Smarten Up in English Age 6 7

EnglishSmarten up inT H E A C T I V I T I E S I N T H I S B O O K A D D R E S S M A N Y O U T C O M E S I N T H E S Y L L A B U S

WRITTEN BY RON SHAW

for students 6-7 years old

Smarten up in English (age 6-7) Intelligent Australia Productions

First published in 2008 by Intelligent Australia Productions

Ron Shaw 2008

ISBN 978-0-9805774-4-0

IAP 032

Intelligent Australia Productions PO Box 670 Hillarys, WA 6923 Australia

Tel: (08) 9307 8365 Fax: (08) 9402 2339 Email: [email protected]

Dedicated to the students of Beaconsfield Primary School

COPYING OF THIS BOOK BY EDUCATIONAL INSTITUTIONS

A purchasing educational institution may only photocopy pages within this book in accordance with the Australian Copyright Act 1968 (the Act) and provided the educational institution (or body that administers it) has given a remuneration notice to the Copyright Agency Limited (CAL) under the Act.

Acknowledgements

In this book Intelligent Australia Productions has used graphics that were obtained under licence from Jupiter Images. IAP is indebted to rightful copyright holders of other graphics and illustrations who kindly consented to their use here. Yet other images used in this work are freely available in the Public Domain. In the few cases where attempts to gain permission for use from original copyright holders were not successful: If you believe in good faith that materials used by us infringe your copyright, you (or your agent) may send us a written notice that includes the following information: ! A clear identification of the copyrighted work you claim was infringed. ! A clear identification of the material you claim is infringing the copyrighted work, and information that will allow us to locate that material,

such as a link to the text or graphic. ! Your contact information so that we can reply to you, preferably including an email address and telephone number. ! A statement that you have a "good faith belief that the material that is claimed as copyright infringement is not authorized by the copyright

owner, its agent, or the law." ! A statement that "the information in the notification is accurate, and under penalty of perjury, the complaining party is authorized to act on

behalf of the owner of an exclusive right that is allegedly infringed." The notice must be signed by the person authorized to act on behalf of the owner of an exclusive right that is allegedly infringed. Notices should be sent to our address at the top of this page. We will review and address all notices that comply with the requirements above. We suggest that you consult your legal advisor before filing a notice or counter-notice. Also, be aware that you may be liable for damages if you make a false claim of copyright infringement.

Smarten up in English (age 6-7)

Intelligent Australia Productions 2

Postal Address IAP PO Box 670 Hillarys, WA Australia 6923 Email

[email protected] Telephone

(08) 9307 8365 Intl (618) 9307 8365 Fax

(08) 9402 2339 Intl (618) 9402 2339

www.intelligentaustralia.com

Intelligent Australia Productions is committed to raising standards in Literacy and Numeracy in Australian schools.



TTeeaacchheerrss NNootteess 4 Grammar Nouns: Explanation and exercises 5 Grammar Verbs: Explanation and exercises 6 Grammar Adjectives: Explanation and exercises 7 Punctuation Capital letters, full stops and question marks 8 Punctuation Introducing apostrophes 9 Vocabulary Synonyms & Antonyms 10 Vocabulary Matching words 11 Words & Meanings Words, meanings and examples 12 Comparing Word Meanings Which word is different from the others? 13 Comparing Word Meanings Which word is different from the others? 14 Comparing Word Meanings Homophones 15 Definition & Example Provide the word, its meaning or an example 16 Time to Write Creating a story from a scene 17 Classification Household Objects 18 Matching Questions with Answers Testing thinking skills 19 Mixed Exercises Understanding parts of a whole 20 Choosing Words in Context Choosing appropriate words from a list 21 Choosing Words in Context Choosing appropriate words from a list 22 Sentence Completion Use your own words to complete the sentences 23 Enrich Your Writing Use an adjective to describe a noun 24 Further Enrichment of Your Writing Use two adjectives to describe a noun 25 Time to Write Creating a story from a scene 26 Sequence in a Story Order of sentences 27 Story Logic Insert the missing words 28 Parts of a Story Locating characters and events within a story 29 Parts of a Story Characters, setting and plot 30 Parts of a Story Thinking about what youve read 31 Analysing a Story What is the story about? 32 Analysing a Story Comprehension: Did you understand the story? 33 Analysing a Story Comprehension: Did you understand the story? 34 Complete the Story Insert the missing words 35 Time to Write Creating a story from a scene 36 Identifying the Main Idea What is this paragraph about? 37 Identifying the Main Idea What is this paragraph about? 38 Practice in Thinking Skills Mixed examples 39 Practice in Thinking Skills Mixed examples 40 Practice in Thinking Skills Creative thinking and writing 41 Read!!!!Think!!!!Write Selecting appropriate words from a list 42 Read!!!!Think!!!!Write Selecting appropriate words from a list 43 Poetry Time Like prose, poems have characters and a setting 44

Solutions 45

CCCCCCCCoooooooonnnnnnnntttttttteeeeeeeennnnnnnnttttttttssssssss



Smarten up in English contains 40 activities in English suitable for children age six and seven.

As well as providing students with practice in Reading, Spelling and Writing, there are exercises focussing on grammar, punctuation, vocabulary development, story analysis, and more. Some of the exercises require students to be original and creative, thereby bringing their higher thinking skills into play.

Smarten up in English is intended as a supplement to the core English syllabus. While it addresses many key indicators and learning outcomes it should be used in conjunction with more prescriptive materials and/or texts.

Each page represents a stand-alone lesson and, while some activities may prove more challenging than others, most six and seven year olds should be able to complete the work without difficulty. There may be times though as in the case of new and difficult words- when a little help from teachers or parents is required.

For some of the activities it would be useful to have a dictionary and/or thesaurus on hand.

Some questions, such as those seeking the students thoughts or opinion, dont have a single correct answer. For these, students should be encouraged to bring their best, most original thinking to the fore and come up with a response that is perhaps unique or different. In the process of doing this they will certainly smarten up in English.

TTTTTTTTeeeeeeeeaaaaaaaacccccccchhhhhhhheeeeeeeerrrrrrrrssssssss NNNNNNNNooooooootttttttteeeeeeeessssssss

Im gonna rid the world of mices.

Better smarten up in English while youre at it.



A) Write down the nouns in each of these sentences.

Todays Date

................................................................................

My Name

..........................................................................

GGGGGGGGrrrrrrrraaaaaaaammmmmmmmmmmmmmmmaaaaaaaarrrrrrrr:::::::: NNNNNNNNoooooooouuuuuuuunnnnnnnnssssssss Nouns can be things, people or places. The word table is a noun. So is fish. The word Anna is a noun. So is Mrs Smith. The word Australia is a noun. So is England. .

Challenge: Write 4 nouns of each kind on the lines. Write smaller. things . people . places .

1. Today I saw a very tall man.

2. Today my grandma came over.

3. Mr Jones arrived late.

4. Spotty was outside sleeping.

5. I like seeing Jenny happy.

6. The bird flew away quickly.

.

7. Lets all get off this bus.

.

8. Yellow is a very nice colour.

B) If you look around you now it will be easy to find 10 nouns in your classroom. Write them here.

1. ... 6. ...

2. ... 7. ...

3. ... 8. ...

4. ... 9. ...

5. ... 10. ...



1) On the line write the verb in each of these sentences.

a. Uncle Mike let us have a ride on his tractor.

...

b. I hurried to the shop before breakfast.

...

c. My teacher is very kind and smiles a lot.

...

2) Write sentences that contain these verbs:

a. looking .....

b. drawing .......

Todays Date

................................................................................

My Name

..........................................................................

GGGGGGGGrrrrrrrraaaaaaaammmmmmmmmmmmmmmmaaaaaaaarrrrrrrr:::::::: VVVVVVVVeeeeeeeerrrrrrrrbbbbbbbbssssssss Verbs are doing words, sometimes called action words.

Running is a verb and so is run and ran. Swimming is a verb and so is swim, swam and swum. Carrying is a verb and so is carry and carried. Thinking is a verb and so is think and thought. Zooming is a verb and so is zoom and zoomed.

There are thousands more verbs in the English language.

Challenge Write one sentence containing these two verbs:

walk play ..

...

...



1) Write down the adjective in each sentence.

a. I saw a pretty butterfly on a flower.

.

b. Jacks mother has a shiny new car.

c. The clouds looked very stormy.

2) Write two adjectives that could describe a .

a. lady

b. house

c. street

3) Write sentences about each noun. Use an adjective to describe it.

a. dog . ..

b. man .. ...

c. book ... .....

Todays Date

................................................................................

My Name

..........................................................................

GGGGGGGGrrrrrrrraaaaaaaammmmmmmmmmmmmmmmaaaaaaaarrrrrrrr:::::::: AAAAAAAAddddddddjjjjjjjjeeeeeeeeccccccccttttttttiiiiiiiivvvvvvvveeeeeeeessssssss

Adjectives are words that describe nouns. Here are some examples:

Noun Adjectives sky cloudy, clear, stormy fish large, tiny, scaly man young, short, happy

We use adjectives to make our writing more interesting.



These sentences need capital letters. They also need full stops or question marks. Can you write them out correctly?

1) jane and alex went swimming .......................................................................................................................................

...........................................................................................................................................................................................................................................................................................

2) mum said i could play outside ........................................................................................................................................

...........................................................................................................................................................................................................................................................................................

3) does sophie live in sydney ........................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

4) my dogs name is jess ..........................................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

5) dad knows mr smith .................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

6) is mrs jones coming for tea ...................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

7) why are you walking slowly ..................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

8) i once got bitten by a dog .........................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

9) do you like cricket ...........................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

10) what is the time ..............................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

Todays Date

................................................................................................

.....

My Name

................................................................................................

.........

PPPPPPPPuuuuuuuunnnnnnnnccccccccttttttttuuuuuuuuaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn CCaappiittaallss,, ffuullll--ssttooppss,, qquueessttiioonn mmaarrkkss

- - - do not write between the narrow lines - - -



1) Im having my lunch. ..............................................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

2) One kittens asleep. .................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

3) This isnt my pencil. .................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

4) Whats your name? .................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

5) I havent seen snow yet. .................................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

6) Annas pencil broke. .................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

7) This is Tims room. .................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

8) I used Mums brush. .................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

9) Mr Browns car is new. ............................................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

10) Fluffys fur is grey and white. ........................................................................................................................................

...........................................................................................................................................................................................................................................................................................

Todays Date

................................................................................................

.....

My Name

................................................................................................

.........

PPPPPPPPuuuuuuuunnnnnnnnccccccccttttttttuuuuuuuuaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn AAppoossttrroopphheess

Apostrophes look like this: We use them to show missing letters. (questions 1-5) We also use them to show ownership. (questions 6-10) Can you rewrite the sentences below, putting apostrophes where they belong?

- - - - - - - - do not write between the narrow lines - - - - - - - - -



The word pretty has nearly the same meaning as lovely. The opposite of pretty is ugly.

See if you can fill in the spaces by choosing words from the boxes.

same opposite

1) big ........... 2) .........

3) noisy ........... 4) .........

5) fast ........... 6) .........

same opposite

07) rainy ........... 18) .........

19) wet ........... 10) .........

11) happy ......... 12) .........

same opposite

13) down ........... 14) .........

15) closer ........... 16) .........

17) dirty ......... 18) .........

Todays Date

................................................................................................

.....

My Name

................................................................................................

.........

VVVVVVVVooooooooccccccccaaaaaaaabbbbbbbbuuuuuuuullllllllaaaaaaaarrrrrrrryyyyyyyy SSyynnoonnyymmss && AAnnttoonnyymmss

slow small loud speedy large quiet

sad sunny dry damp cheerful stormy

below further clean up nearer messy



shoes

paper

cats

green

oranges

lemons

pencil

socks

bees

leaves

cars

lady

blue

dogs

man

trucks

trees honey

Write an interesting sentence containing all of these words: lady oranges bees

...........................................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

Now do the same with these words: man shoes paper

...........................................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................................

Todays Date

................................................................................................

.....

My Name

................................................................................................

......... VVVVVVVVooooooooccccccccaaaaaaaabbbbbbbbuuuuuuuullllllllaaaaaaaarrrrrrrryyyyyyyy

MMaattcchhiinngg WWoorrddss

Rule lines to match the Rule lines to match the Rule lines to match the Rule lines to match the words on the leftwords on the leftwords on the leftwords on the left with with with with the ones on the right.the ones on the right.the ones on the right.the ones on the right.



1. Fill in the missing words. The first one has been done for you.

Meaning Word Large boat which takes people across the ocean. ship Built for families to live in (has bedrooms).

.................................... A solid chunk of water that is frozen.

.......................................

You put a letter inside this and then post it. .......................................

A small animal that cats like to chase.

.......................................

2. Eagles, sparrows and crows are examples of birds. Fill in the missing words below.

March, June and December are examples of .....................................................

Tuesday, Monday and Friday are examples of .......................................

Red, blue and green are examples of .........................................................................

Bee, wasp and beetle are examples of ...........................................................................

Elephant, lion and bear are examples of .....................................................................

Meat, cheese and eggs are examples of ..........................................................................

Todays Date

....................................................................................

My Name

..................................................................................

WWWWWWWWoooooooorrrrrrrrddddddddssssssss &&&&&&&& MMMMMMMMeeeeeeeeaaaaaaaannnnnnnniiiiiiiinnnnnnnnggggggggssssssss



A) Put a ring around the word that has a different meaning from the others. Then try to give the meaning of that different word.

1) small tiny large ......................................................................................................................................

2) pretty lovely ugly ......................................................................................................................................

3) dark white black ......................................................................................................................................

4) crow fish magpie ...............................................................................................................................

5) road building house ............................................................................................................................

6) write build draw ......................................................................................................................................

7) coin stone money ...................................................................................................................................... B) Put a ring around the word that has a different

meaning from the other two; then write a sentence to say what that word means.

hill forest mountain

..........................................................................................................................................................................................................................................................................................

..........................................................................................................................................................................................................................................................................................

..........................................................................................................................................................................................................................................................................................

.........................................................................................................................................................................................................................................................................................

Todays Date

................................................................................................

.....

My Name

................................................................................................

.........

CCCCCCCCoooooooommmmmmmmppppppppaaaaaaaarrrrrrrriiiiiiiinnnnnnnngggggggg WWWWWWWWoooooooorrrrrrrrdddddddd MMMMMMMMeeeeeeeeaaaaaaaannnnnnnniiiiiiiinnnnnnnnggggggggssssssss

WWhhiicchh wwoorrdd hhaass aa ddiiffffeerreenntt mmeeaanniinngg ffrroomm tthhee ootthheerrss??

In this exercise you have to give the meaning of the word that is different from the other two.

(you may have to write smaller than you usually do)



Three words are alike and the other one is different.

A) Write the word that has a different meaning from the others. 1) big large little enormous .................................................................................................

2) pretty awful lovely nice ............................................................................................

3) ship boat plane yacht ....................................................................................................... 4) fast swift slow speedy ....................................................................................................

5) nasty terrific horrible terrible ...............................................................................................

6) dry moist damp wet ............................................................................................................. 7) shiny dull bright glowing ............................................................................................

8) quiet noisy whispering soft ...................................................................................................... B) Put a ring around the word that has a different

meaning from the other three; then write a sentence to say what that word means.

road tree track path

..........................................................................................................................................................................................................................................................................................

..........................................................................................................................................................................................................................................................................................

..........................................................................................................................................................................................................................................................................................

.........................................................................................................................................................................................................................................................................................

Todays Date

................................................................................................

.....

My Name

................................................................................................

.........


WWhhiicchh wwoorrdd hhaass aa ddiiffffeerreenntt mmeeaanniinngg ffrroomm tthhee ootthheerrss??



In each word-pair in the box below the words have the same sound but different meanings. Choose the right word from the box to complete each sentence.

be bee flower flour hour our hole whole two to wood would road rode sun son

1) I have ..... brothers and one sister.

2) I have to be home in one .................. . 3) The car was going along the .................... .

4) My blocks are made of .................... .

5) Roses are my favourite kind of ............................................. .

6) The ...... made some honey.

7) Mrs Brown has a ...... named Adam.

8) Tomorrow I am going ......... visit my uncle.

9) Jenny was hungry so she ate the ......................... cake.

10) When I grow up Id like to .... a dancer.

11) I watched the ...... rise this morning.

12) Mum used some .......................... to make the cakes.

13) Dad said he ............................. be home by 6 oclock.

14) Suzie ........ her pony every day in the holidays.

15) In ...... street there are some nice gardens.

16) I helped Dad dig a ............. near the fence.

Todays Date

................................................................................................

.....

My Name

................................................................................................

.........


SSaammee ssoouunndd,, ddiiffffeerreenntt mmeeaanniinngg.. ((HHoommoopphhoonneess))



1. Give an example of each word below.

Word Meaning Example

drink something you have when you are thirsty ....................................

food what you eat at meal times

.................................... dessert a tasty treat after the main meal

....................................

fruit a food with a seed or stone in the middle ....................................

2. Write the missing words in the first column.

Word Meaning Example

............................................................ a kind of plant that you eat carrot

............................................................ it has pages and a cover The Lion King

............................................................ you have fun playing with these spinning top

............................................................ they fly and have a beak eagle

3. Give one more example:

fruit apple, orange, pear, ....................

drink water, milk, juice, ....................

vegetable potato, carrot, lettuce, ....................

clothes shirt, socks, skirt, ....................

transport bus, car, ship, ....................

sport tennis, football, swimming,....................

number four, two, ten, ....................

Todays Date

................................................................................................

.....

My Name

................................................................................................

.........

DDDDDDDDeeeeeeeeffffffffiiiiiiiinnnnnnnniiiiiiiittttttttiiiiiiiioooooooonnnnnnnn &&&&&&&& EEEEEEEExxxxxxxxaaaaaaaammmmmmmmpppppppplllllllleeeeeeee



Write a story about the picture. Try to use some good describing words.

.............................................................................................................................

..................................................................................................................................

................................................................................................................................

...............................................................................................................................

...........................................................................................................................

............................................................................................................................

.......................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

Todays Date

................................................................................................

.....

My Name

................................................................................................

.........

TTTTTTTTiiiiiiiimmmmmmmmeeeeeeee ttttttttoooooooo WWWWWWWWrrrrrrrriiiiiiiitttttttteeeeeeee CCrreeaattiinngg aa ssttoorryy ffrroomm aa sscceennee..

Some words to help you...

animal doctor (or vet)

moustache

thermometer

measure

temperature

examine



Where can you find the things written in the stars? Write each word under the correct heading.

bedroom

..................

..................

..................

..................

..................

kitchen

..................

..................

..................

..................

..................

bathroom

..................

..................

..................

..................

..................

Todays Date

................................................................................................

.....

My Name

................................................................................................

.........

CCCCCCCCllllllllaaaaaaaassssssssssssssssiiiiiiiiffffffffiiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn HHoouusseehhoolldd OObbjjeeccttss

milk

comics

soap

bread

bath

butter

shower

towel

toys

spoon

bed

wardrobe



Draw lines to match the questions with their correct answers.Draw lines to match the questions with their correct answers.Draw lines to match the questions with their correct answers.Draw lines to match the questions with their correct answers.

How are bees, grasshoppers and ants alike?

They all help us to eat.

How are buses, trains and ships alike?

They are all fruits.

How are knives, forks and spoons alike?

They all fly.

How are birds, insects and planes alike?

They all carry people.

How are water, milk and soft drink alike?

They are all insects.

How are apples, oranges and plums alike?

They are all drinks.

........................................................................................................................................................................

Todays Date

................................................................................................

.....

My Name

................................................................................................

.........

MMMMMMMMaaaaaaaattttttttcccccccchhhhhhhhiiiiiiiinnnnnnnngggggggg QQQQQQQQuuuuuuuueeeeeeeessssssssttttttttiiiiiiiioooooooonnnnnnnnssssssss wwwwwwwwiiiiiiiitttttttthhhhhhhh AAAAAAAAnnnnnnnnsssssssswwwwwwwweeeeeeeerrrrrrrrssssssss

Have you finished matching? " List all the things you see in the picture.

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................

......................................................................................................................



A) Thinking about pA) Thinking about pA) Thinking about pA) Thinking about parts of a whole.arts of a whole.arts of a whole.arts of a whole.

................

A house needs a roof ..................... .....

A house needs windows ............................ .....

A house needs a door ........................... ...

B) In the story below there is a missing sentence. One of the sentences in the box is the missing one. Write it on the line.

One day a bear met a rabbit. At first the rabbit was frightened of the bear. ...................................................................................................................................................................................

After that the bear and the rabbit became good friends.

Todays Date

................................................................................................

.....

My Name

................................................................................................

.........

MMMMMMMMiiiiiiiixxxxxxxxeeeeeeeedddddddd EEEEEEEExxxxxxxxeeeeeeeerrrrrrrrcccccccciiiiiiiisssssssseeeeeeeessssssss

* I dont like you, said the bear. * The bear said, Go away, rabbit! * You are big and ugly, said the rabbit. * I wont hurt you, said the bear.

Finish the sentences to say why a house needs these things:



Choose words from the boxes below and write them on the lines.

1) Jack wanted to go to the.................... with his friend

.................. . He asked his......................... if he could

go and she said, .............

So the two.......... got ready and off they....................to

have some................in the sun.

2) Anna and her.........Jenny are both six ..... old. Anna has brown........and Jennys hair is black.

They both have........eyes. Anna and Jenny live

in the.........street and go to the same ...........

3) Tomorrow is my................................... I will be turning

........................................ years old. My Mum and Dad are taking me

to see a........................................................... . After that there will be a .......................................................

at my house and Ive........................................................................................ six friends. Mum is

going to make some ............................................................................................... birthday toffees.

Todays Date

................................................................................................

.....

My Name

................................................................................................

.........

CCCCCCCChhhhhhhhoooooooooooooooossssssssiiiiiiiinnnnnnnngggggggg WWWWWWWWoooooooorrrrrrrrddddddddssssssss iiiiiiiinnnnnnnn CCCCCCCCoooooooonnnnnnnntttttttteeeeeeeexxxxxxxxtttttttt

fun Yes boys Tom beach went mother

brown same years school friend hair

chocolate invited seven birthday movie party



Choose words from the boxes below and write them on the lines.

1) Mrs Smith was walking her........ when it started to

rain. Mrs Smith put up her........ to keep her and

the dog from getting wet. The dog, whose name was ......,

liked jumping in the......... . When they got

........ Mrs Smith was dry but Spot was very ................................................... .

2) In our class there is a girl named ...................................................... and she is very

good at maths. Lyn finished her maths sheet in only three

........................................................................................... Lyn knows she is very good at......................................................

but she says she is not too good at............................................................................................. . Lyn

likes writing............................................................................. so shes going to try very .......................................

to improve her spelling.

3) My Dad got a new........................yesterday. Its a small

........................... one. Our old car was a................................................................................. one and

it was blue. Today our family is going to take our new car

for a....................................................................... . Mum will sit next to Dad in the..............................................

and Ill be in the back with my little .............................................................................................. .

Todays Date

................................................................................................

.....

My Name

................................................................................................

.........

minutes hard spelling Lyn stories maths

red front car bigger brother drive

Spot dog umbrella wet home puddles

CCCCCCCChhhhhhhhoooooooooooooooossssssssiiiiiiiinnnnnnnngggggggg WWWWWWWWoooooooorrrrrrrrddddddddssssssss iiiiiiiinnnnnnnn CCCCCCCCoooooooonnnnnnnntttttttteeeeeeeexxxxxxxxtttttttt



Here is the beginning of a sentence: In our garden We could complete the sentence like this... In our garden there are lots of colourful flowers. Heres another example: Tonight I will We could write... Tonight I will finish reading my library book.

See if you can make interesting sentences from these...

1) I looked up and saw............................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

2) After lunch we......................................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

3) Tomorrow my uncle..............................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

4) I like to....................................................................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

5) For my birthday I .....................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

6) At school yesterday .............................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

7) When I grow up I .............................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

Todays Date

................................................................................................

.....

My Name

................................................................................................

.........

SSSSSSSSeeeeeeeennnnnnnntttttttteeeeeeeennnnnnnncccccccceeeeeeee CCCCCCCCoooooooommmmmmmmpppppppplllllllleeeeeeeettttttttiiiiiiiioooooooonnnnnnnn Use your own words to complete the sentences.



Look at this sentence: I saw a man with a dog. Lets see how we can make this more interesting... I saw an old man with a dog. (this is better) I saw an old man with a spotted dog. (this is better still)

See if you can make these sentences more interesting by placing a describing word in front of each noun.

1) A dog ran past my house. ....................................................................................................................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

.................................................................................................................................................................................................................................................................................... 2) A girl was reading a book. ....................................................................................................................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

.................................................................................................................................................................................................................................................................................... 3) A boy was eating an ice cream. ....................................................................................................................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

4) I saw a bus near a shop. ....................................................................................................................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

5) I know a girl who owns a horse. ....................................................................................................................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

Todays Date

................................................................................................

.....

My Name

................................................................................................

.........

EEEEEEEEnnnnnnnnrrrrrrrriiiiiiiicccccccchhhhhhhh YYYYYYYYoooooooouuuuuuuurrrrrrrr WWWWWWWWrrrrrrrriiiiiiiittttttttiiiiiiiinnnnnnnngggggggg Your writing will be more interesting if you describe your nouns thoughtfully.



Look at this sentence: A rabbit saw a fox. Lets see how we can make this more interesting... A small rabbit saw a red fox. (this is better) A small white rabbit saw a big red fox. (this is better still)

See if you can make these sentences more interesting by placing two describing words in front of each noun.

1) A lady walked towards her car. ....................................................................................................................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

.................................................................................................................................................................................................................................................................................... 2) Two kittens were sleeping in a basket. ....................................................................................................................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

.................................................................................................................................................................................................................................................................................... 3) A plane flew over the mountain. ....................................................................................................................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

4) The cat stretched out on the carpet. ....................................................................................................................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

5) The house was damaged by a storm. ....................................................................................................................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

....................................................................................................................................................................................................................................................................................

Todays Date

................................................................................................

.....

My Name

................................................................................................

.........

FFFFFFFFuuuuuuuurrrrrrrrtttttttthhhhhhhheeeeeeeerrrrrrrr EEEEEEEEnnnnnnnnrrrrrrrriiiiiiiicccccccchhhhhhhhmmmmmmmmeeeeeeeennnnnnnntttttttt ooooooooffffffff YYYYYYYYoooooooouuuuuuuurrrrrrrr WWWWWWWWrrrrrrrriiiiiiiittttttttiiiiiiiinnnnnnnngggggggg

Your writing will be more interesting if you describe your nouns thoughtfully.



Write a story about the picture. Try to use some good describing words.

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................................................................

Todays Date

................................................................................................

.....

My Name

................................................................................................

.........

TTTTTTTTiiiiiiiimmmmmmmmeeeeeeee ttttttttoooooooo WWWWWWWWrrrrrrrriiiiiiiitttttttteeeeeeee CCrreeaattiinngg aa ssttoorryy ffrroomm aa sscceennee..

Some words to help you...

striped

saucer

pattern



1. Write 1,2 and 3 to tell each story in order. A

Patty was the winner. Patty was running in a race. She started to go very fast.

B

It was a very hot day. He jumped into the water. Joe went to the pool.

C

Sally called her pup Blacky. Sally got a new pet. It was a little black dog.

D

Dad drove home from work. Then he went into the house. He got out of his car.

E

Tom is the tallest. My friend has two brothers. .............. Their names are Tom and Sam.

F

.... Then the buzzing noise stopped. .... It flew onto a flower. .... The bee went buzzing past me.

2. Write the sentences about Sarah in order.

She has breakfast with her family. She gets ready for school. She arrives at school. She walks to school. Sarah gets out of bed. .

...

.

...

.

...

.

Todays Date

.................................................................................

My Name

..................................................................................

SSSSSSSSeeeeeeeeqqqqqqqquuuuuuuueeeeeeeennnnnnnncccccccceeeeeeee iiiiiiiinnnnnnnn aaaaaaaa SSSSSSSSttttttttoooooooorrrrrrrryyyyyyyy

I



One very hot day an elephant was ................. water from a wide river. He would put his trunk down into the river, fill it with water and squirt it into his ..... The only problem was, the river was very muddy and the water didnt taste very ........................ Just then a small bird flew up and said to the elephant, Follow me. Ill ......... you where theres a stream of nice clear water. The elephant thought this sounded like a good ........... so he followed the bird along a grassy path. Soon they came to a big waterfall which had a little stream at the ... The elephant walked toward the stream, put his trunk in the water and had a big............................................. Hm, said the elephant to the bird, youre right; this is the best water Ive ever tasted.

..

..

..

Todays Date

........................................................................................

My Name

.............................................................................................

SSSSSSSSttttttttoooooooorrrrrrrryyyyyyyy LLLLLLLLooooooooggggggggiiiiiiiicccccccc

Give the story meaning by writing in your own words.Give the story meaning by writing in your own words.Give the story meaning by writing in your own words.Give the story meaning by writing in your own words.

Creative Thinking Challenge: What kind of favour could an elephant do for a bird?



1. Read the st1. Read the st1. Read the st1. Read the story and then listen to what your teacher ory and then listen to what your teacher ory and then listen to what your teacher ory and then listen to what your teacher asks you to do.asks you to do.asks you to do.asks you to do.

Toby was a six year old boy who lived with his parents and sister. His sisters name was Sally and she was 10 years old.

One day Toby was playing with his toys in his room when he heard Sally say, Hey Toby, lets go to the park. This made Toby happy because he loved to ride on the swings and the see-saw.

While Toby and Sally were walking to the park Sally found a boys watch on the ground. When they arrived at the park they saw someone they knew. It was their cousin James. James was crying.

Whats wrong James? asked Toby. I cant find my watch, replied James. Sally then put her hand on James shoulder and said in a kind voice, Look James, heres your watch.

Now James was happy and the three children had a lovely time playing at the park.

2. Sally was kind to James. Tell about a time when someone was kind to you.2. Sally was kind to James. Tell about a time when someone was kind to you.2. Sally was kind to James. Tell about a time when someone was kind to you.2. Sally was kind to James. Tell about a time when someone was kind to you. .......................................................................................................................................................................................................................................

...........................................................................................................................................................................................................................

...........................................................................................................................................................................................................................

...........................................................................................................................................................................................................................

...........................................................................................................................................................................................................................

Todays Date

........................................................................................

My Name

.............................................................................................

PPPPPPPPaaaaaaaarrrrrrrrttttttttssssssss ooooooooffffffff aaaaaaaa SSSSSSSSttttttttoooooooorrrrrrrryyyyyyyy

Teachers Note Let pupils read the story at their own pace. When all have finished, tell them to 1) put an X above the name of each person in the story; 2) draw a line under the sentence that tells where Toby was before he went to the park; 3) circle the sentence that tells why James was crying; and 4) put a tick by the sentence that tells what Sally said to James.



Lisa lived in a little old cottage next to a mountain which sometimes had snow on its peak. One day Lisa and her friends Mary and Jesse were playing outside Lisas house. Mary said, Im going to climb up the mountain. Not me, said Jesse, I would be afraid. Mary, dont do it, said Lisa, its too dangerous. Mary did not listen to Lisa. She walked off to begin the big climb. Lisa ran to the shearing shed to tell her father Dan what happened. Dan searched the mountain tracks and finally found Mary who was lost and feeling very cold. Dan brought Mary back to the cottage and gave her a nice warm drink.

1) What are the names of the people in this story?

.

2) Who said, its too dangerous?

3) Did this story happen at a beach, in the country or in a city?

.

4) What happened to Mary on the mountain?

5) What did Lisa do to help her friend Mary?

Todays Date

........................................................................................

My Name

.............................................................................................


Read the story and then answer the quRead the story and then answer the quRead the story and then answer the quRead the story and then answer the questions that follow.estions that follow.estions that follow.estions that follow.



Robbie loved to visit his friend Samuel. One day Robbie was walking to Samuels house when a very small brown dog ran up to him. The dog looked sad. Robbie thought that the dog must be lost so he carried it to Samuels house. What a cute little dog, said Samuel. Yes, it is, said Robbie. Samuels mother saw the dog and gave it some water and something to eat. Soon there was a knock on the door. It was a very old lady. The very old lady said, Have you seen a little brown dog? When Samuels mother showed her the dog the very old lady said, Oh, thankyou, Ive been looking everywhere for her.

1) Who are the characters in this story? .

..

2) To where was Robbie walking? ..

3) What did Samuels mother do for the little dog? ..

4) What are three things the very old lady might do when she arrives home with her dog? Say these things in order.

..

..

Todays Date

................................................................................

My Name

...................................................................................


Read the story and then answer the questions that follow.Read the story and then answer the questions that follow.Read the story and then answer the questions that follow.Read the story and then answer the questions that follow.



Read this short story.Read this short story.Read this short story.Read this short story. Luke has a pet lamb. The lamb is 12 weeks old. Each day Luke gives the lamb some milk to drink from a bottle. Some of the milk falls on the grass. The lamb licks the milky grass dry.

A) Write a sentence telling what the story is about.

...

......

B) What would be a good name for this story? ....................................................................................................................................................................................................................... C) Write the missing words.

1. The lamb is Lukes . .

2. The lamb is only 12 old.

3. Luke gives the lamb milk from a ....

4. Some milk on the grass.

5. The lamb dries the grass by it.

D) Would having a pet lamb be fun? Say why or why not.

Todays Date

..........................

Smarten Up in English Age 6 7

Documents

Transcript of Smarten Up in English Age 6 7