epidemiology
10
Pregnancy 7
Mother 6
Infant 4
Birth weight 4
Offspring 3
Environmentalepidemiology
7
Asthma 2
Air pollution 2
Nonsmoker 2
Susceptibility 2
Season 2
Health care quality 28
Practice 7
Health 7
Survey 6
Research 6
Problem 5
Clinical trials 23
Placebo 12
Controlled trial 12
Hazard ratio 10
Efficacy 10
Dose 8
Meta-analysis 13
Quality 10
Review 6
Medline 6
Systematic review 6
Meta analysis 6
Cost-benefit analysis 2
Cost 5
Dollar 2
Cost effectiveness 2
Life year 2
Life expectancy 1
2008–2013
EpidemiologyJournals 4,550Articles, 1,354
Terms, %
GeneralMedicine
Journalsb 6,159Articles, 1,040
Terms, %
Cardiovascular diseaseepidemiology
23 18
Body mass index 12 5
Table continues
Metaknowledge Analysis of Epidemiologic Topics 101
Am J Epidemiol. 2015;182(2):93–104
Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018
were related to infectious diseases except the words “systolic”and “diastolic,”which were related to the epidemiology of car-diovascular diseases. The word “seropositive” showed themost intense burst. After 2000, there was no clear time patternof burst. Some terms belonged to a single topic. For instance,
thewords “ambient” and “particulate”were exclusively relatedto environmental epidemiology. Eight terms were related togenetics and meta-analysis. Two of the terms with the most in-tense bursts (“gestational” and “preterm”) were related to re-productive and perinatal epidemiology. A majority of burst
Table 1. Continued
Topica
2008–2013
EpidemiologyJournals 4,550Articles, 1,354
Terms, %
GeneralMedicine
Journalsb 6,159Articles, 1,040
Terms, %
Height 5
Childhood 3
Cause mortality 3
Blood pressure 3
Cardiovascular disease 5
Prospective cohort study 4
Smoking 4
Gene 3
Nutritionalepidemiology
20
Hazard ratio 10
Consumption 5
Diet 3
Health study 3
Smoker 3
Infectious diseaseepidemiology
19
Research 8
Epidemiology 6
Infection 6
Issue 4
Article 4
Methodology 15
Method 13
Approach 10
Bias 7
Problem 5
Design 5
Reproductive andperinatal epidemiology
11
Pregnancy 8
Mother 5
Childhood 4
Birth weight 3
Infant 3
Environmentalepidemiology
7
Air pollution 3
Particulate matter 2
Table continues
Table 1. Continued
Topica
2008–2013
EpidemiologyJournals 4,550Articles, 1,354
Terms, %
GeneralMedicine
Journalsb 6,159Articles, 1,040
Terms, %
Season 2
Temperature 1
Hospital admission 1
Meta-analysis 3 13
Meta analysis 5 9
Gene 4
Systematic review 3 8
Genotype 3
Polymorphism 2
Randomized controlledtrial
8
Medline 7
Database 7
Global health 38
Country 11
Prevalence 9
Trend 6
Survey 6
Cost 6
Clinical trials 20
Hazard ratio 15
Therapy 15
Week 13
Placebo 12
Clinical trial 11
Cardiovascular diseaseepidemiology
13
Hazard ratio 15
Stroke 7
Significant difference 6
Myocardial infarction 6
Cause mortality 5
Abbreviation: HIV, human immunodeficiency virus.a Data are clusters of terms interpreted as major topics (with the
percentage of terms within each cluster) and the top 5 terms withineach cluster (with the percentage of articles including each term).The major topics are ordered by their importance in the epidemiologicjournals and then in the general medicine journals.
b For the 6 high-impact medical journals, we retrieved articles mostlikely of relevance to the field of epidemiology by using a customsearch filter.
102 Trinquart and Galea
Am J Epidemiol. 2015;182(2):93–104
Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018
wordswere related tomethodology (e.g., “pathway,” “Bayesian,”“causal,” “mediation,” and “simulation”). Finally, approxi-mately one-third of burst words did not belong to any par-ticular cluster, but most of them were related to methodology(e.g., “multilevel,” “P for trend,” “Cox,” “heterogeneity,”“modeling,” and “confounder”).
Ancillary analysis of high-impact general medicine
journals
Our search retrieved 32,760 articles most likely of rele-vance to the field of epidemiology that were published inthe 6 general medicine journals. Web Figure 3 shows themapping and clustering of terms over time. Table 1 shows asummary of the clusters of terms and allows comparison witharticles from epidemiologic journals.
Some topics were similar to those identified in epidemiol-ogy journals and showed similar evolution. Cardiovasculardiseases and infectious diseases were among the main topicsover the 5 time periods, except the last time period for infec-tious diseases. We identified a cancer cluster in the 1974–1989 period and a reproductive and perinatal health clusterover the 1974–1989 and 1990–1995 periods. A cluster re-lated to meta-analysis appeared during 2002–2007 and per-sisted in the subsequent period.
Other topics differed from those identified previously. Onecluster corresponding to clinical trial terms (in multiple clin-ical specialties) was identified over the 5 periods. Anothercluster related to health care quality was identified over theperiods from 1974 to 2007. Lastly, a cost-benefit analysiscluster was identified in 2002–2007, and a global health clus-ter was identified in 2008–2013.
DISCUSSION
We analyzed 20,895 articles published in 5 epidemiologyjournals over 4 decades using a production-oriented approachto investigate the epistemic core of epidemiology. We found aclear pattern of leading areas of epidemiologic inquiry duringthis period and patterns in the evolution of these areas. Wefound, first, that the epidemiology of infectious and cardiovas-cular diseases have consistently been the main topics of interestin these 5 journals. Second, cancer epidemiology has been amajor topic, with a peak in knowledge production in 1990–1995, where 2 clusters related to cancer and female cancerwere identified but stopped being a leading focus of papers inthe 5 epidemiologic journals after 2001. Third, nutritional epi-demiology gained importance over time. Fourth, 3 topics wereamong the leading areas of inquiry for time-delimited periods,namely environmental epidemiology since 1996, whereasmeth-odology and meta-analysis in genetics appeared in 2008–2013.
Becausewe focused our inquiry on these 5 leading epidemi-ology journals, we can interpret our findings as representingknowledge produced and regulated through peer review prin-cipally by epidemiologists and shaped by editorial processes inline with the leading epidemiologic organizations. The Amer-ican Journal of Epidemiology is published in association withthe Society for Epidemiologic Research, the InternationalJournal of Epidemiology is published on behalf of the Interna-tional Epidemiological Association, Epidemiology is the offi-
cial journal of The International Society for EnvironmentalEpidemiology, and the Annals of Epidemiology is the officialpublication of the American College of Epidemiology. By de-sign, this analysis, excludes papers published by epidemiolo-gists, or papers published by nonepidemiologists that wouldnonetheless be considered within the field’s remit, that werepublished in nonepidemiologic journals. There is little ques-tion that such papers thrive, particularly in clinical journals.So, for example, the decrease in focus on cancer in these 5journals over the past decade represents most likely a shift inwhere these papers are being published—away from epidemi-ology journals to cancer journals. We would argue, however,that there is consequence to publishing the relevant papersin the leading journals in the discipline. Epidemiologistsare, in many respects, the keepers of the methodological flamein population health sciences. If cancer epidemiology is evolv-ing in nonepidemiology journals, it represents a tremendouslost opportunity for the field to make the contribution it canand should make to one of the leading global causes of death.Therefore, although our observations are in some ways heart-ening, reinforcing that we are focusing on cardiovascular dis-ease commensurately with the contribution of cardiovasculardisease to burden of mortality, they also suggest that the disci-pline is playing a far smaller role in other areas that are alsoimportant. For example, although several new areas have gain-ed prominence in the field over the past decades, including so-cial epidemiology, these are clearly not represented among thekey areas in these 5 leading epidemiology journals over thetime period of interest (21–23).Moreover, areas such as injury,psychiatric, or neurological epidemiologyare clearly not amongthe main topics identified; this is dissonant with the importancethat these areas have for global burden of disease (24–26).Within a consequentialist epidemiology framework, it wouldcertainly stand the field in good stead if we engaged activelyaround inquiry concerning the major causes of morbidity andmortality worldwide, with an eye to how we may prevent dis-ease and improve health (27–29).
The increasing role that methodological papers play inpublication in epidemiology journals over the past decadepresents both opportunities and challenges. In some respects,this evolution represents an evolution in the field, whereinmethods for epidemiology are being developed principallyby epidemiologists. This reflects a maturity in the field, mov-ing well beyond its origins where methods in the disciplineemerged from other areas (8). However, it also suggests thatthe field takes upon itself greater responsibility, both to keepdeveloping methods that are adequate to the evolving popu-lation health challenges we face and to ensure flexibility tothe incorporation of methods that do arise in other areas thatmay be fruitful for epidemiology to adopt.
These observations also have implications for our educa-tional programs and how we train the next generation of ep-idemiologists. If the leading epidemiology journals focusinsufficiently on significant areas of population health, weas a discipline may fall short on our self-definition and ourpromise as a field. This stands both to change the composi-tion of those who are attracted to the discipline and poten-tially to influence the structural factors (such as promotionexpectations and criteria) that stand to reinforce our areasof focus and growth in the field going forward.
Metaknowledge Analysis of Epidemiologic Topics 103
Am J Epidemiol. 2015;182(2):93–104
Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018
Our analysis has limitations. First, our results and interpre-tation depended on our selection of epidemiology journals. Adifferent list of journals could be considered. For instance, thePublic Health/Health Administration Section of the MedicalLibrary Association considered 10 journals as “essential for acollection that supports a program with subject specializationin this area” (30, p. 572). Moreover, many epidemiologic ar-ticles are published in nonepidemiologic journals. However,in our ancillary analysis of 6 high-impact general medicinejournals, we found patterns of epidemiologic papers thatwere consistent overall with the findings in epidemiologicjournals, which suggests that the trends observed here holdacross the discipline. Second, our results correspond to amacroscopic rather than microscopic mapping of the disci-pline in the sense that we may have missed subtle regularitiesin the objects of research. We were, in fact, interested by theidentification of main topics, suggesting that our approachsuited our purpose. We may have missed the exact dynamicsof appearance or disappearance of these main topics becauseour categorization of articles aimed for an approximatelyequal number of articles in each time period.In sum, we identified the major topics in 5 high-impact jour-
nals of epidemiology, and we analyzed the trends of thesemain topics. This allowed for an empiric perspective on thediscipline’s past, with an eye to its future. Our metaknowledgeinvestigation, which relied on freely accessible data sourcesand free software, is replicable. Monitoring the evolution ofthe science of epidemiology may help inform our efforts toconsider appropriate recalibration of the field’s scope.
ACKNOWLEDGMENTS
Author affiliations: Department of Epidemiology, MailmanSchool of Public Health, Columbia University, New York,New York (Ludovic Trinquart); and School of Public Health,Boston University, Boston, Massachusetts (Sandro Galea).Conflict of interest: none declared.
REFERENCES
1. Lilienfeld DE. The general epidemiologist: Is there a place intoday’s epidemiology? Am J Epidemiol. 2007;166(1):1–4.
2. Armenian HK. Epidemiology: a problem-solving journey. Am JEpidemiol. 2009;169(2):127–131.
3. Ness RB, Andrews EB, Gaudino JA Jr, et al. The future ofepidemiology. Acad Med. 2009;84(11):1631–1637.
4. Bhopal R,Macfarlane GJ, SmithWC, et al.What is the future ofepidemiology? Lancet. 2011;378(9790):464–465.
5. Pearce N. Epidemiology in a changing world: variation,causation and ubiquitous risk factors. Int J Epidemiol. 2011;40(2):503–512.
6. McKeown RE. Is epidemiology correcting its vision problem?A perspective on our perspective: 2012 presidential address forAmerican College of Epidemiology. Ann Epidemiol. 2013;23(10):603–607.
7. Khoury MJ, Lam TK, Ioannidis JP, et al. Transformingepidemiology for 21st century medicine and public health.Cancer Epidemiol Biomarkers Prev. 2013;22(4):508–516.
8. Morabia A. A History of Epidemiologic Methods and Concepts.Basel, Switzerland: Birkhäser Verlag; 2004.
9. Buck C, Llopis A, Najera E, et al. The Challenge ofEpidemiology. Issues and Selected Readings. Washington, DC:Pan American Health Organization; 1988.
10. Evans JA, Foster JG. Metaknowledge. Science. 2011;331(6018):721–725.
11. Griffiths TL, Steyvers M. Finding scientific topics. Proc NatlAcad Sci U S A. 2004;101(suppl 1):5228–5235.
12. ISI Web of Knowledge. 2012 Journal Citation Reports ScienceEdition. http://admin-apps.webofknowledge.com/JCR/JCR.Thomson Reuters; 2014.
13. van Eck N, Waltman L. Text Mining and Visualization UsingVOSviewer. Leiden, The Netherlands: Centre for Science andTechnology Studies, Leiden University; 2012.
14. Borg I, Groenen P. Modern Multidimensional Scaling. 2nd ed.New York, NY: Springer; 2005.
15. Van Eck NJ, Waltman L. Bibliometric mapping of thecomputational intelligence field. Int J Unc Fuzz Knowl BasedSyst. 2007;15(5):625–645.
16. Newman MEJ, Girvan M. Finding and evaluatingcommunity structure in networks. Phys Rev E. 2004;69(2):026113.
17. Waltman L, van Eck NJ, Noyons ECM. A unified approach tomapping and clustering of bibliometric networks. JInformetrics. 2010;4(4):629–635.
18. van Eck NJ, Waltman L. Software survey: VOSviewer, acomputer program for bibliometric mapping. Scientometrics.2010;84(2):523–538.
19. Kleinberg J. Bursty and hierarchical structure in streams. DataMin Knowl Discov. 2003;7(4):373–397.
20. Mane KK, Börner K. Mapping topics and topic bursts inPNAS. Proc Natl Acad Sci U S A. 2004;101(suppl 1):5287–5290.
21. Berkman L, Kawachi I. Social Epidemiology. New York, NY:Oxford University Press; 2000.
22. Cwikel J. Social Epidemiology: Strategies for PublicHealth Activism. New York, NY: Columbia University Press;2006.
23. O’Campo P, Dunn J. Rethinking Social Epidemiology: Towardsa Science of Change. New York, NY: Springer; 2011.
24. Vos T, Flaxman AD, Naghavi M, et al. Years lived withdisability (YLDs) for 1160 sequelae of 289 diseases andinjuries 1990–2010: a systematic analysis for the GlobalBurden of Disease Study 2010. Lancet. 2012;380(9859):2163–2196.
25. Murray CJ, Vos T, Lozano R, et al. Disability-adjusted lifeyears (DALYs) for 291 diseases and injuries in 21regions, 1990–2010: a systematic analysis for the GlobalBurden of Disease Study 2010. Lancet. 2012;380(9859):2197–2223.
26. Whiteford HA, Degenhardt L, Rehm J, et al. Global burden ofdisease attributable to mental and substance use disorders:findings from the Global Burden of Disease Study 2010.Lancet. 2013;382(9904):1575–1586.
27. Galea S. An argument for a consequentialist epidemiology. AmJ Epidemiol. 2013;178(8):1185–1191.
28. Cates W Jr. Invited commentary: consequential(ist)epidemiology: let’s seize the day. Am J Epidemiol. 2013;178(8):1192–1194.
29. Galea S. Galea Responds to “consequential(ist) epidemiology:finally”. Am J Epidemiol. 2013;178(8):1195–1196.
30. Ascher M. Journals, epidemiological. In: Boslaugh S, ed.Encyclopedia of Epidemiology. Thousand Oaks, CA: SAGEPublisher, Inc.; 2008:572–573.
104 Trinquart and Galea
Am J Epidemiol. 2015;182(2):93–104
Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018