Special Article Mapping Epidemiology's Past to Inform Its Future ...

12
Special Article Mapping Epidemiologys Past to Inform Its Future: Metaknowledge Analysis of Epidemiologic Topics in Leading Journals, 19742013 Ludovic Trinquart* and Sandro Galea * Correspondence to Dr. Ludovic Trinquart, Department of Epidemiology, Mailman School of Public Health, Columbia University, 722 West 168th Street, New York, NY 10032 (e-mail: [email protected]). Initially submitted July 29, 2014; accepted for publication January 28, 2015. An empiric perspective on what epidemiology has studied over time might inform discussions about future direc- tions for the discipline. We aimed to identify the main areas of epidemiologic inquiry and determine how they evolved over time in 5 high-impact epidemiologic journals. We analyzed the titles and abstracts of 20,895 articles that were published between 1974 and 2013. In 5 time periods that reflected approximately equal numbers of articles, we iden- tified the main topics by clustering terms based on co-occurrence. Infectious disease and cardiovascular disease ep- idemiology were the prevailing topics over the 5 periods. Cancer epidemiology was a major topic from 1974 to 2001 but disappeared thereafter. Nutritional epidemiology gained relative importance from 1974 to 2013. Environmental epidemiology appeared during 19962001 and continued to be important, whereas 2 clusters related to methodology and meta-analysis in genetics appeared during 20082013. Several areas of epidemiology, including injury or psy- chiatric epidemiology, did not make an appearance as major topics at any time. In an ancillary analysis of 6 high- impact general medicine journals, we found patterns of epidemiologic articles that were overall consistent with the findings in epidemiologic journals. This metaknowledge investigation allowed identification of the dominant topics in and conversely those that were absent from 5 major epidemiologic journals. We discuss implications for the field. bibliometrics; knowledge; periodicals as topic; terminology as topic The denition of epidemiology has not changed signicantly since it originated. A review of 70 epidemiology textbooks pub- lished between 1931 and 2014 shows that epidemiology has consistently been dened as the science of understanding the distribution and determinants of population health to be able to intervene to control or prevent disease (Web Table 1 and Web Figure 1, available at http://aje.oxfordjournals.org/). How- ever, the scope of epidemiologic study and practice has ex- panded substantially over the past few decades. Between 1974 and 2013, there was a nearly 6-fold increase in the use of the term epidemiology in papers indexed by MEDLINE. Motivated in part by changes in funding opportunities and in the scale of population-based studies, several recent com- ments have been concerned with potential future directions for epidemiology as a discipline (17). However, much of this soul-searching has been informed principally by expert opinion, with little evidence to guide our thinking. An em- piric perspective on the elds evolution may be useful to help guide our collective thinking about future research direc- tions for the eld (8, 9). A large-scale content analysis can track how areas of epidemiologic research evolve, with various areas gaining or losing importance. Underrepresented research paths might be due to a lack of attention to important areas that need to be looked at in the future. Metaknowledge investigations can complement the ongo- ing self-reection in the eld (10). Because they involve analyzing large quantities of texts, metaknowledge investi- gations have the potential to allow the investigation of the distribution and relative inuence of topics over time (11). Considering that what we, as epidemiologists, write should reect our vision of the discipline, such analysis may help us shape the discipline. Therefore, we aimed here to provide an empirical perspective on the eld of epidemiology by identifying the main topics in 5 major epidemiology journals and assessing how they had evolved over the past 40 years. METHODS Selection of articles We considered 5 high-impact epidemiology journals: the American Journal of Epidemiology, the International Journal 93 Am J Epidemiol. 2015;182(2):93104 American Journal of Epidemiology © The Author 2015. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health. All rights reserved. For permissions, please e-mail: [email protected]. Vol. 182, No. 2 DOI: 10.1093/aje/kwv034 Advance Access publication: May 14, 2015 Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673 by guest on 11 April 2018

Transcript of Special Article Mapping Epidemiology's Past to Inform Its Future ...

Page 1: Special Article Mapping Epidemiology's Past to Inform Its Future ...

Special Article

Mapping Epidemiology’s Past to Inform Its Future: Metaknowledge Analysis of

Epidemiologic Topics in Leading Journals, 1974–2013

Ludovic Trinquart* and Sandro Galea

* Correspondence to Dr. Ludovic Trinquart, Department of Epidemiology, Mailman School of Public Health, Columbia University,

722 West 168th Street, New York, NY 10032 (e-mail: [email protected]).

Initially submitted July 29, 2014; accepted for publication January 28, 2015.

An empiric perspective on what epidemiology has studied over time might inform discussions about future direc-

tions for the discipline. We aimed to identify the main areas of epidemiologic inquiry and determine how they evolved

over time in 5 high-impact epidemiologic journals. We analyzed the titles and abstracts of 20,895 articles that were

published between 1974 and 2013. In 5 time periods that reflected approximately equal numbers of articles, we iden-

tified the main topics by clustering terms based on co-occurrence. Infectious disease and cardiovascular disease ep-

idemiology were the prevailing topics over the 5 periods. Cancer epidemiology was a major topic from 1974 to 2001

but disappeared thereafter. Nutritional epidemiology gained relative importance from 1974 to 2013. Environmental

epidemiology appeared during 1996–2001 and continued to be important, whereas 2 clusters related tomethodology

and meta-analysis in genetics appeared during 2008–2013. Several areas of epidemiology, including injury or psy-

chiatric epidemiology, did not make an appearance as major topics at any time. In an ancillary analysis of 6 high-

impact general medicine journals, we found patterns of epidemiologic articles that were overall consistent with the

findings in epidemiologic journals. This metaknowledge investigation allowed identification of the dominant topics

in and conversely those that were absent from 5 major epidemiologic journals. We discuss implications for the field.

bibliometrics; knowledge; periodicals as topic; terminology as topic

The definition of epidemiology has not changed significantlysince it originated. A review of 70 epidemiology textbooks pub-lished between 1931 and 2014 shows that epidemiology hasconsistently been defined as the science of understanding thedistribution and determinants of population health to be ableto intervene to control or prevent disease (Web Table 1 andWeb Figure 1, available at http://aje.oxfordjournals.org/). How-ever, the scope of epidemiologic study and practice has ex-panded substantially over the past few decades. Between 1974and 2013, there was a nearly 6-fold increase in the use of theterm epidemiology in papers indexed by MEDLINE.

Motivated in part by changes in funding opportunities andin the scale of population-based studies, several recent com-ments have been concerned with potential future directionsfor epidemiology as a discipline (1–7). However, much ofthis soul-searching has been informed principally by expertopinion, with little evidence to guide our thinking. An em-piric perspective on the field’s evolution may be useful tohelp guide our collective thinking about future research direc-tions for the field (8, 9). A large-scale content analysis cantrack how areas of epidemiologic research evolve, with various

areas gaining or losing importance. Underrepresented researchpaths might be due to a lack of attention to important areas thatneed to be looked at in the future.

Metaknowledge investigations can complement the ongo-ing self-reflection in the field (10). Because they involveanalyzing large quantities of texts, metaknowledge investi-gations have the potential to allow the investigation of thedistribution and relative influence of topics over time (11).Considering that what we, as epidemiologists, write shouldreflect our vision of the discipline, such analysis may helpus shape the discipline. Therefore, we aimed here to providean empirical perspective on the field of epidemiology byidentifying the main topics in 5 major epidemiology journalsand assessing how they had evolved over the past 40 years.

METHODS

Selection of articles

We considered 5 high-impact epidemiology journals: theAmerican Journal of Epidemiology, the International Journal

93 Am J Epidemiol. 2015;182(2):93–104

American Journal of Epidemiology

© The Author 2015. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of

Public Health. All rights reserved. For permissions, please e-mail: [email protected].

Vol. 182, No. 2

DOI: 10.1093/aje/kwv034

Advance Access publication:

May 14, 2015

Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018

Page 2: Special Article Mapping Epidemiology's Past to Inform Its Future ...

of Epidemiology, the Annals of Epidemiology, Epidemiology,and the European Journal of Epidemiology. Their impactfactors are among the highest for the category public, envi-ronmental, and occupational health of the Journal CitationReports, and these journals are widely considered the jour-nals of record (12).We retrieved from MEDLINE via PUBMED the records

of all indexed articles published in these 5 journals up to2013, without any restriction on article type but includingonly articles for which an abstract was available. The se-lected articles were categorized into 5 time periods, andwe aimed to have approximately equal numbers of articlesin each time period. Data were analyzed separately for eachperiod of time.

Linguistic processing

For each article, we extracted the title and abstract and thencombined them into a single string. We discarded the wordsused to denote the structure of the abstract. Grammatical tag-ging allowed us to identify the part of speech (e.g., noun, pro-noun, adjective, noun, or verb) and assign the lemma (itscanonical form) of each word of a string. For instance, “genes”and “gene” would be assigned the lemma “gene.”Moreover,we developed a thesaurus that allowed for merging of differ-ent spellings of the same word (“ischaemic” and “ischemic”)and for merging an abbreviation with theword or phrase itself(PTSD and “posttraumatic stress disorder”). Each string wasthen reduced to a set of noun phrases, that is, single nouns orsequences of adjectives plus nouns or nouns that belong to-gether (e.g., “cardiovascular disease” or “relative risk”). Inthe remainder, noun phrases were referred to as terms.Terms that occurred multiple times within a string were

counted only once, and we discarded the terms that occurredin fewer than 10 articles. The relevance of each term was esti-mated as the degree to which the occurrences of the term wereoriented towards 1 or more topics underlying the articles. For agiven term, it was measured as the Kullback-Leibler distancebetween the distribution of (second-order) co-occurrences be-tween that term and all other terms and the overall distributionof co-occurrences over all terms. We selected the top 60% ofthe terms with the highest relevance (13).

Mapping and clustering of terms

The selected terms were positioned on a 2-dimensionalco-occurrence plot and were grouped into clusters based onthe co-appearance of terms. A normalized co-occurrence fre-quency was derived for each pair of terms. The locations ofterms on the plot were determined by minimizing a weightedsum of the squared distances between all pairs of terms. Min-imization was achieved through stress majorization (14).Consequently, terms with high co-occurrence tend to be closeto each other, whereas terms that are far away from each otherdo not or rarely occur together in the same article (15). Theterms were also assigned to clusters using a weighted variantof modularity-based clustering (16, 17). We characterizedeach cluster by providing a heading based on the terms inthe cluster. We assessed the relative importance of clustersaccording to their share of terms relative to the total number

of terms. Clusters of terms are interpreted as major epidemi-ology topics, and clusters located close to each other in themap indicate related topics.For each time period, the resulting maps show terms as la-

beled nodes in the co-occurrence network. Node size is pro-portional to the term frequency of occurrence, so that thelarger the node, the more articles include the term. The clus-tering of the terms is displayed on top of the map by coloringnodes based on the cluster to which they belong. Analysis in-volved the use of the VOSviewer software, version 1.5.7(Centre for Science and Technology Studies, Leiden Univer-sity, The Netherlands) (18).

Identification of bursts

To identify topics that attracted attention in epidemiologyresearch but eventually faded away, we used Kleinberg’sburst detection algorithm to identify words that experiencedsudden increases in use (19, 20). The algorithm assessesstates of the document stream, with different frequencies ofindividual words, and identifies state transitions, that is,years around which the frequency of a word’s usage changessignificantly. The analysis generates a list of burst words, to-gether with the intervals of time during which each burst oc-curred and the intensity of the burst. We visualized the top100 burst words graphically on a horizontal bar chart, withpublication year on the x-axis, burst words on the y-axis,and a bar from the start to the end of the burst. The barwidth is proportional to the intensity of the burst. Barswere color-coded according to the major epidemiology top-ics, as previously. Some words did not belong to any partic-ular cluster, and the corresponding bars were left uncolored.Analysis involved the use of the Science of Science Tool,version 1.1 β (Cyberinfrastructure for Network Science Cen-ter, Indiana University, Bloomington, Indiana, http://sci2.cns.iu.edu).

Ancillary analysis of high-impact general medicine

journals

Because many epidemiologic articles are published out-side of epidemiology journals, we performed the followingancillary analysis. We considered 6 high-impact generalmedicine journals: The New England Journal of Medicine,The Lancet, The Journal of the American Medical Associa-tion, The BMJ, Annals of Internal Medicine, and PLoS Med-icine. To identify articles most likely of relevance to the fieldof epidemiology, we analyzed how the articles published inthe 5 epidemiology journals were indexed with MeSH termsin MEDLINE and we derived the following sensitivity-maximizing search filter: “epidemiology” (Subheading) OREpidemiologic Factors (MeSH) OR Epidemiologic Methods(MeSH) OR epidemiologic studies (MeSH). Using this filter,we retrieved from MEDLINE the records of articles with ab-stracts that were published in these 6 general medicine jour-nals during the same time period that the other articles in the 5epidemiology journals. The selected articles were catego-rized into the same 5 time periods. We applied the same lin-guistic processing to the titles and abstracts, and we mappedand clustered terms into major topics, as previously.

94 Trinquart and Galea

Am J Epidemiol. 2015;182(2):93–104

Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018

Page 3: Special Article Mapping Epidemiology's Past to Inform Its Future ...

RESULTS

Characteristics of selected articles

We selected 20,895 articles. Overall, 42.7% were publishedin the American Journal of Epidemiology, 21.7% in the Inter-national Journal of Epidemiology, 10.2% in the Annals ofEpidemiology, 10.9% in Epidemiology, and 14.5% in the Eu-ropean Journal of Epidemiology. Figure 1 shows the evolutionover time of the yearly number of articles across the 5 journals.In all, 3,725 (17.8%) articles were published between 1974and 1989; 3,948 (18.9%) were published between 1990 and1995; 4,492 (21.5%) were published between 1996 and 2001;4,180 (20.0%) were published between 2002 and 2007; and4,550 (21.8%) were published between 2008 and 2013.

Mapping and clustering of terms

Figure 2 shows the mapping and clustering of terms overtime. Table 1 shows a summary of the clusters of terms andthe evolution of major epidemiology topics. The map for1974–1989 contained 5 main clusters of co-occurring terms,which corresponded to infectious diseases epidemiology,cardiovascular diseases epidemiology, cancer epidemiol-ogy, reproductive and perinatal epidemiology, and nutritionepidemiology.

These 5 major topics were identified consistently over the1990–1995 and 1996–2001 periods. In addition, a clustercorresponding to female cancer epidemiology was identifiedfor 1990–1995 but disappeared thereafter, whereas a clusterrelated to environmental appeared during 1996–2001 andpersisted in the subsequent periods.

For the period of 2002–2007, infectious and cardiovascu-lar diseases epidemiology remained among the top majortopics. However, the cluster related to cancer epidemiologydisappeared, and the nutritional epidemiology cluster gaineda larger share of the term map. Moreover, a cluster related tomethodology appeared during 2002–2007, ahead of repro-ductive and perinatal epidemiology and environmental epi-demiology, and persisted in the subsequent period.

Finally, 2008–2013 saw the appearance of another clusterrelated to meta-analysis in genetics, and the period included atotal of 7 clusters. Cardiovascular diseases, nutrition, and in-fectious disease epidemiology remained the top major topics.Reproductive and perinatal epidemiology and environmentalepidemiology completed the picture.

Identification of bursts

The analysis of the 100 top burst words showed similarpatterns (Web Figure 2). From 1974 to 1999, all of the bursts

0

200

400

600

800

1975 1980 1985 1990 1995 2000 2005 2010

Publication Year

No.

of A

rtic

les

Journal

American Journal of EpidemiologyInternational Journal of EpidemiologyAnnals of Epidemiology

EpidemiologyEuropean Journal of Epidemiology

Figure 1. Number of articles published per year from 1974 to 2013 by journal.

Metaknowledge Analysis of Epidemiologic Topics 95

Am J Epidemiol. 2015;182(2):93–104

Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018

Page 4: Special Article Mapping Epidemiology's Past to Inform Its Future ...

liver ciciiiirrhorrrrrrr sis

invasive cerrrrrvicavvvv l cancer

respiratory syncsynsynsynsysy ytial virus

older pepepepepepepeppp rson

hohohohomiohomihomimih imih mimh ihh cidecicicicicc

equaequaequaequaequaquaequaequaal nnnul nnul nul nl numberbebebbeebe

yeararararararararar old

seeeroese logiogiogigiogiogog c testststst

Los AngeAnAnAnAnAn les

ill perspepepeep on

control l oll lll l wwwomawwwww n

compcompcompcompcompcompco lemeemeemeemelemelemelementntntnt fntntnt ixation

ChinChinChininneseee

reeeeinrere fectfecfecfececece ion

healheaeaeaeaalalalalth cth thth th h h are emeremerememermermermergencencencenencgencg ee

downowowowowow

case fatfafafafafafafaffa alitlitlitlitllitititittyyyyyyy

packpacpacpackpacacacacac

cupcupcupcupcupcupcupcupcuc

C.trachochochohochochochomatis

beveveveveveeragerageragerageragerageragerage

Upstatee NNNew NN York

estiestiestiestieseses matomatomatomatoooomatoomama rrrrrrr

adennnnnnovovovovovoviro us

typepepepepepepe B

beerbeebeeeebeebeeeeee

H1N1H1NH1NH1NNH1NH1N

Cauucucucuucucccaaaasiaaaaaa n

dididiardiardiardi rhearhearheaaaal didididil dil didid seaseaseaseaseaseaseassees e

caffffffffffffffcacacaca eieieiineieiei

uriccccccccc aaaciaaaaa dddddddd

Tecucucucuummmmsehmm

presssssschoochoohchoochoochoochool child

mousmoumoumousmoumou eee

H3N2H3N2H3N2H3N2H3N2H3N2H3NN

Taaaiaaiaiwanwanwanwanwanw

nosnosnosnnosnosn snosnosococococococococoococcomiamiamiamial iiil il infenfenfenfenfenfefeccctcticct onononononono

Washinhinhinhinhiinhinhinhinhingtogtogtogtogtogtogtogtog n Stattattattattata eeeee

sssttrtrtrstrttrttsstttstsss atificficficficficficficficaatiaaaaaa ononononononononononnnnnnnnnnsststaststataayyyyyyyyprinnncincincincinciplepppleppleppleple

parpaparparrparrtnnnnetntn r

IndIndIndnddII iiaiaiaaaaiacururururururrenrerererr t tt st st t st sssmmmmmokmm er

codododododo eeee

trtrtrrararararararaitititititititti

ovaoooooo rian cn cn cn cn cn cn cn cancananananananan er

miidididididididdledledleddd -agagagagagagagagagaged eee man

chechecheemicmimimimi al

Mexicann An An An An An An An AAAn Amermemermermermemememericaiiiii n

hoshoshoshoshososttttt

subbbbbbbbtytytyptytytytyyy e

hepatitis BeBeBeBeBeBe annnnntigtigtigtigigtigtigene

gaigaigaigaigaigaigaigaigaigainnnnnnn

efficcciccicieeenceee y

dogdogdogdogdogdogdogdodo

cononononononononcepcecepcepceppppcepcepceeppttiot n

altaltaalta ernernrnaaatttiaatiaativeveeeeeeve

babbabbabbabbabbabbabababy

USAUSAUSAUSAUS

lymphophophophophoma

Indnddndddndiaaaanaiaiaia

asttstststttthmmmmamhmhmhm

postmenopopopopopopppaaauauaususausaa sal al l alll al womwomwomwomaaaan

Meeexeexexicoicoicocococococo

insinsinsinsnstiiitiittuttttitutut onnnnnn

deeefeeefeefecececctctctctcteccecc

biabiabiabiabibbiasseeeseessseseee

wiwiwiininnteeeertete

sssserss ococococococoonvenvenvenvenveeeeersrsirsirsirsirsisiononononononon

mmmmormmmore ye yye yeareararrrrraa HIVHIVVHIVVHIVVHH

BBBraBraBraBBraBrB zilzilzizilzilzili

total chhhhohohhoooleeeseleelele terrrrrrrrroooolooooo

respiratoooooooryy y y ryry illillillillllillillness

perperperperperperpepepepe foororrorrmaamaanamm ce

iscccccccisi ci ci chaehaehaehahaaeaehaaeaehaahaemiciicicciiicmiccmiccm cmmicccm ccm ccccm hhhhheheheehehhehhhhehhhhhhhhhehheartartaartartaaaartartaartartart didididididdddd seaseeeeeeee

coooouoouoououggghggggggg

cccofcofcofccofofcoffeeeeefeefeef

boyboyboyboyboyboyboyboyboy

birbirbirbirbirth th th hh cocoohohcohhhhhortorortrtrtoortortrtortort

higggghighh h rh rh rh rh rh rh rrrateateateateataaa

AIDAIDAAIDAIDAIDAIDAIDS

preeeeeeeeessussuuuuuusssssss re

girgirgirgirgirgirgirgirgg lllllll

accaccaccaccaaa cideeeideidentntntntntn

colcocococollo ononononnnnnnn

fffalf lfalfalf lllllll

fatf ttfatfat

dririiirirrrrrinkenkekekekekekenker

prooootttectecttectecte ttiotttt n

deeeleeeleeliveiveeeeeiveeeiveeveryryryryry

islisisisislislssssss anndanannnddddaannandnd

cancancancananccerccercercece ririririrrririskssssssstumuumtumumorororororo

resrrr piratooooory ry ry y disease

anananiannininia mmmalmammm

proprororoproproropropp op tectectecteteccccecteccccccctivttivtive eee ee ee ee ee ee ffeffeffeffeffeffeffeffef ct

orgorgorgorgrgorgorgrorgorgaananianianianismsmsmsmsmsmsmsm

schhhhhhooooloooloolccchiccc ld

TTTexTTexTexaaasaaa

assssssumpumpumpumpumpumpppption

maymaymaymaymayymayma

cancananancancanananaanccececer inininncicidcidcidcic encencencncccceeeeeeleueueueukemkemmmkemkemmmmkemmmiaaa

innnfnfnfnnffluluelueluel nnnzannn

biririrthhthhh hthh hhh weieieiiweiieieiweiweie ghtghtghghtghtghtghtghghghghtghththt

oral cl cl cc cl cconononontonntonntn racracracaccccraceptepteptepteptiveveevevevevevve

sepsepsepppsepppseptemtemtemmmtemmberberberbbberererraugaugaugaugaugu ustustustustustststus

preprepreprepreeeprepredidicdicdicdictortotttortotortortortotorto

regregregregregregreegrere resrerereree sssiosssiosion m m mmn mn odeeeeelllllll

ppappapaparppp ityyyyty

highhhhhhihhh h-ddddddddddensensensensensensensensensitititityityityityityy lililililiipoppoppppppopppoppopo rotrotrorotrotrotrotrotrototeineineineineineinein chchchchchchchchcholeoooooooo sterol

ememempemppeee ployloyloyloyyyyyyeeeeeeeeeeeeeeee

seseeenensenseseseeeenensenensitsitsitivviviviviiviv tyyyyyytytytt

cucuculcuululcu turturturureeee

synsynsynsynsynsynsyndrodrodrodroooodrommmmmemm

myoooooooooocarcarcarcarcarcarcararcarardiadiaddddiaddiadiadial iil il il l infarcttttttionionionnioniono

houhouhouhouhouhouhouhouoo sehsehsehhhhhholdoldoldolddd

hephephephephephephhhepatiatiatiatiatataa tistististist B B B B sursursursurfacfacfacfacfacff e ae e eee ntintintitntigengegegegegg

scscscschschschsccc oolooloololololool

ddidieddieieied ttttt

alllllllcocohohoooooohol

brbrbrbrbrbrbrbrbreaeaeaeaeaeaaaeaeaastststststssss ccccananannnnnnanancecccc r

apapapappppprprprpppp oaaaaaoaoachchchchch

hyyhyhyhyyyyyyyypepepepepepepepepeerttrrrrtrrtennnnnnenennsisisisisisississisiononooo mmmmemememmmmemmmememmmmemememmmmemeasaaaaasasurrururreeeeeememmmmeemmeeee ennnnnnnnnnnnnnttttttttttttt

sususuusuusurvrvrvrvrveieieeilllll ananananaannncececeee

mmomooom rtrtrtrttrtrtrtrrttalalalititityyyyy yy yy yyyyyy rararararararararrararararararaaaaatetetetettte iinniinnfafafaaff ntnttttnttnnttttntttttttttttt

cocococococoorororororoonnnanananaaaanarryryyyyyrryrry hheaeaeae rrtrtrtrtrtrrr dddddddddisssssseaaaaaeaaaaeasssesesessesse

ccoccocococcocccc nnnsnsnnnsnnnnsnnsnsnsnn umumumumumumummumptptptptptppp iooooooonnnnnn

illllllnlnlnlnesesesssssssououououououououo tbtbtbbtbrererer akakakakakaka

blblblblblblblbllllooooooooooooooooooooooo d ddddd ddd prprprp essssssssssuuuusuuuuuurererererererererre

vivivirururussssmsmsmsmsmsmsmsmsmsmsmsmsmokokkkkokokkiinniininiininingggggggggg

rerereeererereeererreeeeer lalalalalalaalala ititiiveveveee rrrrrrrrrissisisiisisisisisiskkkkkkkkkkkkkk

anananananaannntitititibbobobodydydyyyydyy

caaaaaaaaasesesesesesesesesse ccccccccconntrtrrooollolooolo sssstututututuuuuuuudydyddydydydydddydydydy

mmmmmmmmmmorrtttaaalllliiiiittttttttttttyyyyyyyyyyyyyyyyyyyyyyyyy iiiinnnnffffeeeeecccctttiiiooooooonnnn

mmmaaannn

A)Cancer

Infectious Disease

Cardiovascular Disease

Reproductive and Perinatal

Nutritional

Figure 2 continues

96

Trin

quartandGalea

Am

JEpidem

iol.2015;182(2):9

3–104

Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018

Page 5: Special Article Mapping Epidemiology's Past to Inform Its Future ...

B)

C)

b-caaarororototeneenenene

dietary cholchochchochchch esterollll

cancer cer cerer cr ontrol

ruberubeberuberuberuberubbbb lla

pancncncncncn reareareaa

maternalalalaalalalalal eexpeeeee osure

maccronutononuonuonono rient

loowow oow ow ow rararaterrarrra

lungunglunglunglunglungunglungunungununnuuuun funffufunfunfunfufufunfunfunfufunffffunfufffffunnnnfunctioctictictictctcctcttctioctioioioctiotioion

soutsoutousousousoutsoutououououthhhh

rectal cl cl cl cl cl caaancer

lower prrrrrrrrrevevevaleveveveveee ence

futufufuuutttutuututufututufutufutuutuuttufu urrererere

FlorFlorFFlorFlorFlorFlorFlorFlorloFloloFlo idaidaidaiidi

chilhilhilhilhilhilhilhilhi d mod mod md md mod mod mod mm rtality

urinurinurinurinurinurinr e

sporsporsposporsporsposporp ttttttt

rQ feQ feQ fefefefefeevevv

paststaststststt yyyyeayyy r

migrmigrmigrgrgrmigrrratioatioatioatiotiotiotioatiotitiooatiotiotiotioatiot oa oationnnnnlowelolloweeeel elo eer rar rr rar rararar rar rararar atetettetetetettet

expeexexexpeexxpexpepeexpexxexpeexpeexpeertrtrtrrrrt

bronbronbrobronnnnbronnbrbb nbbrbbb chchitchchitchitchitchitchitchitchitiiisisisisis

n Gimmmummimmimmmimm nogloglogogoglogogoggg obulobuobu i

betabetetaetaetaetbetbetbee

stilstilstilstilililstilstillblblbilbilbirbilbbilb th

ratiatiratiratiratatiratiatiratira onalonalonalonalnalonalnonalonalonalononoooonooooonon eeeeeee

condondondondondondcondndom uom uom uom uom uom uom uuom uom ssesesesesse

ccarocarocarocarocarocaroottetenetettt

non-Hispspspspspspppppaaanananicaanaaa white

malamalamalamalamalamalaal ria

fetal grgrgrgrgrgrgrgrg owowtowthowowtowtowtoww

minminminminminminininnnuuuteuteuu eeu eu eee

KapKapKapKappapapaposososiosioosos

vitamamamiamiamamiam n En En E

serserserserserserrserolololooloolooloolooololo gygygygygygyggy

offoffofffoffffo iceicececeiceiceiciceee

stostostostostostostoooooooloooo

concoocononoccocococ gengengengengengengengg itaitititiit l ml ml mml mml mmmmaaaalfaaaa ormationblablablalaaablablalaalaaaaaddeddeddeddeddeddded rrrrr

TexTexTexTexTexTexTexexexexaaasa

potassassassassassassas iumii mmmm

malmmmm forororoorororrmammmmatmmm ion

fibfibfibfibffibibereeerereerer

secsss ulaulaulaulaaulaulaulalaularr tr tr tr trrrrr renrenrenrerenrenrenddddddddd

ticccticcticticcickkkkkkk

newwwwwwwwwbboboboborbbobb n

radadadradradrada iati tiiatiatttia ionionionionononionnpppppp

goagoagoagoagoagoaoagooo llllll

sexuaualualualualuaualuaa acacacacacccccctivtivtivtivtivvtivt ityityityityityityityityy

paspasassspasppp sivsivsivsivsivssivsivvsive se se se se see se se se se ssmokmokmokmokmokmokmokmokmokmokmomomokokmookmo inginiinininiiii

attattattattattattattackackackackkckckckac rrrarararraaatetete

first trrririrririmmemesmemememm ter

cascacaasaasscaascaaaasasasasscaaascacaaaascacaccc e pe pe pe pe pe pe pe ppe aaaaatiatiatiaa iatiaaaaaatiaataaa enteentntnt

serum total alalalalal al alall chchchocchccccc lesterrrrrrrrrrolololooo

ovavaovaovovaovovavaoo riariariariariariariarian cn cn cn cn cn cn ccn ancncncncereee

instrrurururururummenmmmmm ttttt

Hissssssssspapanpanpanpapanpapapap ic

hephh atiitististististististisisis CCCCCCC C C CC vvirv us

babbabbabbabbabbabbababbbabyyyyyyyyyy

milmilmilmilmilmilmilm kkkkkkkkkkk

plaplaplaplaplaplapppplplapplannntnn

energygygygygygygy iininintakke

trarararararrararansmnsnsnsmnsnsmms ittittittittttttttteded ed ed eded eeddee disdissdissdissssseeeaseaeeeaee eeeyyyyy

MarMararMaarMarMarararrylaylaylaylaylaylaylaylylylyy ndndndnnnd

faaatatataaaaatheherheertt

higher prprprprprprprprppp eevaeveveee lenleneneneenenennnccececcc

rerererelllrerelrelreelrre atatititiiiatiitiatatatiiatiaa veveveveveveveveeve

concoconcononoononoooo ccepcepcepcepcepepepeppepce ttttttttttt

meameammeameaeaeasleslesleslesleslesle

frufrufrufrufrffffffffffruuuiitititittttttttiitt

intravenoenoenooooous us us s s drdrudrudrudrdrrddd g user

arartaartaarta iclclliclclllicllleeeeeeeeeeeefatfatfatatatttttttattttfatttattfatt

anianiaaaniaa imamalmalmalmalalalalmalal

preeeegnagnagnagnagnagnagnaagnant ntntntt tt wowowomwowomwomwomwwo annnnnnn

HIIVIVIVIIVI ttytytyttt pe

boyboyboyboyboyboyboyboybobobooyy

serserseresersesesseserruummumumumummumumuuu

empempmpmpmpempmployloyloyloyloyloyyymenmenmenmemenmene ttttt

ffevfevfevffffefef erererereree

sigsigsigsigsigggggnnnnnnnnn

geggesgesesesese tatatatatttattatttatattationiononnioniono al alalalalal aall ageageagegegegegegeagag

druuuuuuug ug ug u uuuug ug uusssesesesss

deaaaaaaaaththththth rratrratratrrrrara e

diediediedieed tartarrtartatatatatatarrtt rttttarta y iy iy iy y y y iyyyyyyyyyyy ntantantantaatatatanntat kekkkkekekkekekeke

vegggggggetataetataetaetaableblebleblebleeee

eeeueueurururee ropeopeopeppopepoppeop

carcarcarcarcarrcarrrcincincincincicincc omomaomomomom

cocofcocococofcococoo feeeeeeeeeeefeeeee

culculculculcuccuccucuc turturturururururru eee

serseseseresese opropopopopropoproprevaevaevaevav lenlenlenlenlenlenlenlelennccec

teteteesesessestintintintintinnnggggg

mismmismismismmmissclaaclaclaclaclassissisisss ficficficfff atiatiatiatiationnononnnnn

eeerrerrrreerrer orororororrrrorrooor

prprroprorororororrororrroteeieieietetet n

lolloowowowowowlol bibbibiibbiibirthhrthrth wwwewwwww ight

nutnutnutnununununutn rieeeerierierieentntntttntttttt

ccccaccc rdrdrdrdrdrdrdrdddioiii vavavavavavavavavaascscscscccscsccscccululululularararraraaa rrrrrrrrrrisisisisiii kk k factor

cacaacacancnccncereeeerereereeeeeeerere mmmmmmoooroo taliliilililliilitytytyttytytttyyyyyyyyy

ccececelllllllllll

diaaaraaara rhrhhhhrhheaeaeaeaeaaeaea

cacccc nnncncnccerrererrrerr rrrrrriiisisisiisi k

ppppapapappapappapaareeeeeeentntnnn

alalallllallcocococooococoooohohohohhohohohohohholll ininininininnnnntatttt ke

sststssstsstsssssstsssststrorrororrorokkekekkekkk

pppappappappppppapp ririritytytytytytytytyttytytyttyty

spspspspspspspspspsssssssppspecececececceeeee ifififififificcccicicciiccicccciiiciciici ititittittitiittityyyyyyyyyy

nononononononononnn-n-nnnn smsmmmsmmmmmsmmmsss okokokokkkokokkokokkokkkokokerererererrrereerreerrr

AIAIAIDDSDSDSDDwwhwhwwwwhwhwhwhitititititeeeeeeeee

mmmamamammm rkrkrkrkkereerererererr

high-ddddddddenenenenenenee sissisisisisitytytytytytytytytyyy lllllliipipipipippopopopopopopopopoppopoprororororororoooororor teteteteteteteteteteeeinininiinininini cccccccccchohohohohohh leleleleleleleleeststststststssss erol

ssssususssss rvrvrvveieieillllllanananananananancecececececececececeaanianana mmm

vvavavavvaavvv liliililiddididiiiitytytytyyyytytytyyty

tetetetetetetetetechchchchchninininiququququqq eeee

phphphphhhhhhyyysyyysyyy iciciciciciiccalalalall aaaaaactctctcttivvvvvvivivvivivititititityyyyy

chhhhhhhhhoolololoo esesessstetetetetett rorororoororooroollllllllll

stsststssssts rararainnnini

ItIItItt lalalalaa yyyyyyyyyccccocococcccccocorrrrrrrrrrrrrrrrrelelelelelelelele attatttttttatattatatatttatatatata ioioiooioioioiooionnnnnnnnn

mommmmm rttttt lalalaliititty y y y y y yyy y yyyy rararaaaaaaaraaaaraaaaaaaaaratteteetetetetetetettttteeettetttetetettt

lllaalallalalalaaaaaaaaaaaaaa cocococococooohohoooohoooooooooooohooohohoohhoh llllll

wwwewweweweewewwewwweigiiiigghthththththhthhht

didididididiidiiabababaa etetetttttteseseseses HIHIHIHIHIVVVVVVVVVV

apapapappapapappppapappppppppapppprprprproaoaaaaaaoaaaaaaaaachchchccchccccchchch

bbblblbblb oooooooooood ddd ddd prprpprp esesessessee sususususususususuuusurererererereerrrr

ananananananana titititibobobobobooodydydyddydydydyd

momomom ththerereereeeeee

cicciciciciccccccciccccccccciccicciiiiiggagggagagagagg rrrrerreerrerrrereerrererrererrrrereetttttttttt eeeee smsmsmsmsmmsmmmmmmmokokokkokkokokokokkokokokokkokokiinininiiiniii gggggggggg

pprprprprp eegeeeegeeeeegnananannnncncnnncnnncncncn yyyyyy

cococococococooooonsnsnnnnsnsnnnnsnsnnsnsnsnnnnnnnn umumummumummmmptpptptptpttttppttptptttpptpptptptptppppp ioiioiiooioi nnnnnnnnn

booooooobooboooboobobobooodddydydydydddydydydydydddydyy mmmmmmass ss s s ss ininininininininndedddd xxx

cccacacacccacccac nnccncn ererererere

iiiiiiiiinnnnnnnnfffeeeecccctttiiiooooonnnn

nitnitnitrtrrateateateateate

B.gagagagagagarinirr i

standardrdrdrdrdrdrddd method

HIV epidemic

Egypgygygygygy t

westwestwestwestwestwestwesteererernern eern ern ern popuopuopuopupopupopupopupopupupopupulalalalatillalll ononononnononnn

Q feQ feQ feQ feQ feQ fevvervvvvv

nighnighhttt

HIVHIHIHIHHIVHIVHIVHIV HIV seroeroeroeroeroeroeroeroor ststststastattsst usssss

weatweatweatweatweatweatweathherherherherhhhherherhhh

ruraruraruraruraurarrurarrr l pol pol pol pol pol po popupupulapuppu tion

Japanesee AmeAmAmAmAmAmmAm rican mmammamamamamannnnnnn

hohohomihomihomiomimmmm cidecidecidecidee

tis Chepahepahepahepahepahepatittittittititit

early prrrrrrrregegegegnaegegegg ncy

dietary ary ryry ry ry ry fiber

tranranranranransfusfussfussfusfussfussfusionnnnionio

recoecoecoec gnitgnitgnitgnitgnitgngn ioniononionon

fat distststststttttribibbbubribribriri tionnnnnnn

congconggcononconconggcon eeenitee al mmmmmmmmalformation

catcatcatcatcatcatcat

CARDDDDDDDDDDIA sIA sIA sIA sIA sIA sIA sIA sIA sI sttttudyttt

itemm food frequeueueueueuency ncy ncy ncy ncy ncncy quesquesquesququesquesquesueuesuesuesuesssstiontiontiontiontiontionnairnairnairnainairainai ee

folic acc ac ac ac ac ac ac a id

ArgeArgeArArAArgArgeergA eennntinnnn a

ThaThaThaThaiaiaiiTha lanlanlanlandandandandlannneckkknneecnecckcckckneckcecceecneeneeecec

recrecrecctcctctumumumumu

neural tube ubeubeubeubeubeubeube defects

TurTurTurTururTurkeykeykeykeykeyk

hhhhhhhighhhhhhhighiggheshesheshehehheheheehesheheehhheshesh sst tt tt tt tt tttttttttttttterterterterterterte iiilei

resresresessresrespirpipipirpirpppirrpirpirraatoaatoatooatoaaaaaaaatoaatoryryryy

pplalaaapppppppppppppppppp cebcecececece o

eggeggeggeggeggeggeggggggggggggggggg

CARARARARARARARARARDIA

plalalalaaantntntnnn

multivvvvvvvvitaaaaaitaaitaminnnnnnnn

lung fg fg g fg fg ffg fg funununununcunununnuu tion

adeadededeeeadeeeeeennonoococnonn arcarcarcarcarcinoinoinoinoinomamamammamaammaa

userintntntntintntn ravravravravravvenenoenoenoee uuusus us us dddrudd g uggg

CD4CD4CD4CD4CCD44 cccoccc unt

biobiobiobiobiobioibioiopsypsypsypsypsypsyy

bbebebeeeeeebeeebebbbebbbbb r

fetal grogrogrogrogrogrogrogrogrogrog wth

rrecrecrecrecrecrecrectaltalllltaltaltaltaltall caaacacac ncececececececececerrr

WaWWWalWalWalWWalalWWWWW eesesesesseseeseshoo

oooiloiloilo

liiititlittlititlitlitittletletleletleetletle eeevevevevee idddedddidid ncececececececeee

bevbevbevbevbevbevbevveraeraeraeraeraeraeraeraeraer ge

insuliuliulilililiulililiin ln ln lllln leveeveeveeveeeeveeveellll

smsmsmsmmmmmosmsmmomokkkekekkekkekekkk

parpapapapapapa ticulaulaulaulaulaulaulalatetete e e e te matter

winwiniiinwinwinwiwinwinnnneeeeeeeee

utiutiutiutiutuuu littlitlityyyyy

tictictictictickkkkkkk

ccccororororororo recrecrecreeccecreeccrre tititiotittiottiotttiottttionnnnnnnn

adult popopopoppopopopopoppuulaulauuuulaulalatiotiotiotiotiotioionnnnn

neural tutututututuuuuubeeee eebebebb defectectecectectectctct

teateateateateateateat

impmpmpmpimpimpimpimpm lemlemlemlememlemlemlemlee entententententntntntatiatiatiatitititiatt ononononononnn

warwwwwwawarwarwwwarwamalmalmalmalmalallignignignignigig aancanca ccca cyyyyyyy

Hisssssssssssssspapapapaaananaananpapapaanaaapaap iiiic

energgygygyggy ininininininnntaktaktaktaktaktaktakktaktakktatata eeeeeee

wwwaiwwaiwaiwaissstsssss

intintintinttintnintintrodrodrorodrororodo uctuctuctctctcttuc ionionionionionionoi

ccrocrcrocroccroroocc ssssssssssssssssssss

biabiabiabiabbbb seeesesesees

abbobobobbobbortiiiiiirtirtion

memelmelmelelelelelele aaanoanoanoaaanoanomamammamama

diadiadiadiai rrhrrhrrhhrrheaeaeaeaeeae

resresesr sr spirpirpiririrrirrpppp atoatoatoatoatoatoatoatoatatataatatoaaat ry ry ryry ry ry ddddddidisdisdisdisddisdiseeaeaeaseaseaseaeaseaeaaseaeaaeae eeeeee

spospospospospospospospontantantantantantantant neneoneoneoneoneneeooousss usssusuus aboaboaboaboaboaboabortirrrr on

excessessessessessessessessesses momomoommomoooooooortartartartaarrtartartaalilitlitlitlitllilii yyyyyyy

vitvitvitvitvvitvitamiaaaaamiamin nn Cn Cnn n C

higggggggggh-dh-dh-dh-d-dh-dh-dhhh ensensnsnsensensen iityityityityyy liliiliililipoppoppoppoppopoppo rotein

fevfevfevfevfeveveee eerererer

lunlunlululu gggggg

stastastastatastastastandandandadadadadaaadadardrdddidirddirdrdirdrddrddrdrd zedzedzededzedzeddzezezzeedeed momomooooomooooooortrtrtartartartrtartrtarrt litlitititlittlitititlitlitittlitity ry ry ry ry ry ryyy atiatiatiatiatiattiatat ooooo

insinsinsinsinssssinsssinsnsnsstrrrrrurrtrtrtrttrtrrrurummmmenmenmenennenmenmenmmmmmennmmemmmenennm nnenmem ttttt

horhorhorhorhorhorhorhoro momoomooonmooo eeeee

detdetdetdetdetdetectectectttec ionionionioon

coooofooofofofofcccc feeeeeeeeeefeefeefeefe lyymymymymlyymmymlymlymymmphophophophophop ma

enenzenzenznnenzymeymeymmeymyyyy

seseeeeaaeaaeeseeeasososoooonononsooononso

leuleuleuleuleuuleuleuukemkemkemmkemkemiaii

tumumumtumumumtutuumtuututut morororooror

sersersererseropropropropropopropp evaevaevavalenennnnlenlele ce

eleeleeleeleeeleeleeleleee vavavaatatavavaatedd dedddd dedd risssrisiskkk

corcorcorcorcorcorcorcororcc lrelrelrelrelateateattateateateateateateateateeatateeataatateateateate

insininnnininssinsnsssuliuliuliuliliuliulinnnnnnnnnnnnn

admadmadmadmadmadmadmaa ississsssissssionionionionononi

nuuuutuututrieeeerieerientntntntntntnt

matmatmatmatmatmatmatmatatatereeernernernerne al alal alalalalaa agagageageageageageageee

pospospoposposostmetmetmetmemmmenoopopopopopooppnnn pausauussssusaua ssssssssssssaaaalaaalalalalalalalaaaaa wwwowomomomomomomomomwomwomwomomomwommmananananannana

aairairairaairirirairirr pppppoppopollululluuuuuuluuuuuuul tttiotiotiotiotttiotiotionnnnnn

exxxcxcxcx essssssssessess

gengengengegeggegeg eeeeeeeeeeeee

coecoccoecocoecoeooecoeeeeeeeeeffiffifffiffffifficciiieiicccic ntntntntntntnntntnt

brereerererereastastastastastastastaast cacaccccc nccecenccecececer rr rr rr rr rr rr rr rriskiskiskiskiskiskskkk

AIDAIDAIDAIDSSSSSSSS

ststststss rarararainnnnininin

bblblbbbblbbb acacacackkkkkkkkk

aaaagagagaa eenenennnntttt

asasassssassasassa thhththhmamammmaaamaammamaa

highhhhhh-d-dd-d-dddenenenenenenennennsssisisisisisississ tytytytytytyty lllllliipipipipipopoppopopopo rrrrrororrroooteeeteeteeeett ininininininininn cccchohohohohohohohohoolelelelllllll stststerererererrerrrerolllololololololololo

apapapapplplplpp icici atattatioioioionnnnyyyy

nnnnonnonnnnnnnon nnnssnsnsnsmmommooooomomokekekekekekekeeekeeekek rrr

eeereeererrorororrrrrrr

lulll nnnngngnggngngg ccccananancecececeecerrrrr

vvvavavvvalililidididitytytytyytytyy

ststststststrarararatetetetegygygygyg

oooboboboobbbbesesesesitittttttitityyyyyyyyyyyy

alaalalalalallcococoohoohohohollldididididddieteteteteeet

ccccacacaccacarrdrdrdrdiioioiioiooooiovvavavavavaaaassscscscs ululularararararr ddddddddddddisissisisssisisiseaeaeaeaeaeaeaeaeaasesesesesesesesesee

HIHIHIHIVVVininn

ala cohol lll lll cccocococccocococoonsnnsnssumumummmmummmptptpttpttttttptpttptptptioioiooooiooooioioioioiioiooi nnnnnnnnnnnnnnnnnnnnnnnn

brrrrrreaeaeaeaeaeaeaeastsstst cccaananaancecececececeeececeeecececerrr

apapapapapapapappprprp oaoaachchchchchchchh

bbibiib rtrtrtrthhhh

prprprprrprprprprprpregegegegeeeeee nanananaancnncnncncncccncncncncnncncyyyyyyyyyyyy

cocccccoconsnsnnnssnsnsnnnnnnnnn umumumummmumumppptpppttp ioioioioiioioioooionnnnnnirrrrireeeeere

bbbbbbbbbbbbboooooodyyyyyy mmmmmmmmmmaaaassssssssss iiiiinnnnnnnnnnnnnddddddddddddeeeeeeeeexxxxxxxxxxiiiiiiiinnnnnnfffeeecccctttiiioonnn

Cancer

Infectious Disease

Cardiovascular Disease

Reproductive and Perinatal

Nutritional

Environmental

Cancer

Infectious Disease

Cardiovascular Disease

Reproductive and Perinatal

Nutritional

Female Cancer

Figure 2 continues

Metaknowledge Analysis of Epidemiologic Topics 97

Am J Epidemiol. 2015;182(2):93–104

Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018

Page 6: Special Article Mapping Epidemiology's Past to Inform Its Future ...

D)

ankle brachiachachachachchach al index

winewinewinewinewinew

readadadadadadermultivariatteeeeee relrelrelrr ativaa e risk

chromosomomomomomo me

tototototatototot l efefef efefeffect

meanananananannnssssss

low-w--w----densnsdensdensdensdensdensensdensdensitytyyytyyty lipolipolipolipolipolipopolipolipolipoprotprotprotprotprotprotprotprotprotprotprotprotproproteineineineineineineineinne

inseininii cticcticctictcticcticccticideedededdeeideidediddedeedddeideeidede

fefefetutututufetuufe ufe uuuuf sssessessesessss

ndistinctincncncncncncc io

casecasecaasasasas -crossovsovsovsovsovssover dee esign

aaaacycaaaa lic c c c cc ggrapggggg hdi ti

poisoisiiiisiiisssssonssssss

Norwegiaiaiaiaiaaaannn monnnn ther

large ste ste se se se stee ste stse ste se s udyudud

inflnflnfllnfluenzuenzenzuenzenzenzza via via via via va va via viv rusrrrr

recreceeecerecrecerececerececeiptiiptiptiiptiipipparepapareareareareparepareareea earerentaltttt llll edededuedueddududduedededddduduedddd catititionononnnnnn

pancreeatttic cc cc cc ccc cc canceaaaa r riskskskkskkkNNIH-NIHNIHNINIH AARPAARPAARPARPAARPAAAA diediediediediediettttt

miscccccarriarriarriarriarriarriarriarriageageageagegeageagageagagageagaggeagaagg

idedeideadeedeadeaideaaideaiddedeadeaed ad addddeadea

HIV HHHHH testtestestetestestes ingngnggg

child cooooohorthohohohorthohohort ttstutststststststsst dyddydyddydydyy

viololololllatatioatatatat n

micrcrcrrrrogogog mogogog

mendmemmmmm eliaaaan rn rn ran rn rarandomnnnnn ization

auauauuutitiutiutiaututiautautaaauuutiaaaaaauaaa sssmmmsmsmss

actactactactactaact

HIVHIVHIVHIV/IV/IV/VV AIDSAIDSAIDSAIDSAIDSDSAIDSSS

sstttstudstudstustustudstsssssstudy rey ry reeeererereesultsultsultsultultsss tsss

rrrruuraruraruraru l arl arl arl arl arl arl araa ea

wintwintwintwintwinwinwintinteeeereee

neural tubeubeubeubeubeubeubeubebebe ddddefedd ct

medimemmmm ation an an an ann an aa alysis

folafolafolafolafolalaatttetetet

fetuetuetuetueetetuetusssssssss

pestpestpestpestpestpestpestpestpestpestpestpestpestestpestpesepespestestspestp icidiiiiicicidiicidicidicidicidcideeeeeeee

discisciscscscscsscipliipliipliipipliipliplliiplplp ne

seasseasseasseasseseasseassesss onalonaonononononon ity

intententententeiinnteiintentei lliglliglliglliglliglliglliglliggeeenceencencenceenceeeenceeeeeeee

firsfirsfirsirsfirsrsrsrsst bit bit bit bit bit bt biit rthrthrthrthrthovarovaovarovarararrv ianian iann nnn n canccanccanccancanccanccanann erererrr

hhhhhh

genetic assooooooociaiatiaaciacia ion ion ion ion onon study

evolevolevolevolvoevoevoevollo utitiutioutioitiotiotioonnnn

breareareaeaeaeaae st csssss anceaanceanceanceanceancancer car cr car car car car car asesesesee

ARICARIARIARIARARIARIARARARAR

formrmrmrmmmulaulaulaulauu

alleallealleeaaaalleealleeeergrggyggygggrggrgrggggyg

acciccicciccccicciacciaac dentdentdenddentdentdeententeneen

sucsucsuccsuccucccccessssssessssesss

genetitictic tiic ic eeffeeeee ct

urinrinrinrinrinrinnneeeeeee

communinitniitniititieeees ieeie stustuststustustustudstust y

parparpartrtrtrtrticicclecicicicc

calicacccccaaccaa bratbratbratatb attioioioononononononioonnioioidddddddididdidddiddddid

H1NH1NH1H1H1N1H1N1H1N1H1N1H

arsarsarsarsarssessearssarsrsesea nnnicnnnn

preeclamclamclamlamclamcllamlampsiapsiapsiapsiapsipsisispsispsisssspsipsipsipsip

ccccarcarcararcarcaccarrrrrrdiodiodiodiodioddiodiodiodiodididiodioddiodiodiooood vasvasvasvasvasvasvasasvasvasasasv svasscuuulcululcuulllaaaar aaaaaa eveevevev ntntnt

calalallallcciuciuciucciuciummmmm

hhhhheahhhhh rt rtrtrtt tt faaaaiafafa lurrreeeeeeee

deadeadeadeaeadeadeadeadeadeaeadeaadeaddeadeaeaddeddead aadd ttttth thtthth th th rraraaatrrarararaararrr eeeeee

aggggegegeeeeegg nntntntntntntntnntntntntnttnntnnntnnnnn

estesestesestestestrogggrogrogoggenenenenenenen conconnnnnononcononcononceepppppppepceeeptttttt

cohorororrtrtrtr pprpprprrrrrpppprrooofiofiofiofiofiofio iofioooooo lelelelelele

thththhhhethhehhehethethhhthehhhhthhthtt ooororrryorrrfrffrufrururuititttiit

gengengennnegenngenngengeneee-eeeeeeeeeee nvironnnnmememenmememe t interaction

altaltaltaltaa ttererernerrnrnrnrneeeeer aaatiaaaaa ve

ccancacancancacancancanancancaaacancccccancccancccercerrrrrcercerccerrrrrr moooooooooooommommortartartartartartartaalititttlitlitlitlittti yyyyyyyyy

scsscsciciciiiiscsciiciiiiencencccenceencenen e

sususuupssusu pplpleplppleleplpleemmmenmennnnnnm nmmmennnmm tttttttt

ssuiisuisuisuisuiss cidcididciddciddddc ddeeeeeeeeee

mmmmmenmeneneenmenmenenenenennmenmmenmenemenmmeneenmm tttatat ltaaltaaalltallttala hhheheheheehhhhhhhehhheehhehhehheehhehealtaltaltltltlttthhhhhhhhhhhh

outouttttttbrebrebrebrebrebrebreakakakakakakakkk

mmismmmmmmm claaaaaaaa issssssississsssissssiss ififiicfiifi atiiiioononononono

goagoagoagoagoagoaggggggg llllll

p p p vvvvvp vp alualuluuuualualuuuuualuluuueeeeeee

lifliflifliflififfl e ce ce ccccce c cccce ce e ourururoururoururrrseseseseseseseeseeesesssessssesesse

temmmmmmmmperperpepeperpepperaaaatuaaa re

mmedmedmedmedmedmedmmmmeddm dmedmmedmme iaatiatatttiaiatiaiaiaatiooonioonoioooiooii

vvvvvirvirvirv usususssss

spespespepespeespeeeecifcicifcifcifcifcifcifcifcifcific ic ic iciccic iciciciic mormormormormormorororormorormooooormoooo taltaltaltaltaltaltaltalalityyyyyyyyyyyyyyyacciacciacciacccc dededenteent

samsamsamsamsamsampppleppleplep sisisisiisisiizezezezezezezeze

carcarcardiodiodiodiodiodidiodidioddd vasvasvasvasasasvasvasvasvvv ccculcculcculc llculculaaar raaarr r ar r r aa mormormormormormormormomomo ttatttaalalalalatataaltataalaalaa ityytyityityyityityi

gggirgirg rgirrrlllll

vacvacvvacvavacvacvacvva cinnnncincinc eee

epiepiepiepiepiepiepepepip demdemdemdemmmdemmmmicicicicicicc

tuuuumumumu ororororroofifififiefiefief ldddddlddld

covcovccovcovcovcovcovvcovvvvcovovovvvcovcovcovcovovveeraeraae aeraraagegegegegegegegege

sssssceesssceescss esss nnararrnararrrnn rarrrrarnarrrrnn ioiooioioioi

resesesresesssssr sourouroururou cecececeeeeee

aaaallaaaaaallaalleleeeeeleeleeeeeeeeeel

seseseeeaeasooooonononononononononnnonosoo

innnnineinenineininineiniii quaquaquaaaauaquaqu litlitlitttlitityyyyyyyy

sysysyssssssyssyssysy totoltoltotoltoltotototooo ic ic icicic bbbbblblobloblobloooodododddddoddodo prepreprepreprepreprerep ssussussussusussusussussusuuusurereereresspsppppp

sseseseseseseseseelseselselselseeleeeleeesee eeecectctectee ionioiononn

particcculaulaulaulaulauuu tete te te e matmatmatmatmatmatmatmatm tttterttt

simsimsimsimsimsimss lulaulaaatiotiotiotiotiotiot nnnn

lunuununlunnunnnnung cgggg cgg cg cggggggg cg cg cggg annncncncncnccnncccncnnnnnncannanncana eeeeererereeerre

cigiiicigcigciggarearearereeeereeeeeareeeareareeaaa ttttttttettetttttttetttt smsmmmmmmms oooookioo nngngngnggnnnnsususuuupppplplpleep mupppp

vvvvvaaaaararvavavavaaavaraavaaa iaannnniananniaaiaii t

ddddededeedeledeedeldeeldddeedddeeldeeeelede iveveeeeeiveeiveeei eryyyry

popopolpolpolpolpolpollyyymyymymoymymoymoymymomoymoymomoymymymmym rppphphrphphrprprrprprpp ismismsmsmsmsmmismsmm

grggggroggrgrogg wthwtthththwthththhwaywaywaywayy

eeerreeeerree rororor

pppopolpopolpololicyicycyyyicyicyy

eeeefeffeffeffe ortortortorttttttt

HIVHIVHIVVVVHIV

pepepepeperpepepepepepepeperperpere fofoforfoforororffffffofoooormanmananmanmanmmmama cececececeeececee

brebrebrebrebrebrebreb easasasastastastaasa caacac ncncncecececencerrrrrrr

airaiairairairirairairair pppppopopop llulluuutiotiotiotiotiotiotiotioonnnnnn

assssssssssssasasssssssumpumpumppppumpptiotiotiotiotiotiotion

bblblblblblblblblblblblblooooooooooooooooooooooodddddddddd pprprprprp esesesssessse sususususussusus rerererererererer

cacacacacacacacacacaaausususssssssuuu eeeeee ee e momomooooooomoo trttttttttalalalalalitititittititititityyyyyyyyyyyy

hehehehehhehhheaaalalalaa ththth ssssstutuutututututt dydyyyyyyyyydyyyydyyydydydyyyyyydydyy chchchchchchchchchcccccc iiiliiililii dhdhdhooooooooooooddddddddddddddddddd sesesseseseseseseseeseeesesessssssssss tttttttttt iniininnggggg

ggegegeggegeneneeneee

ppapapapaapepepepeppepepeppppp rrrrrrrr

cocooocococonsnsnsnsnsnnsnsn umumumptptptptptptpptioioioioioioonnnnnnnn

mommommmmmmmmmmmmmm ttththhererere

ininininininiiinininininnii ffffefefefefectctctctc ioioioionnn

bibibbiasasssasassprprprprprprpprp eeeegegegeeege nananaancncnccccccncncccccccyyyyyyy

reeeeeeeeseeseseseees araararararrchchchchchchchchchchhhhhcchhhhchhcchhhhhhbobobobobobobobobobbobobobobobobobobobobbobobbobbobbobboob dydydydydyddydydydydyydydyydydyddyydyy mmmmmmmmmmmmmmmmmmmmaaasaaaasss inininininnnninninnnnddddedeeedededeeeeededdd xxxxxxxxxxxx

memememmmmmmmmmmmmmmmmmm thththththhododdododddoddddddddo

E)

South Koh Kh Kh h Khh h h rea

P chloroororoorooroororororophenyl

dietary ry ry ry ry folaff te

yabdominanananananananananal obesity

IRRIRRIRRRRRRRRRRIRRRIRIIRRIIRRRIRIRR

ironironironironroironironiro

short teeeeermrmmm ermrmrmm ffect

resresresreseesstresrestresesstr sstesststresstsser

increaseeeeed mod mod d mod mod momod mod modd d d rtalrtartalrtalrtalalalrtalalaliiiityiii

dddaugdauaaugugugugd ugaugdaudauaugdauuauughterhterhtehterhterhterhterhtee

cigaccigacigarettrettttettttretrettrettrettr ttrettretttttetttettettette sme sme sme smssmme smme smmme sme sme smee smokeokekekekeokeeokeokeokeokoo eeee

chilcccc d momomomoortality

youtyoutyoutyoutyoutyoutyoutyoou hhhhh

younounououou g wog wg wg wg ww mmmmanmanmanmmaanannna

ttttreattt tmenenenenenenenenttt eft fect

EPICEPICEPICEEPICEPICEPICEEEE

poorpooroooooopoorpoorpoorpoorpoorpoorpoorpoor heheheeahhhehhh lth

LondndndLondLondLondLondndLonddndddnnddonnddn oooonononononoon

SeSSeSSeatSeaeattSeSeSeSSeeatSeeatatatttltltlettt

point esesesesesesese timat te

normal wal wal wal wal wal wal wal wal wal eeieieigeigheieigeiee t

growth fh fh fh fh fh fh fh fh fh factoaactoactoactaacta rrrr

CARDCARDCARDCARDARDARDCARDRDRR IAIAIAAIAAAAAAA

bodydydydydydydyy mass

time se see sssee sssseeeerieee es

HawHawHawawHawaawawaiiaiiaiiaiiaiiaiiaia

fooololollatattetatatatt

skkskkkiskskkikkikssssssskkks nnnnnnnn

nonnonnonnonnonnonnondddrdridririddririd nkenkenkeeenkkenkenknkeenkerrrrrrr

slemememeaeeameeam sssssss

feefeteefetfefeffettetetfetfettfetettffe aaaalaaalalaaaaaalaaaaaaaallaala

fatty y y y y y aciaciaciaciacia dddddddd

corcorcorcoroororcororcororcorroonanaonaonaonaonanaonaonaoonaoo ryryryry ry ryryryryry event

MEDMEDMEDMEDDDDDLLLINLLLLL E

weaweweweaeaweaeweaweweweweaweaw ththththheththt r

sprsprsprsprprsprsprsps eaeaadeaeaeaeae

genetic vc vc vc vc vc vc vc variant

carooteoototeoteeennoinnnnnn ddddd

tratraaratraatratraaaarafffififffiffffffffffffff cccccccsumsumsumsumsumsumsumumumummm

steststetestesstststetesteeteeteteeeeeeeeppppppp

nutriennntnnntnt intintintinti taakakeakaaaa

immmmmmmmimmimmm ununniunuu ty

happpplotlotlotlotlotlototlotypypypypypeypypyp

clecleclecleclecleeeleleft ftft ftft ft lip

aduaduaduaduaduduuuduaduuuduuuuuuuuudullttlllt ltltltt llife

genetic c c vc c vc vvvvaaariaaaaaaa ation

pubububbubblliclicliccatatatiatataa ononononott

polpolpoololpolololpp lutllutlutlutlututaananantanaaa

nnnneunnnn ral tuuuuuuuubeeee ebebee defect

plaplaplaaaaasmmmmaaaammmmmammamasmsmmmmmmma

ethethetheththethethnicnicniccccnininicccnn cnicnnnn dddiddiddididifffefefefeffffffff rennnnncececeecccece

raraaddraddr drarrradrararar ddiatiattiatiatttiationionionionnion

HuGE rE rE rE rE rE rEE evie ew

metmetmetmetmetmetmetmetaboaboaboaboaboaboaboaboababolilitlitlitlilitlittl e

jouuuuuuuurnnnnarnnrnrn l

genenenengengenengenene ee ee ee ee ee ee ee eenviviiivinnnnnvivivinnvivirrrronrrr menmenmemenmenmememe t interaction

dddddedeeebbdeebebdded bddedddeeebeebbateateateateateateateate

simsimsimsimsimimimsimmssimsssimsims ulaulaulaulaulaulaulaulatiotiotiotiotiotitt nn snnnnn tudy

cholessssterterterterterterterterterrrooloololoooooo levlevlevevlevlevlevlevllele el

validaidaaaaidaidaidadadattiotiotiottiotiotiotttitiotiottiotiotionnnnnnnnnnnn

uuurbuuuuuuuuuuurburbrbuur ananananaaa arareaarareararearearareararea eareaarea aaaaaaaaa

ccccooouououuuc ucoouuuoupppppleppppp eepppp eep

ststastatatasttaststass ndaaaaaandndnd rdrdrdrd rdrd eeerror

inffflulueluluueueueluennnnzannn

DNADNADNADNADNDNDN

cccucuulcuculuc lc turuturtururureeeeeeeee

preeeprpreprepreeepreeepreepreeeeeeeeetertteeeteteetetetetteteteetetett m dm dm dm dm dm dm dm dm dm dm deliliiiivevvvervevevvervvervv rvvveryyyyyyyyyyyyyyyy

corcorcorcorcocorcorcocococococococoococooococococoo relrelrelrelrellatitititiatatatataa ooonoononn cccoecoecoecoeccoecocoecoecoecoeccocoecoocoecocccc ffiffiffifffffffff ciiiciieiciieieeennnntttttntttnnntntnnntt

deadeadeadededeadeadeaeaeadeaeaeadeaadd tthth thththtththth ratratratratratatrratrrateee

rededededededdeduceucuceucuceucuucucuc d rd rd rrd rd d d iskiskiskkiskiskiskssk

ppeapeapeapeapeapeapeakkkkkkk

fatfatfattt

enenzenznzenze ymymmmmmmemmmyymmmymmmymmmy

cycyccycyccycyccyccyccyccycccycycyycccycycyccyyccc cleeeleeleleeleeeelellelelellelel

HHIVHIVHIVHIHIVHIVIHIHHH inininininfefeecfeceeee tiotiotiooooonnnnnnnnn

ruururrurrurrrurrurururuuurrurrurrrurrurr ralalalaa areareareareareraarararar aaaaaaaaa

supppplepppleplep menmenmenmenmmmenttt bbbiabiabiaiaiaseseseseese

vegvegvegvegvegvegvegegetaetaetaaaaaetableblelelele

maaatataataaaataataattattatttterneerernerneeereeereeereeeee aaal allllala ageagggegegeageageageageageageagegegegegeaggeageageeageggegegegggegeii ttttttttttteliveere yyyyyy

papparppaparparpararpparparppparpap ticttitticticttticttticticttictict cculaulauluululullulaulaulululaulululaulauulaatete e e etee teete mmamamamamatmammmm terrr

hheaeaaheaheeeaaaaheaheaheaeahhhhheheaaaahheaaeaaaaeaalttththtthttltthlttltlltltlttltttlttt eeefeffefeeeefefeeffecececcectttt

ccancaannancannncancancanccaanccanncaancacacancaancanaannnnannnanaaancercceeerrcereereececeerrcerccc rceceeeereerrrr momomomomomomooorrrtartartartarrrrrtarrrttar aarrrtrrrr ar alitlitlitliitlili y

leuuuuukemkemememmmmmmmmemmkemmmmmmmmkemkemia

ininineineeeeneeeinineineinii quaquaquauaquaquaaquaquaquaauaaaquaaquaquaq allllitlll y

tutututumtumtuummuumummuu orororror

boyboyboyboyyboyboyboyyysitsitsitsittitsitssitsitsitsitsitsitsits uatuauatuatuatttuaatuatuatataaauuuu ionionionoonononionononoonononnionooooooooo

iigirgirgirrgggg lllll

epiepiepiepiepiepiepepie demdemmmmdemdemde icicicciciciic

virvirvirviv ussssususs

CalCalCalCalla ififfoiffoooififoorrnirrnrnrnrniirnirnirniirniirnirnnrniiir iir aaaaaaaaaaaaaaaff

ccccccccocoucocouccc unnnntntntnnnn

pppparparppppppppppparrrrp ityityityyitytyityytytytyytytyittyt

CoxooCoxCoxCoxoooxCoxoooooxoooxoooCoxCoxC propoopoopooopooortirtirtirtitirtrtirtirtirtirt oooonaonaonaoo l hl l hhl hhhhl hl hhhhhhazzzaazzazzaazazazazaazazazazazzaa rdrdrdddddsdsdsdsdddrddddrdrddddr momomomomomoomommmommodeeeeeleleleldddddddelEEPEPEPICPEE

yyyyyy

dd ll ll

cacacanananca cercercercer riiiiiskskskskskskskskkskk ococcoccoccoococcococcocccoccoccoccccoccoccoccooccoooooo co upaupaupaupupaupaupaupaupaupaupaupaupaupaupaapaupuuupp tioitioiitiotiotiotiotiotioootiootioonalllnalnanalllnalnanalan exexexxxxxxexexxxexexexpopopopospospososopopopospppoopopopoosssurerereurereeureureeurlll

mmmmmorororommoorlitlitlitlitlitlitlll eeeeraraeraeraatuuturturtturt eeee

ggrgrogrogggggggg wttwtthttwtthllllllllll

sysysyyysysysysyststststttssststststss olololololololiciciciciicicicicicc bbbbbbbbbbbbbblolololloodddddddodo pppppppppprerererererereressssssssssssssurururururururrrreeeeeeeeee

foood freequququququuueneneneneenenencycycyy qqqqqqqqueueueueuessstsstsststtioioooooiooionnnnnnnaiaiaiaiaiaia rerererere

asasasassassassasthhththtt mmamamamaaaammaaamaaam

popppppppp lyyyyyymmmommmomm rppppprppphihihihismmmmmmmmmsmsmsm

mmemememeeeemeememeeeemmemm taatatatatatata a-a-a-ananaaaanaanaalylylylylylyyysssssiss sssssssppppppppppppp

lolooolololooooloolooloolololowewwewewwwwwweewerr rr rrriiriririiiirrrrrr ssskskkskskk

ofofofofofofofoffffffsfsfffsfsfffffssf prprprpriinnnninininnninininnni ggggggggggggggggggggggggllll

HIHHIHIVVVVV

asasasasssususussumpmpmpmppppptitititittitititiooonooooovavavavavavavavaalilidididididiiitttyttytytttytytyttytyttytyttytytytytyyyy

dididietetet

mommomooooomomomommooooooooortrtrtrrtr aalalaalittitityy y yy yyyyyyy rararaaaarararaaaaaaaaaraatetetetetetetete

bibibibibibibibirtrtrtrrtrrtrthhhhhhhhhhhhhhhhhhhhhhhh ewewweeeeeiigigigiigiigiiiiigighththththththh

ininnnniniiniiiiii ffafafantnttntntmmm

ggggegeggggggggggggggg neeeneee

pprprrrrrrprrrpppp obobobobobbbleleleleeeeemmmmmmmmm

cocococococococccccococorororororororororoonanananananananananananaaryryryryry hhhhhhheeaeaeaeaeaae rtrtrtrtrtrtrtrtt ddddddddddddddddisisisssssississiiississeeaeaeaeaeaeaeeeeeaseseseseeseeseeeee

wweweweweweigigigigigigghththhthhhthththhhhhththththhhthhttthhtththhthhhhh

epppepeppepeepepepepepididddddidddidddddememememmememioioiololoologygygyyyygygyygygygygg

ccacacacacccaaardrddrdrdrdddddr ioioioioioiooioioioioiovavavaaaavavaavavavasscssssssscculululularararrrrrrr ddddddddddisisisisisissiississeaeaeaeaeaeaeaeaeaeaeaeaeasesesesesesesesse

prprprrppprprrppprprprpprrrprprrrprprrrrpregegeegeeeeeeeee nannaanancncncncncccccncncccccnccccccccccyyyyyyyyyyyyyyyyyyy

ininnnininnnnnnnnninnnnnffeffefefefeffectcttctccc iooioioooooooooooooooooonnnnnnnnnnnnnnnncococoooooocooocoooococ nnnnnsnsnnsnnnnnnnnnnnsnsnsnnnnsummummmummmppppptptptpptppptptpppp ioioioioiioiioionnnnnnnnnnnnnnnnnnnnnn

bbbbbbbooooooodddddddddyyyyyyyyy mmmmmaaaassssssssss iiiinnnnnnnnnnnnndddddddddddddeeeeeeeexxxxxxxx

Cardiovascular Disease

Methodology

Infectious Disease

Nutritional

Environmental

Reproductive and Perinatal

Meta-analysisMethodology

Infectious Disease

Nutritional

Environmental

Reproductive and Perinatal

Cardiovascular Disease

Figure 2. Mapping and clustering of terms in 5 high-impact epidemiology journals for A) 1974–1989, B) 1990–1995, C) 1996–2001, D) 2002–2007, and E) 2008–2013. The maps show terms as labeled nodes. Some terms appear to be misspelled or truncated because of the tasks of lin-guistic processing that were performed before themapping and clustering of terms, as described in theMethods section. Node size is proportional tothe term frequency of occurrence (i.e., the larger the node, the more articles include the term). Terms that are far away from each other do not orrarely occur together in the same article, whereas terms with high co-occurrence are close to each other. The clustering of the terms is displayed ontop of the map by coloring nodes based on the cluster to which they belong. Clusters of terms are interpreted as major epidemiology topics, andclusters located close to each other in the map indicate related topics.

98 Trinquart and Galea

Am J Epidemiol. 2015;182(2):93–104

Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018

Page 7: Special Article Mapping Epidemiology's Past to Inform Its Future ...

Table 1. Evolution of Major Topics in 5 High-Impact Epidemiologic

Journals and in a Subset of Articles Published in 6 High-Impact

General Medicine Journals, 1974–2013

Topica

1974–1989

EpidemiologyJournals 3,725Articles, 951Terms, %

GeneralMedicine

Journalsb 8,602Articles, 823Terms, %

Infectious diseaseepidemiology

36 24

Infection 14 13

Antibody 8 6

Virus 7

Outbreak 6

Illness 6 6

Prevalence 5

United States 4

Cardiovascular diseaseepidemiology

24 16

Man 15

Smoking 7 3

Blood pressure 6

Cigarette smoking 5

Adjust 5

Risk factor 6

Relative risk 3

Diabetes 3

Cohort 2

Cancer epidemiology 15 19

Mortality 12

Cancer 11

Mortality rate 4

Death rate 3

Lung cancer 2

Therapy 14

Survival 5

Cell 4

Chemotherapy 3

Recipient 3

Reproductive andperinatal epidemiology

12 5

Case control study 12

Relative risk 7

Confidence interval 6

Pregnancy 4 4

Infant 4 5

Mother 3

Birth 2

Delivery 2

Clinical trials 20

Trial 10

Placebo 8

Table continues

Table 1. Continued

Topica

1974–1989

EpidemiologyJournals 3,725Articles, 951Terms, %

GeneralMedicine

Journalsb 8,602Articles, 823Terms, %

Dose 7

Efficacy 6

Improvement 4

Health care quality 16

Physician 6

Care 4

Survey 4

Cost 3

Service 3

1990–1995

EpidemiologyJournals 3,948Articles, 1,116

Terms, %

GeneralMedicine

Journalsb 6,434Articles, 903Terms, %

Infectious diseaseepidemiology

32 15

Infection 12 14

Antibody 5 5

HIV 5 7

Italy 4

Sensitivity 4

Detection 4

HIV infection 3

Cardiovascular diseaseepidemiology

21 18

Body mass index 8

Cigarette smoking 6

Blood pressure 5

Coronary heart disease 5

Diabetes 5

Case control study 5

Baseline 5

Adjust 5

Smoking 4

Hypertension 4

Cancer epidemiology 18

Cancer 10

Approach 5

Mortality rate 4

Validity 3

Example 3

Reproductive andperinatal epidemiology

14 8

Pregnancy 6 4

Mother 5 3

Birth 5 4

Table continues

Metaknowledge Analysis of Epidemiologic Topics 99

Am J Epidemiol. 2015;182(2):93–104

Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018

Page 8: Special Article Mapping Epidemiology's Past to Inform Its Future ...

Table 1. Continued

Topica

1990–1995

EpidemiologyJournals 3,948Articles, 1,116

Terms, %

GeneralMedicine

Journalsb 6,434Articles, 903Terms, %

Infant 5 5

Smoker 4

Screening 5

Nutritional epidemiology 8

Consumption 8

Diet 5

Alcohol 4

Correlation 4

Food 3

Female cancerepidemiology

8

Breast cancer 4

Parity 2

Family history 2

Oral contraceptive 2

Menopause 1

Health care quality 27

Care 9

Survey 8

Practice 6

Questionnaire 6

Physician 6

Clinical trials 21

Therapy 14

Trial 14

Placebo 9

Efficacy 9

Dose 8

Cardiovascular diseaseepidemiology

12

Sensitivity 5

Myocardial infarction 4

Stroke 3

Specificity 3

Acute myocardial infarction 2

1996–2001

EpidemiologyJournals 4,492Articles, 1,346

Terms, %

GeneralMedicine

Journalsb 6,891Articles, 1,009

Terms, %

Infectious diseaseepidemiology

36 25

Infection 11 13

Approach 5

HIV 4 6

Antibody 4

Table continues

Table 1. Continued

Topica

1996–2001

EpidemiologyJournals 4,492Articles, 1,346

Terms, %

GeneralMedicine

Journalsb 6,891Articles, 1,009

Terms, %

Strategy 4

Survival 8

Cell 4

Sensitivity 4

Cardiovascular diseaseepidemiology

21 29

Body mass index 10

Baseline 5

Physical activity 5

Hypertension 4 4

Alcohol consumption 4

Diabetes 5

Case control study 5

Infant 4

Birth 4

Cancer epidemiology 15

Lung cancer 3

Cigarette 3

Nonsmoker 3

Cancer registry 2

Cancer risk 2

Reproductive andperinatal epidemiology

13

Pregnancy 7

Birth 7

Mother 5

Infant 5

Breast cancer 4

Nutritional epidemiology 10

Consumption 7

Diet 4

Validity 3

Error 3

Agreement 2

Environmentalepidemiology

6

Asthma 2

Air pollution 2

Season 2

Respiratory symptom 1

Respiratory disease 1

Health care quality 25

Care 9

Quality 7

Survey 7

Practice 7

Table continues

100 Trinquart and Galea

Am J Epidemiol. 2015;182(2):93–104

Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018

Page 9: Special Article Mapping Epidemiology's Past to Inform Its Future ...

Table 1. Continued

Topica

1996–2001

EpidemiologyJournals 4,492Articles, 1,346

Terms, %

GeneralMedicine

Journalsb 6,891Articles, 1,009

Terms, %

Physician 7

Clinical trials 22

Trial 21

Placebo 11

Efficacy 10

Dose 7

Double blind 6

2002–2007

EpidemiologyJournals 4,180Articles, 1,236

Terms, %

GeneralMedicine

Journalsb 6,283Articles, 978Terms, %

Nutritional epidemiology 24

Consumption 9

Diet 3

Inverse association 3

Incident case 2

Lower risk 2

Cardiovascular diseaseepidemiology

22 20

Body mass index 10 4

Cardiovascular disease 6 5

Weight 5

Coronary heartdisease

5

Height 5

Stroke 5

Hypertension 5

Case control study 4

Infectious diseaseepidemiology

20

Infection 8

Mortality rate 3

Transmission 3

HIV 3 4

Setting 2

Gene 4

Cell 4

Progression 3

Vaccine 3

Methodology 16

Approach 7

Epidemiology 5

Bias 5

Paper 5

Problem 4

Table continues

Table 1. Continued

Topica

2002–2007

EpidemiologyJournals 4,180Articles, 1,236

Terms, %

GeneralMedicine

Journalsb 6,283Articles, 978Terms, %

Reproductive andperinatal epidemiology

10

Pregnancy 7

Mother 6

Infant 4

Birth weight 4

Offspring 3

Environmentalepidemiology

7

Asthma 2

Air pollution 2

Nonsmoker 2

Susceptibility 2

Season 2

Health care quality 28

Practice 7

Health 7

Survey 6

Research 6

Problem 5

Clinical trials 23

Placebo 12

Controlled trial 12

Hazard ratio 10

Efficacy 10

Dose 8

Meta-analysis 13

Quality 10

Review 6

Medline 6

Systematic review 6

Meta analysis 6

Cost-benefit analysis 2

Cost 5

Dollar 2

Cost effectiveness 2

Life year 2

Life expectancy 1

2008–2013

EpidemiologyJournals 4,550Articles, 1,354

Terms, %

GeneralMedicine

Journalsb 6,159Articles, 1,040

Terms, %

Cardiovascular diseaseepidemiology

23 18

Body mass index 12 5

Table continues

Metaknowledge Analysis of Epidemiologic Topics 101

Am J Epidemiol. 2015;182(2):93–104

Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018

Page 10: Special Article Mapping Epidemiology's Past to Inform Its Future ...

were related to infectious diseases except the words “systolic”and “diastolic,”which were related to the epidemiology of car-diovascular diseases. The word “seropositive” showed themost intense burst. After 2000, there was no clear time patternof burst. Some terms belonged to a single topic. For instance,

thewords “ambient” and “particulate”were exclusively relatedto environmental epidemiology. Eight terms were related togenetics and meta-analysis. Two of the terms with the most in-tense bursts (“gestational” and “preterm”) were related to re-productive and perinatal epidemiology. A majority of burst

Table 1. Continued

Topica

2008–2013

EpidemiologyJournals 4,550Articles, 1,354

Terms, %

GeneralMedicine

Journalsb 6,159Articles, 1,040

Terms, %

Height 5

Childhood 3

Cause mortality 3

Blood pressure 3

Cardiovascular disease 5

Prospective cohort study 4

Smoking 4

Gene 3

Nutritionalepidemiology

20

Hazard ratio 10

Consumption 5

Diet 3

Health study 3

Smoker 3

Infectious diseaseepidemiology

19

Research 8

Epidemiology 6

Infection 6

Issue 4

Article 4

Methodology 15

Method 13

Approach 10

Bias 7

Problem 5

Design 5

Reproductive andperinatal epidemiology

11

Pregnancy 8

Mother 5

Childhood 4

Birth weight 3

Infant 3

Environmentalepidemiology

7

Air pollution 3

Particulate matter 2

Table continues

Table 1. Continued

Topica

2008–2013

EpidemiologyJournals 4,550Articles, 1,354

Terms, %

GeneralMedicine

Journalsb 6,159Articles, 1,040

Terms, %

Season 2

Temperature 1

Hospital admission 1

Meta-analysis 3 13

Meta analysis 5 9

Gene 4

Systematic review 3 8

Genotype 3

Polymorphism 2

Randomized controlledtrial

8

Medline 7

Database 7

Global health 38

Country 11

Prevalence 9

Trend 6

Survey 6

Cost 6

Clinical trials 20

Hazard ratio 15

Therapy 15

Week 13

Placebo 12

Clinical trial 11

Cardiovascular diseaseepidemiology

13

Hazard ratio 15

Stroke 7

Significant difference 6

Myocardial infarction 6

Cause mortality 5

Abbreviation: HIV, human immunodeficiency virus.a Data are clusters of terms interpreted as major topics (with the

percentage of terms within each cluster) and the top 5 terms withineach cluster (with the percentage of articles including each term).The major topics are ordered by their importance in the epidemiologicjournals and then in the general medicine journals.

b For the 6 high-impact medical journals, we retrieved articles mostlikely of relevance to the field of epidemiology by using a customsearch filter.

102 Trinquart and Galea

Am J Epidemiol. 2015;182(2):93–104

Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018

Page 11: Special Article Mapping Epidemiology's Past to Inform Its Future ...

wordswere related tomethodology (e.g., “pathway,” “Bayesian,”“causal,” “mediation,” and “simulation”). Finally, approxi-mately one-third of burst words did not belong to any par-ticular cluster, but most of them were related to methodology(e.g., “multilevel,” “P for trend,” “Cox,” “heterogeneity,”“modeling,” and “confounder”).

Ancillary analysis of high-impact general medicine

journals

Our search retrieved 32,760 articles most likely of rele-vance to the field of epidemiology that were published inthe 6 general medicine journals. Web Figure 3 shows themapping and clustering of terms over time. Table 1 shows asummary of the clusters of terms and allows comparison witharticles from epidemiologic journals.

Some topics were similar to those identified in epidemiol-ogy journals and showed similar evolution. Cardiovasculardiseases and infectious diseases were among the main topicsover the 5 time periods, except the last time period for infec-tious diseases. We identified a cancer cluster in the 1974–1989 period and a reproductive and perinatal health clusterover the 1974–1989 and 1990–1995 periods. A cluster re-lated to meta-analysis appeared during 2002–2007 and per-sisted in the subsequent period.

Other topics differed from those identified previously. Onecluster corresponding to clinical trial terms (in multiple clin-ical specialties) was identified over the 5 periods. Anothercluster related to health care quality was identified over theperiods from 1974 to 2007. Lastly, a cost-benefit analysiscluster was identified in 2002–2007, and a global health clus-ter was identified in 2008–2013.

DISCUSSION

We analyzed 20,895 articles published in 5 epidemiologyjournals over 4 decades using a production-oriented approachto investigate the epistemic core of epidemiology. We found aclear pattern of leading areas of epidemiologic inquiry duringthis period and patterns in the evolution of these areas. Wefound, first, that the epidemiology of infectious and cardiovas-cular diseases have consistently been the main topics of interestin these 5 journals. Second, cancer epidemiology has been amajor topic, with a peak in knowledge production in 1990–1995, where 2 clusters related to cancer and female cancerwere identified but stopped being a leading focus of papers inthe 5 epidemiologic journals after 2001. Third, nutritional epi-demiology gained importance over time. Fourth, 3 topics wereamong the leading areas of inquiry for time-delimited periods,namely environmental epidemiology since 1996, whereasmeth-odology and meta-analysis in genetics appeared in 2008–2013.

Becausewe focused our inquiry on these 5 leading epidemi-ology journals, we can interpret our findings as representingknowledge produced and regulated through peer review prin-cipally by epidemiologists and shaped by editorial processes inline with the leading epidemiologic organizations. The Amer-ican Journal of Epidemiology is published in association withthe Society for Epidemiologic Research, the InternationalJournal of Epidemiology is published on behalf of the Interna-tional Epidemiological Association, Epidemiology is the offi-

cial journal of The International Society for EnvironmentalEpidemiology, and the Annals of Epidemiology is the officialpublication of the American College of Epidemiology. By de-sign, this analysis, excludes papers published by epidemiolo-gists, or papers published by nonepidemiologists that wouldnonetheless be considered within the field’s remit, that werepublished in nonepidemiologic journals. There is little ques-tion that such papers thrive, particularly in clinical journals.So, for example, the decrease in focus on cancer in these 5journals over the past decade represents most likely a shift inwhere these papers are being published—away from epidemi-ology journals to cancer journals. We would argue, however,that there is consequence to publishing the relevant papersin the leading journals in the discipline. Epidemiologistsare, in many respects, the keepers of the methodological flamein population health sciences. If cancer epidemiology is evolv-ing in nonepidemiology journals, it represents a tremendouslost opportunity for the field to make the contribution it canand should make to one of the leading global causes of death.Therefore, although our observations are in some ways heart-ening, reinforcing that we are focusing on cardiovascular dis-ease commensurately with the contribution of cardiovasculardisease to burden of mortality, they also suggest that the disci-pline is playing a far smaller role in other areas that are alsoimportant. For example, although several new areas have gain-ed prominence in the field over the past decades, including so-cial epidemiology, these are clearly not represented among thekey areas in these 5 leading epidemiology journals over thetime period of interest (21–23).Moreover, areas such as injury,psychiatric, or neurological epidemiologyare clearly not amongthe main topics identified; this is dissonant with the importancethat these areas have for global burden of disease (24–26).Within a consequentialist epidemiology framework, it wouldcertainly stand the field in good stead if we engaged activelyaround inquiry concerning the major causes of morbidity andmortality worldwide, with an eye to how we may prevent dis-ease and improve health (27–29).

The increasing role that methodological papers play inpublication in epidemiology journals over the past decadepresents both opportunities and challenges. In some respects,this evolution represents an evolution in the field, whereinmethods for epidemiology are being developed principallyby epidemiologists. This reflects a maturity in the field, mov-ing well beyond its origins where methods in the disciplineemerged from other areas (8). However, it also suggests thatthe field takes upon itself greater responsibility, both to keepdeveloping methods that are adequate to the evolving popu-lation health challenges we face and to ensure flexibility tothe incorporation of methods that do arise in other areas thatmay be fruitful for epidemiology to adopt.

These observations also have implications for our educa-tional programs and how we train the next generation of ep-idemiologists. If the leading epidemiology journals focusinsufficiently on significant areas of population health, weas a discipline may fall short on our self-definition and ourpromise as a field. This stands both to change the composi-tion of those who are attracted to the discipline and poten-tially to influence the structural factors (such as promotionexpectations and criteria) that stand to reinforce our areasof focus and growth in the field going forward.

Metaknowledge Analysis of Epidemiologic Topics 103

Am J Epidemiol. 2015;182(2):93–104

Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018

Page 12: Special Article Mapping Epidemiology's Past to Inform Its Future ...

Our analysis has limitations. First, our results and interpre-tation depended on our selection of epidemiology journals. Adifferent list of journals could be considered. For instance, thePublic Health/Health Administration Section of the MedicalLibrary Association considered 10 journals as “essential for acollection that supports a program with subject specializationin this area” (30, p. 572). Moreover, many epidemiologic ar-ticles are published in nonepidemiologic journals. However,in our ancillary analysis of 6 high-impact general medicinejournals, we found patterns of epidemiologic papers thatwere consistent overall with the findings in epidemiologicjournals, which suggests that the trends observed here holdacross the discipline. Second, our results correspond to amacroscopic rather than microscopic mapping of the disci-pline in the sense that we may have missed subtle regularitiesin the objects of research. We were, in fact, interested by theidentification of main topics, suggesting that our approachsuited our purpose. We may have missed the exact dynamicsof appearance or disappearance of these main topics becauseour categorization of articles aimed for an approximatelyequal number of articles in each time period.In sum, we identified the major topics in 5 high-impact jour-

nals of epidemiology, and we analyzed the trends of thesemain topics. This allowed for an empiric perspective on thediscipline’s past, with an eye to its future. Our metaknowledgeinvestigation, which relied on freely accessible data sourcesand free software, is replicable. Monitoring the evolution ofthe science of epidemiology may help inform our efforts toconsider appropriate recalibration of the field’s scope.

ACKNOWLEDGMENTS

Author affiliations: Department of Epidemiology, MailmanSchool of Public Health, Columbia University, New York,New York (Ludovic Trinquart); and School of Public Health,Boston University, Boston, Massachusetts (Sandro Galea).Conflict of interest: none declared.

REFERENCES

1. Lilienfeld DE. The general epidemiologist: Is there a place intoday’s epidemiology? Am J Epidemiol. 2007;166(1):1–4.

2. Armenian HK. Epidemiology: a problem-solving journey. Am JEpidemiol. 2009;169(2):127–131.

3. Ness RB, Andrews EB, Gaudino JA Jr, et al. The future ofepidemiology. Acad Med. 2009;84(11):1631–1637.

4. Bhopal R,Macfarlane GJ, SmithWC, et al.What is the future ofepidemiology? Lancet. 2011;378(9790):464–465.

5. Pearce N. Epidemiology in a changing world: variation,causation and ubiquitous risk factors. Int J Epidemiol. 2011;40(2):503–512.

6. McKeown RE. Is epidemiology correcting its vision problem?A perspective on our perspective: 2012 presidential address forAmerican College of Epidemiology. Ann Epidemiol. 2013;23(10):603–607.

7. Khoury MJ, Lam TK, Ioannidis JP, et al. Transformingepidemiology for 21st century medicine and public health.Cancer Epidemiol Biomarkers Prev. 2013;22(4):508–516.

8. Morabia A. A History of Epidemiologic Methods and Concepts.Basel, Switzerland: Birkhäser Verlag; 2004.

9. Buck C, Llopis A, Najera E, et al. The Challenge ofEpidemiology. Issues and Selected Readings. Washington, DC:Pan American Health Organization; 1988.

10. Evans JA, Foster JG. Metaknowledge. Science. 2011;331(6018):721–725.

11. Griffiths TL, Steyvers M. Finding scientific topics. Proc NatlAcad Sci U S A. 2004;101(suppl 1):5228–5235.

12. ISI Web of Knowledge. 2012 Journal Citation Reports ScienceEdition. http://admin-apps.webofknowledge.com/JCR/JCR.Thomson Reuters; 2014.

13. van Eck N, Waltman L. Text Mining and Visualization UsingVOSviewer. Leiden, The Netherlands: Centre for Science andTechnology Studies, Leiden University; 2012.

14. Borg I, Groenen P. Modern Multidimensional Scaling. 2nd ed.New York, NY: Springer; 2005.

15. Van Eck NJ, Waltman L. Bibliometric mapping of thecomputational intelligence field. Int J Unc Fuzz Knowl BasedSyst. 2007;15(5):625–645.

16. Newman MEJ, Girvan M. Finding and evaluatingcommunity structure in networks. Phys Rev E. 2004;69(2):026113.

17. Waltman L, van Eck NJ, Noyons ECM. A unified approach tomapping and clustering of bibliometric networks. JInformetrics. 2010;4(4):629–635.

18. van Eck NJ, Waltman L. Software survey: VOSviewer, acomputer program for bibliometric mapping. Scientometrics.2010;84(2):523–538.

19. Kleinberg J. Bursty and hierarchical structure in streams. DataMin Knowl Discov. 2003;7(4):373–397.

20. Mane KK, Börner K. Mapping topics and topic bursts inPNAS. Proc Natl Acad Sci U S A. 2004;101(suppl 1):5287–5290.

21. Berkman L, Kawachi I. Social Epidemiology. New York, NY:Oxford University Press; 2000.

22. Cwikel J. Social Epidemiology: Strategies for PublicHealth Activism. New York, NY: Columbia University Press;2006.

23. O’Campo P, Dunn J. Rethinking Social Epidemiology: Towardsa Science of Change. New York, NY: Springer; 2011.

24. Vos T, Flaxman AD, Naghavi M, et al. Years lived withdisability (YLDs) for 1160 sequelae of 289 diseases andinjuries 1990–2010: a systematic analysis for the GlobalBurden of Disease Study 2010. Lancet. 2012;380(9859):2163–2196.

25. Murray CJ, Vos T, Lozano R, et al. Disability-adjusted lifeyears (DALYs) for 291 diseases and injuries in 21regions, 1990–2010: a systematic analysis for the GlobalBurden of Disease Study 2010. Lancet. 2012;380(9859):2197–2223.

26. Whiteford HA, Degenhardt L, Rehm J, et al. Global burden ofdisease attributable to mental and substance use disorders:findings from the Global Burden of Disease Study 2010.Lancet. 2013;382(9904):1575–1586.

27. Galea S. An argument for a consequentialist epidemiology. AmJ Epidemiol. 2013;178(8):1185–1191.

28. Cates W Jr. Invited commentary: consequential(ist)epidemiology: let’s seize the day. Am J Epidemiol. 2013;178(8):1192–1194.

29. Galea S. Galea Responds to “consequential(ist) epidemiology:finally”. Am J Epidemiol. 2013;178(8):1195–1196.

30. Ascher M. Journals, epidemiological. In: Boslaugh S, ed.Encyclopedia of Epidemiology. Thousand Oaks, CA: SAGEPublisher, Inc.; 2008:572–573.

104 Trinquart and Galea

Am J Epidemiol. 2015;182(2):93–104

Downloaded from https://academic.oup.com/aje/article-abstract/182/2/93/94673by gueston 11 April 2018