Selective Inhibition of HDAC6 induces DNA damage and apoptosis and Sensitizes Colon ... ·...
57
Selective Inhibition of HDAC6 induces DNA damage and apoptosis and Sensitizes Colon Cancer Cells to Anticancer Agents Dong-Hee Shin The Graduate School Yonsei University College of Pharmacy
Transcript of Selective Inhibition of HDAC6 induces DNA damage and apoptosis and Sensitizes Colon ... ·...
Selective Inhibition of HDAC6 induces DNA damage
and apoptosis and Sensitizes Colon Cancer Cells to
Anticancer Agents
Dong-Hee Shin
The Graduate School
Yonsei University
College of Pharmacy
Selective Inhibition of HDAC6 induces DNA damage
and apoptosis and Sensitizes Colon Cancer Cells to
Anticancer Agents
A Master’s Thesis
Submitted to the Department of Parmacy
And the Graduate School of Yonsei University
In partial fulfillment of the requirements for the degree of
Master of pharmacy
Dong-Hee Shin
January 2014
This certifies that the master’s thesis of
Dong-Hee Shin is approved.
Thesis Supervisor: 권소희
Thesis Committee Member: 남궁완
Thesis Committee Member: 이진우
The Graduate School
Yonsei University
January 2014
i
Contents
Contents ................................................................................................................................................ i
List of Abbreviation ...................................................................................................................... iii
List of Figure .................................................................................................................................... iv
Abstract ................................................................................................................................................ v
Introduction ........................................................................................................................................1
Materials and Methods .................................................................................................................5
1. Chemicals and antibodies ...........................................................................................5
2. Cell culture .........................................................................................................................5
3. Cell growth and viability .............................................................................................5
4. MTT assay .........................................................................................................................6
5. Soft agar assay ................................................................................................................6
6. Acid extraction of histones .......................................................................................7
7. Annexin V/PI assay and Flow cytometry ...........................................................7
8. Western Blot .....................................................................................................................7
9. Small interfering RNA (siRNA) transfection .....................................................8
10. Analysis of gene expression by qRT-PCR .......................................................8
11. Statistical analysis .........................................................................................................9
12. Real Time PCR Primer sequences ...................................................................... 10
Result .................................................................................................................................................. 11
1. A452 is an effective HDAC6 inhibitor .............................................................. 11
ii
2. A452 Inhibits cell growth and viability of transformed but not normal
cells ............................................................................................................................................... 11
3. A452 induces caspase-dependent apoptosis................................................ 12
4. A452 induces the accumulation of γH2AX and phos-Chk2 .................. 13
5. A452 modulates p53 by upregulating wild type p53 and
downregulating mutant p53 in CRC cells .................................................................... 14
6. A452 sensitizes human colon cancer cells to cell death induced by
SAHA, cisplatin, irinotecan, or capecitabine ............................................................. 15
7. Down-regulation of HDAC6 expression increases sensitivity to cell
death induced by SAHA, irinotecan or capacitabine ............................................. 16
8. Culture with A452 plus SAHA, cisplatin, irinotecan or capecitabine
enhances caspase-dependent apoptosis in CRC cells ......................................... 17
9. A452 enhances the accumulation of γH2AX and phos-Chk2 induced
by SAHA, irinotecan or capecitabine ............................................................................ 17
Discussion ........................................................................................................................................ 37
Reference ......................................................................................................................................... 41
Abstract in Korean ...................................................................................................................... 46
iii
List of Abbreviation
cDNA complementary DNA
CRC Colorectal Cancer
DSB Double Strand Break
ECL Enhanced Chemiluminescence
HDAC6 Histone Deacetylase 6
HDACI Histone Deacetylase Inhibitor
HRP Horseradish peroxidase
IB Immunoblotting
mRNA messenger RNA
PCR Polymerase Chain Reaction
PI Propidium Iodide
SDS-PAGE sodiumdodecylsulfate-polyacrylamide gel electrophoresis
siRNA small interfering RNA
SEM standard error of the mean
5-FU 5-fluorouracil
iv
List of Figure
Figure 1. A452 is a specific-HDAC6 inhibitor
Figure 2. Effects of A452 on cell growth and viability and acetylated
patterns of proteins in HCT116 and HT29 cells
Figure 3. Effects of A452 on cell viability and acetylated patterns of
tubulin in normal and other transformed cells
Figure 4. A452 induces apoptosis and accumulation of γH2AX in colon
cancer cells
Figure 5. A452 regulate p53 in colon cancer cells
Figure 6. A452 enhances cell death induced by SAHA, irinotecan, or
capecitabine in transformed HCT116 cells
Figure 7. A452 enhances cell death induced by SAHA, irinotecan, or
capecitabine in transformed HT29 cells
Figure 8. Down-regulation of HDAC6 expression in HT29 cells results in
increased sensitivity to cell death induced by SAHA, irinotecan, or
capecitabine
Figure 9. A452 enhances SAHA-, irinotecan-, or capecitabine-induced cell
death
v
Selective Inhibition of HDAC6 induces DNA damage
and apoptosis and Sensitizes Colon Cancer Cells to
Anticancer Agents
Dong-Hee Shin
The Graduate School
Yonsei University
College of Pharmacy
Abstract
Histone deacetylase 6 (HDAC6), the best-characterized class IIb histone
deacetylase, is a cytoplasmic enzyme that regulates many important
biological processes. HDAC inhibitors (HDACI) are promising therapeutic
agents which are currently used in combination with chemotherapeutic
agents in clinical trials for cancer treatment. Here we show that a γ–
lactam based HDAC inhibitor A452 selectively inhibits HDAC6 catalytic
activity in vivo and in vitro. A452 causes cell death as well as growth
inhibition of transformed cells (HCT116, HT29, LNCaP, MCF, A549) an
effect not observed in normal cells (BJ). Interestingly, A452 exhibits
differential cytotoxicity for wild type and mutant p53 human colon cancer
cells. A452 shows different mechanisms of action of modulating p53: A452
increases wild type p53 by destabilizing Mdm2 while decrease mutant p53
by stabilizing Mdm2 in colon cancer cells. Moreover, A452 significantly
enhances cell death induced by the topoisomerase I inhibitor irinotecan,
DNA synthesis inhibitor capecitabine (a prodrug of 5-fluorouracil) and the
vi
pan-HDAC inhibitor SAHA in colon cancer cells. A452 in combination with
irinotecan, capecitabine or SAHA is more potent than either drug alone in
the apoptotic pathway, as evidenced by an increase in PARP cleavage.
Furthermore, A452 enhances DNA damage induced by irinotecan,
capecitabine or SAHA as indicated by increased accumulation of H2AX and
activation of the checkpoint kinase Chk2. However, A452 does not
increase cisplatin-induced cytotoxicity in HCT116 and HT29 cells.
Therefore, these findings indicate that A452 is a specific HDAC6 inhibitor
and point mechanism by which HDAC6-selective inhibition can enhance
the efficacy of certain anti-cancer agents in colon cancer cells.
Keywords: Histone deacetylase 6, HDAC6-selective inhibitor, anticancer
agent, apoptosis, colorectal cancer
Selective Inhibition of HDAC6 induces DNA damage
and apoptosis and Sensitizes Colon Cancer Cells to
Anticancer Agents
Dong-Hee Shin
The Graduate School
Yonsei University
College of Pharmacy
1
Introduction
Colorectal cancer (CRC) is the third most commonly diagnosed cancer in
males and the second in female, and the fourth most leading cause of
cancer-related deaths in the Western world 1. The number of new cases
of CRC worldwide is increasing and approximately one half of CRC
patients develop metastatic disease. 5-fluorouracil (5-FU)/ capecitabine,
irinotecan and cisplatin/oxaliplatin are common chemotherapeutic agents
used to treat colorectal cancer. For instance, 5-FU-based chemotherapy
in CRC patients has been demonstrated to improve disease-free and
overall survival by 35 and 22%, respectively 2. However, in advanced CRC,
5-FU monotherapy produces response rates of only 10-15% 3. Recently,
combination treatment with targeted molecular therapies and traditional
chemotherapy as has significantly improved response rate and overall
survival of patients with advanced CRC 4. Despite of these improvements,
more than half of colorectal cancers initially respond to chemotherapy
almost all develop resistance and overall survival of patients with
metastatic colorectal cancer is less than one year 5-8. More than half of
colorectal adenocarcinomas are still diagnosed only when the disease
involves regional or distant structures 9. Chemoresistance of these
therapies is reported and is a critical factor limiting the efficacy of
chemotherapy for CRC. This chemoresistance has been proposed to
involve in various mechanisms, such as decreased sensitivity to apoptosis,
overexpression of the transporter protein P-glycoprotein. One strategy to
overcome chemoresistance is the use of combination chemotherapy, which
is associated with potentially higher response rates and less toxic effect.
However, the combination of cytotoxic agents has increased toxicity and a
2
debatable overall survival benefit. Thus, continued development of novel
combination agents to circumvent drug resistance is of great importance
and imperative.
Histone deacetylase 6 (HDAC6) is a cytoplasmic class IIb
deacetylase that has unique structural features and substrate specificity 10.
HDAC6 possesses two catalytic domains and a C-terminal zinc finger
domain (ZnF-UBP domain, also known as BUZ) that binds free ubiquitin as
well as mono- and polyubiquitinated proteins with high affinity 11-13.
HDAC6 selectively deacetylates substrates such as tubulin, Hsp90, and
cortactin 14-16. As a microtubule-mediated cytoplasmic enzyme, HDAC6
regulates multiple important biological functionss through deacetylase
dependent and –independent mechanisms modulating many cellular
pathway relevant to normal and tumor cell growth, migration and death as
well as immune synapse formation, viral infection, the degradation of
misfolded proteins, and stress granule (SG) formation through complexes
with partner proteins. Interestingly, mice lacking HDAC6 do not have
abnormal development or problems with major organ functions 17,
suggesting that HDAC6 inhibition would not cause major side effects in
contrast to inhibition of other HDACs, in particular class I HDACs. Thus,
HDAC6 is an attractive target for potential cancer treatment.
Inhibition of HDAC has emerged as a promising approach for the
treatment of cancers 18-20. HDAC inhibitors (HDACI) have the potential to
be used as monotherapy or in combination with other anticancer therapies.
Two pan-HDACI, SAHA (vorinostat) and romidepsin (depsipeptide or
FK228), have been approved by the US Food and Drug Administration for
the treatment of cutaneous T cell lymphoma 21-23. Many more clinical trials
assessing the effects of various HDACI on both hematologic and solid
tumors are currently being conducted. Preclinical data with numerous
3
cancer cell lines have been shown synergistic and additive effects when
combining HDACI with various anticancer therapies 22. Furthermore, a
number of combination therapies with HDACI are being investigated in
clinical trials for the treatment of neoplastic diseases 24. Despite the
anticancer effects of particular HDACI against certain cancers, many
aspects of HDAC and HDACI are still not fully understood and unselective
pan-HDACIs display adverse side effects such as fatigue, nausea,
vormiting, diarrhea, thrombocytopenia, and neutropenia. To solve these
issues, HDACI currently in clinical development target several HDAC
isoforms 25. The discovery of isoform-specific HDACI is important to
elucidate the mechanism of action of specific HDAC enzymes and may
offer a therapeutic advantage by minimizing toxicity profiles.
Among the HDACs, HDAC6-selective inhibitor is promising in
treatment of cancer. Selective inhibition of HDAC6 can influence a number
of cellular pathways involved in tumorigenesis. HDAC6 inhibition promotes
α-tubulin acetylation and acetylated tubulin enhances microtubule stability
and reduces cell migration 16. Through the ubiquitin-binding domain,
HDAC6 in concert with p97/VCP, TRIM50, and p62 controls aggresome
formation and autophagosome maturation for ubiquitin-selective quality-
control (QC) autophagy 26,27. Hyperacetylation of HSP90 in response to
HDAC6 inhibition reduces the chaperone association with its client
proteins, resulting in polyubiquitination and proteasomal degradation of
many HSP90 substrates 14. Furthermore, HDAC6 inhibition can abrogate
HSP90 chaperone function when combined with the HSP90 inhibitor 17-
AAG in human leukemia cell 28, augment the cytotoxic effects of paclitaxel
29, and enhance the cytotoxicity of the proteasome inhibitor bortezomib 30-
32. Such results emphasize the need to evaluate the combination effect of
HDAC6-specific inhibitor and other anti-cancer agents on CRC.
4
Here, we report development of a novel γ-lactam based HDAC6
inhibitor A452. We show that A452 significant growth induces cell death
and inhibition in a panel of cancer cells. Furthermore, this study focuses
on the combination therapy of HDAC6-selective inhibitor with other
chemotherapeutic agents in treatment of CRC. We found that HDAC6-
selective inhibitor A452 significantly and synergically enhanced the effect
of anti-cancer drugs in inducing cell death of transformed cells but not
normal cells.
5
Materials and Methods
1. Chemicals and antibodies
Anti-acetylated tubulin antibody (T6793, IB 1:2000) was purchased from
Sigma. Antibodies directed against α-tubulin (sc-32293, IB 1:2000),
HDAC6 (sc-11420, IB 1:1000), Histone H3 (sc-10809, IB 1:1000), p21
(sc-759, IB 1:1000), p53 (sc-126, IB 1:1000), Mdm2 (sc-965, IB 1:500),
Bax (sc-20067, IB 1:500) and Puma (sc-28226, IB 1:500) were purchased
from Santa Cruz. Anti-acetylated H3 (06-599, IB 1:2000) antibody was
obtained from Millipore. Anti-phospho-Chk2 (2661, IB 1:500) antibody
was from Cell Signaling. Anti-gamma H2A.X (ab2893, IB 1:1000) antibody
was purchased from abcam. Anti-PARP (551024, IB 1:500) antibody was
purchased from BD Pharmingen™. Anti-Beta-Actin (G043, IB 1:1000)
antibody was purchased from abm.
2. Cell culture
Human cancer cell lines were purchased from American Type Culture
Collection (ATCC, Manassas, VA) and cultured in medium (HyClone,
Thermo Scientific Pierce, Rockford, IL, USA) containing 10% fetal bovine
serum (FBS), 100 units/ml penicillin, and 100 µg/ml streptomycin in a
humidified atmosphere of 5% CO2 and 95% air at 37°C.
3. Cell growth and viability
To monitor cell growth and viability, cells were seeded in triplicate at 6 ×
103 cells in 200 μl of medium in 96-well plates. The drugs were added at
6
the indicated concentrations 24 h after seeding. After drug treatment, 20
μl of CCK-8 (CK04-05, DOJINDO MOLECULAR TECHNOLOGIES, INC.)
reagent were added to the culture and reaction mixtures were incubated at
37°C for 4 h. The absorbance readings for each well were carried out at
450 nm using the multimode microplate reader (Teckan, Maennedorf,
Switzerland).
4. MTT assay
Cell viability was assessed by 3-(4, 5-dimethylthiazol-2-yl)-2, 5-
diphenyltetrazo-lium bromide (MTT) assay. Briefly, 6x103 of cells were
seeded into 96-well plates for 24 h, followed by incubation with various
reagents for indicated time. After adding 20 µl/well of MTT solution, the
cells were incubated for another 2 h. Supernatants were then removed and
the formazan crystals were dissolved in 100 µl/well DMSO. The
absorbance at 570 with a 630 nm reference of each sample was measured
using multimode microplate reader (Teckan, Maennedorf, Switzerland).
The results were presented as percent absorbance relative to vehicle to
control cultures. Three independent triplicate experiments were
performed.
5. Soft agar assay
Soft agar assays were carried out in 6-well plate in which 2 ml of 1X
RPMI1640 with 10% FBS was overlaid with 1 ml of 0.5% base agar and
0.25% top agar in 1X RPMI1640 with 10% FBS containing the cells. Cells
of each clone (2 × 104) were plated. 1 ml of culture medium was added to
the top of each plate every 5 days and cells were grown at 37°C for 30
days. The plates were stained with 1 ml of 0.05% Crystal Violet for > 1
7
hour and colonies were counted using a microscope.
6. Acid extraction of histones
HCT116 and HT29 (5.5 x 106) cells were washed with PBS and cell were
suspended in 10 volumes of PBS and centrifuged at 200 g for 10 min. Cells
were then suspended with five volumes of hypotonic lysis buffer (10 mM
Tris-Cl (pH 8.0), 1.5 mM MgCl2, 1 mM KCl, 1 mM DTT, and 1 mM
phenylmethylsulfonyl fluoride) and 0.4 N H2SO4 at a final concentration of
0.2 M and subsequently lysed on ice for 30 min. After centrifugation at
16,000 g for 10 min at 4°C, the cell supernatant fraction that contained
acid-soluble proteins was retained. Trichloroacetic acid was added to the
supernatant up to 33% and the samples were incubated on ice overnight.
Proteins were pelleted by centrifugation at 16,000 g for 10 min at 4°C and
washed 4 times with ice cold acetone with centrifugations at 16,000 g for
5 min at 4°C. Histone pellet air-dried for 20 min at room temperature and
dissolve histone pellet in appropriate volume of ddH2O.
7. Annexin V/PI assay and Flow cytometry
Apoptosis was assessed using Annexin V-PI double staining according to
the manufacturer (BD, San Jose, CA, USA). After treatments, cells were
trypsinized, and stained with 0.5 mg/ ml Annexin V in binding buffer (10
mM HEPES free acid, 0.14 M NaCl, and 2.5 mM CaCl2) for 30 min.
Afterward, PI (5 mg/mL final concentration) was added and incubated for
another 15 min. Cells were applied to a flow cytometer (Beckman
Dickinson) for data collection.
8. Western Blot
8
Cells were rinsed twice with ice-cold PBS and were then extracted with
NP-40 lysis buffer (0.5% NP-40, 50 mM Tris-HCl pH 7.4, 120 mM NaCl,
25 mM NaF, 25 mM glycerol phosphate, 1 mM EDTA, 5 mM EGTA, and
Complete protease inhibitor cocktail tablet (Roche, Basel, Switzerland).
Cells were collected and centrifuged at 15,000 g for 15 min at 4°C. Protein
concentration was measured with a BCA protein assay kit (Thermo
Scientific Pierce, Rockford, IL, USA). Cell lysates containing 10-50 µg of
total protein were subjected to SDS-PAGE on 8-12% slab gels, and
proteins were transferred to nitrocellulose membranes. Membranes were
blocked for 1 h in PBS containing 0.1% Tween-20 and 10% (v/v) horse
serum and incubated overnight with the primary antibody. The membranes
were then washed with 0.1% Tween-20/PBS and incubated for 1 h with an
anti-rabbit/mouse secondary antibody coupled to HRP; bound antibodies
were detected with the ECL western blotting analysis system (Thermo
Scientific Pierce, Rockford, IL, USA).
9. Small interfering RNA (siRNA) transfection
The following siRNA were used: control luciferase siRNA and HDAC6
siRNA (Santa Cruz, sc-35544). For transfection, cell grown to 80%
confluence and then transfected with siRNA (100 nM) using RNAiMAX
Lipofectamine reagent (Invitrogen, USA) by following the manufacturer’s
instructions. Cells were incubated with the siRNA-RNAiMAX complex for
24 h. The medium was then replaced with fresh serum-free medium for 24
h prior to A452 and other anticancer agent treatments.
10. Analysis of gene expression by qRT-PCR
9
A two-step approach was taken in which the initial reverse transcription
was followed by the quantitative PCR amplification. Total RNA was
extracted from cells using the TRIzol Reagent (Invitrogen, USA),
RNAsecure™ (Ambion, Austin, Tex, USA) and Turbo™ DNase (Ambion,
Austin, Tex, USA) following the manufacturer’s instructions. cDNA derived
from this RNA using SuperScript III Reverse Transcriptase (Invitrogen)
was used as template for quantitative real-time (qRT) PCR performed with
the Applied Biosystems 7500 System (Applied Biosystems, Foster City,
CA, USA). mRNA levels were quantitated using a calibration curve based
on known dilution of concentrated cDNA. mRNA values were normalized to
that of GAPDH.
11. Statistical analysis
All data are presented as mean ± S.E.M. from three or four independent
experiments. Statistical differences were determined by a student t test.
Statistical significance is displayed as *(P < 0.05), * * (P < 0.01) or * * * (P
< 0.001).
10
12. Real Time PCR Primer sequences
Gene Primer sequence (5’ - 3’)
p21 Forward : CACCGAGACACCACTGGAGG
Reverse : GAGAAGATCAGCCGGCGTTT
MDM2 Forward : ATCTTGGCCAGTATATTATG
Reverse : GTTCCTGTAGATCATGGTAT
PUMA Forward : GACCTCAACGCACAGTA
Reverse : CTAATTGGGCTCCATCT
TSP1 Forward : CCCGTGGTCATCTTGTTCTGT
Reverse : TTTCTTGCAGGCTTTGGTCTCC
p53 Forward : GAGGGATGTTTGGGAGATGTAAGAAATG
Reverse : TTCACAGATATGGGCCTTGAAGTTAGAGAA
BAX Forward : TCTACTTTGCCAGCAAACTGG
Reverse : TGTCCAGCCCATGATGGTTCT
GADD45 Forward : TGCGAGAACGACATCAACAT
Reverse : TCCCGGCAAAAACAAATAAG
GAPDH Forward : CATGAGAAGTATGACAACAGCCT
Reverse : AGTCCTTCCACGATACCAAAGT
11
Result
1. A452 is an effective HDAC6 inhibitor
γ-lactam based HDAC6 inhibitor, A452, is selective to in various human
cancer cells 33. The binding mode of A452 is similar to that of trichostatin
A (TSA), a pan-HDAC inhibitor: zinc ion in the active site is chelated with
hydroxamic acids and naphthyl moiety as cap group lies in hydrophobic
surface of the HDAC enzyme (Fig. 1A). Frist, we tested the effect of A452
on HDAC6 substrate in a panel of cancer cells. A452 showed good
inhibitory activity of HDAC6, as evidenced by increased level of
acetylated α-tubulin, known substrates of HDAC6 (Fig. 1B). Among the
cancer cells, we focused on human colorectal cancer (CRC) which showed
differential inhibitory effect of HDAC6 by A452 and high relapse,
metastasis and mortality rates. In CRC HCT116 and HT29 cells, HDAC6
inhibition with A452 resulted in the accumulation of acetylated α-tubulin
in a concentration-dependent manner at 24 h but not acetylated histones
(Fig. 1C-1F). Treatment with the clinically licensed broad-spectrum
inhibitor, SAHA, also increased acetylation of α-tubulin (Fig. 1C) and
histone H3 (data no shown). These results represent that A452 is a
specific HDAC6 inhibitor.
2. A452 Inhibits cell growth and viability of transformed but
not normal cells
12
We examined the effect of A452 on cell growth and viability in CRC
HCT116 and HT29 cells. Cells were cultured with A452 for 72 h and
measured cell viability by MTT assay. A452 resulted in a drug
concentration-dependent decrease of the cell viability (Fig. 2A, 2B). Also,
inhibition of cell growth was a concentration dependent (Fig. 2E, 2F). Cells
were cultured with 0.5, 1, or 2 μM of A452, conventional chemotherapeutic
drugs, topoisomerase I inhibitor irinotecan, DNA synthesis inhibitor
capecitabine (a prodrug of 5-fluorouracil), DNA-damaging agent cisplatin
for colon cancer as well as a pan-HDAC inhibitor, SAHA for up to 72h.
Culture with 2 μM A452 resulted in a 88% and 72% loss of cell viability in
HCT116 and HT29 cells respectively after 72h (Fig. 2G and 2H). A452-
induced cell death was markedly higher compared with other
chemotherapeutic agents (cisplatin; 17% vs 13%, irinotecan; 48% vs 36%,
capecitabine; 65% vs 48% in HCT116 and HT29 cells, respectively).
Next, we determined the effect of A452 on cell viability of normal
human foreskin fibroblast BJ and other transformed (LNCaP, human
prostate adenocarcinoma; A549, lung adenocarcinoma; and MCF7, breast
adenocarcinoma) cells cultured with 0.5, 1, or 2 μM A452 for up to 72 h.
A452 decreased cell viability of transformed cells in a concentration-
dependent manner but not that of normal cells (Fig. 3A-3D). In normal and
transformed cells, A452 caused accumulation of acetylated α-tubulin,
substrate of HDAC6 (Fig. 3E). Taken together, these findings show that
A452 induces cell death in various transformed but not normal cells.
3. A452 induces caspase-dependent apoptosis
13
To investigate the pathway of cell death in CRC cells cultured with the
A452, the poly(ADP ribose) polymerase (PARP) and its proteolytic
fragments were assayed. PARP is a 116 kDa nuclear protein that is
specifically cleaved by caspase-3 into a 85 kDa fragment and serves as a
marker of apoptosis 34. In both HT29 and HCT116 cells cultured with 2 μM
A452, the level of full-length PARP decreased, with an increase in cleaved
PARP (Fig. 4A and 4B). To further confirm our result, flow cytometry
analysis was employed to detect apoptotic population in cells exposed to
A452. As shown in Figure 4C and 4D, apoptosis dramatically increased in
CRC cells treated with A452 compared with other chemotherapeutic drugs.
Overall, our results suggest that cell death induced by A452 is, in part,
dependent on caspase activation.
4. A452 induces the accumulation of γH2AX and phos-Chk2
Previous report demonstrated that the HDAC6-selective inhibitor, tubacin,
causes accumulation of phosphorylated histone H2AX (γH2AX), an early
indicator of DNA double-strand breaks (DSB), in transformed cells 35. We
tested whether selective inhibition of HDAC6 with A452 activates a DNA
damage response. A452 increased the accumulation of DNA damage in
both HT29 and HCT116 cells (Fig. 4E and 4F). In particular, the level of
γH2AX upon 2 μM A452 treatments was higher in HCT116 cells compared
with HT29 cells.
Next, we assessed the activation of the checkpoint kinase Chk2
which is phosphorylated on Thr68 in response to DNA damage and has
been implicated in both G1 and G2 checkpoint activation 36. Culture with
14
A452 did not significantly activate Chk2, as shown by the level of
phospho-Chk2 (Fig. 4E and 4F).
5. A452 modulates p53 by upregulating wild type p53 and
downregulating mutant p53 in CRC cells
The tumor suppressor p53 plays an essential role in cell growth arrest and
apoptosis in tumors. Mutant p53 cancers are dependent on their
hyperstable mutant p53 protein for survival but not normal cells 37,38. To
analyze whether inhibition of HDAC6 by A452 has an effect on wild and
mutant p53 expression, panel of human colon cancer cell lines harboring
either wild or mutant p53 were analyzed by immunoblots. As shown in
Figure 5A, A452 strongly upregulated levels of wild p53 protein while
downregulated the various aberrantly accumulated mutant p53 proteins in
all cases. A452 treatment increased the levels of MDM2 in mutant p53, but
not wild p53 cells. In HCT116 cells, A452-mediated upregulation of wild
p53 by low micromolar concentrations was dose-dependent at the mRNA
and protein levels. This effect correlated with induction of mRNA and
protein levels of downstream target genes such as p21, BAX and PUMA
(Fig. 5B and 5C). In contrast, inhibition of HDAC6 reduced mutant p53
protein levels in HT29 cells in a dose-dependent manner while the mRNA
level remained unchanged. A452 caused induction of downstream target
genes MDM2, BAX and GADD45 while reduction of PUMA (Fig. 5B and
5D). Taken together, our results indicate that expression level of p53 was
differently regulated by HDAC6.
15
6. A452 sensitizes human colon cancer cells to cell death
induced by SAHA, cisplatin, irinotecan, or capecitabine
Because a HDAC6-specific inhibitor tubacin synergizes with the cytotoxic
anticancer drugs in prostate cancer and lung cancer 35, we set out to
identify therapeutic combinations of a new potent HDAC6-specific
inhibitor and cytotoxic drugs in colon cancer cells. To do this, we tested
the cell death-inducing effects of A452 in combination with cisplatin,
irinotecan, capecitabine and SAHA in HT29 and HCT116 cells. A452
pretreatment substantially increased other cytotoxic drugs-induced cell
death (Fig. 6A and 7A). This effect was more evident in HCT116 (wild p53)
cells compared with HT29 (mutant p53) cells. To further confirm these
results, cells were treated with either A452 or in combination with other
anticancer drugs for colon cancer In HCT116 and HT29 cells and then
MTT assay performed to measure cell viability. The combination of 0.1
μM A452 with 0.2 μM SAHA increased cell death compared with cultures
with SAHA alone (Fig. 6B) in HCT116. This combined treatment resulted
in a 51.5% loss of cell viability after 72 h (Fig. 6B). HCT116 cell death
was markedly enhanced in cultures with 0.1 μM A452 and 0.5 μM
irinotecan (60%) compared with cultures with irinotecan alone (Fig. 6B). In
contrast, A452 had no detectable effect of cell viability when combined
with ciaplatin and capecitabine in HCT116 cells. Higher concentration of
A452 (2 μM) rendered hypersensitivity to cell death in HCT116. In
addition HCT116, the combination of 0.2 μM A452 with 0.5 μM SAHA
increased cell death compared with cultures with SAHA alone (Fig. 7B) in
HT29 cells. This combined treatment resulted in a 66% loss of cell
viability after 72 h (Fig. 7C). HT29 cell death was markedly enhanced in
cultures with 0.2 μM A452 and 5.0 μM irinotecan compared with cultures
16
with irinotecan alone. Similarly, HT29 cell death was enhanced in culture
with 0.2 μM A452 plus 10 μM capecitabine compared with culture with
capecitabine alone. HT29 is a human colon cancer cell line that is
relatively resistant to cisplatin- and oxaliplatin-induced cell death 39.
HT29 cells cultured with a combination of cisplatin plus A452 did not
cause to synergically induce cell death (Fig. 7B). In a higher concentration
of A452 (2.0 μM), we obtained similar synergic effect of cell death induced
by A452. A452 also increased the sensitivity of MCF7 cells to SAHA-,
irinotecan- and capecitabine-induced cell death (Fig. 7D). Therefore,
these results indicate that A452 enhances transformed cell death induced
by the anticancer drugs.
7. Down-regulation of HDAC6 expression increases
sensitivity to cell death induced by SAHA, irinotecan or
capacitabine
We next determined whether CRC cells in which HDAC6 expression was
genetically suppressed were more sensitive than WT cells to SAHA,
cisplatin, irinotecan, or capacitabine-induced cell death. siRNA targeting
against HDAC6 resulted in reduced HDAC6 levels and increased
acetylated α-tubulin in HCT116 and HT29 cells (Fig. 8A, 8B). Knockdown
of HDAC6 resulted in a decrease in the rate of cell growth (Fig. 8C and 8D)
and increased cell death. HDAC6 knockdown of HT29 cells cultured with
SAHA, irinotecan, or capecitabine for 72 h resulted in 48%-55% cell death
compared with approximately HDAC knockdown (38%) alone and 13%
cells death in WT and scramble siRNA transfected HT29 cells (Fig. 8E).
17
8. Culture with A452 plus SAHA, cisplatin, irinotecan or
capecitabine enhances caspase-dependent apoptosis in
CRC cells
To investigate the pathway of cell death in CRC cells cultured with the
combination of A452 and SAHA, cisplatin, irinotecan or capecitabine, the
poly(ADP ribose) polymerase (PARP) and its proteolytic fragments were
assayed. In cells cultured with A452 and SAHA, the level of cleaved PARP
increased in both HCT116 and HT29 cells (Fig. 9A, 9B). Similarly, cells
cultured with the combination of A452 and cisplatin or irinotecan induced
PARP degradation. In case of capecitabine, PAPR the most cleaved in
combination with A452. To further confirm our result, flow cytometry
analysis was employed to detect apoptotic population in cells exposed to
A452 in combined treatments. As unexpected, apoptosis did not
synergically induce in CRC cells treated with A452 combination with other
chemotherapeutic drugs.
9. A452 enhances the accumulation of γH2AX and phos-
Chk2 induced by SAHA, irinotecan or capecitabine
We tested whether selective inhibition of HDAC6 with A452 activates a
DNA damage response in combination with anticancer agents in CRC cells.
Combination of A452 with SAHA, cisplatin, irinotecan, or capecitabine
synergically increased the accumulation of γH2A compared with compound
alone in HT29 cells (Fig. 9F). In particular, the combination of A452 with
18
capecitabine resulted in a more marked accumulation of γH2AX than in
cells cultured with compound alone. In HCT116, combination of A452 with
other anticancer agents resulted in increased level of γH2A nevertheless
A452 alone very strongly elevated level of γH2AX (Fig. 9E).
Next, we assessed the activation of the checkpoint kinase Chk2
which is a DNA damage marker. Combination of A452 with irinotecan or
capecitabine enhanced in the activation of Chk2, as shown by an increase
of phospho-Chk2 (Fig. 9F). Thus, HDAC6 inhibition can potentiate the
DNA damage and checkpoint response induced by irinotecan or
capecitabine in wild p53 HT29 cells.
19
20
Figure 1. A452 is a specific-HDAC6 inhibitor
(A) Chemical structure of A452 and orientation of A452 (yellow) and TSA
(green) to the catalytic site of HDAC2. (B) Various human cancer cells
were treated 50 nM of A452 for 24 h. Western blot analysis probing with
antibodies against acetylated α-tubulin (Ac-tub) and α-tubulin. HCT116
(C) and HT29 (D) cells were treated A452 as indicated concentrations for
24 h and performed western blot analysis probing with antibodies against
acetylated α-tubulin (Ac-tub), α-tubulin and HDAC6. (E) and (F) HT29
cells were cultured for 24 h with A452, SAHA, and A452 plus SAHA as
indicated concentrations and performed western blot analysis with
antibodies against acetylated α-tubulin (Ac-tub), α-tubulin, acetylated
histone H3 (Ac-H3) and histone H3. α-Tubulin and histone H3 are shown
as loading controls.
21
22
Figure 2. Effects of A452 on cell growth and viability and
acetylated patterns of proteins in HCT116 and HT29 cells
HCT116 (A) and HT29 (B) cells were cultured with indicated doses of
A452 for 72h and MTT assays were performed to analyze viability.
HCT116 (C) and HT29 (D) cells were cultured for 24 h with 0.5, 1.0, 2.0 μ
M A452 or 5 μM SAHA. SAHA is a positive control. Cell lysates were for
prepared for immunoblot analysis of α-tubulin (Ac-tub) and α-tubulin. α-
Tubulin is a loading control. Cell growth and viability of HCT116 (E, G)
and HT29 (F, H) cells cultured with A452 (0.5, 1.0, 2.0 μM), SAHA (5 μM),
cisplatin (10 μM), irinotecan (5 μM), or capecitabine (10 μM). Inhibition of
cell growth of HCT116 and HT29 cells is concentration-dependent. Viable
cell numbers were evaluated by CCK-8 reagent and viability was
measured by MTT assay. Data are expressed as mean ± SEM from three
independent experiments.
23
24
Figure 3. Effects of A452 on cell viability and acetylated
patterns of tubulin in normal and other transformed cells
Transformed (MCF7 (A), LNCaP (B) and A549 (C)) and normal BJ (D))
cells were cultured with indicated doses of A452 for 72 h. SAHA, pan-
HDAC inhibitor, is a positive control. Viable cells were evaluated by MTT
assay. (E) A452 causes accumulation of acetylated α-tubulin in normal and
transformed cells. Cells were cultured with 0.5, 1.0, 2.0 μM A452 or 5 μM
SAHA for 24 h as indicated. Cell lysates were prepared for immunoblot
analysis of indicated antibodies. α-Tubulin is a loading control.
25
26
Figure 4. A452 induces apoptosis and accumulation of γH2AX in
colon cancer cells
HCT116 and HT29 cells were cultured with indicated compounds for 24 h.
Western blot analysis show PARP degradation, phosphorylated γH2AX and
phosphorylated Chk2 in HCT116 (A, E) and HT29 (B, F) cells. α-Tubulin
is shown as a loading control. HCT116 (C) and HT29 (D) cells were
treated with A452, SAHA, cisplatin, irinotecan or capecitabine as indicated
for 48 h and stained with Annexin V and propidium iodide (PI) for 15 min.
Apoptosis induced by these compounds was then assessed by flow
cytometry analysis. Data are expressed as mean ± SEM from three
independent experiments.
27
Figure 5. A452 regulate p53 in colon cancer cells
Expression of p53 and p53 target gene was analyzed by western blot (A)
and real-time RT-PCR (B) in HCT116 and HT29 cells treated with
indicated doses of A452 for 24 h.
28
Figure 6. A452 enhances cell death induced by SAHA,
irinotecan, or capecitabine in transformed HCT116 cells
Dead cells were quantified in HCT116 cells treated with A452 (50 nM) for
48 h and then for an additional 24 h in the presence of SAHA (2.5 μM),
cisplatin (10 μM), irinotecan (5 μM), capecitabine (10 μM), etoposide (20
μM) and Adriamycin (1 μM). Data is expressed as the percentage of dead
cells. (B and C) HCT116 cells were cultured with A452, SAHA, cisplatin,
irinotecan, capecitabine or in combination with these compounds as
indicated for 72 h. Cell viability was measured by MTT assay. Data are
expressed as mean ± SEM from three independent experiments.
29
30
Figure 7. A452 enhances cell death induced by SAHA,
irinotecan, or capecitabine in transformed HT29 cells
(A) Dead cells were quantified in HT29 cells treated with A452 (200 nM)
for 48 h and then for an additional 24 h in the presence of SAHA (5 μM),
cisplatin (10 μM), irinotecan (5 μM), capecitabine (10 μM), etoposide (20
μM) and Adriamycin (1 μM). Data is expressed as the percentage of dead
cells. HT29 (B, C) and MCF7 (C) cells were cultured with A452, SAHA,
cisplatin, irinotecan, capecitabine or in combination with these compounds
as indicated for 72 h. Cell viability was measured by MTT assay. Data is
expressed as mean ± SEM from three independent experiments.
31
32
33
34
Figure 8. Down-regulation of HDAC6 expression in HT29 cells
results in increased sensitivity to cell death induced by SAHA,
irinotecan, or capecitabine
Western blot analysis of HCT116 (A) and HT29 (B) cells expressing
siRNA targeting HDAC6 and non-targeting scramble siRNA. Cell growth
and viability of HCT116 (C) and HT29 (D, E) cells cultured with siRNA
targeting HDAC6 with SAHA, cisplatin, irinotecan or capecitabine have no
synergy effect. Data is expressed as mean ± SEM from three independent
experiments.
35
36
Figure 9. A452 enhances SAHA-, irinotecan-, or capecitabine-
induced cell death
HCT116 (A, E) and HT29 (B, F) cells were treated with indicated doses of
compounds for 24 h. Western blot analysis shows PARP degradation,
phosphorylated γH2AX and phosphorylated Chk2. α-Tubulin is shown as a
loading control. HCT116 (C) and HT29 (D) cells were treated with A452,
SAHA, cisplatin, irinotecan or capecitabine as indicated for 48 h and
stained with Annexin V and propidium iodide (PI) for 15 min. Apoptotic
cells were then measured by FACS analysis. Data is expressed as mean ±
SEM from three independent experiments.
37
Discussion
In this study, we show that selective chemical inhibitor of HDAC6 induces
cell death and significant growth inhibition in transformed cancer cells.
A452 differentially modulates p53, resulting in cell growth inhibition and
cell death. Also, A452 results in sensitivity of cancer cells to the anti-
cancer agents irinotecan and capecitabine or pan-HDAC inhibitor SAHA.
This effect is not observed in normal cells. These findings show that, at
concentration of SAHA, irinotecan, or capecitabine that are clinically
attainable and tolerated 5,40, HDAC6-selective inhibition can enhance the
therapeutic efficacy of these agents in certain transformed cells.
Recent studies suggested that HDACI including SAHA interact
synergically with cytotoxic agents, such as doxorubicin and etoposide, to
dramatically increase mitochondrial injury and apoptosis in leukemia and
lung cancer cells 35. The antitumorigenic properties of HDACI are
especially notable due to the fact that their cytotoxic effects are usually
specific to cancer cells but to normal cells. We found that selective-
HDAC6 inhibitor A452 alone significantly inhibited CRC growth, but when
combined with SAHA, irinotecan, or capecitabine, it further enhanced the
anti-tumor effects against the different CRC cell lines. There is very
limited information in HDACI in combination with other anti-tumor agents
against CRC. Our data for the first time have demonstrated a synergic
effect of selective-HDAC6 inhibitor and other anti-cancer agent in
inhibition of CRC.
The selective-HDAC6 inhibitor A452 was found to cause
accumulation of γH2AX, a marker of DNA DSBs. The combination of A452
plus SAHA, irinotecan or capecitabine markedly increased the
accumulation of γH2AX and phosphor-Chk2 in colon cancer cells. These
results suggest that HDAC6 inhibition increased SAHA, irinotecan or
38
capecitabine induced accumulation of DNA DSBs, which may explain, in
part, the chemosensitizing effect of HDAC6 inhibition in colon cancer cells.
Synergistic and additive tumor cell apoptosis has been observed when
combing pan-HDAC inhibitors with cytotoxic therapies that induce DNA
damage 41,42, Enhanced DNA damage observed in culture with combined
inhibitors has been attributed to induction of histone hyperacetylation by
the HDAC inhibitor, resulting in a more open chromatin structure, making
DNA more susceptible to damage by various toxic agents. Pan-HDAC
inhibitors such as SAHA can suppress DNA repair proteins in transformed
cells, resulting in failure to repair DNA damage 43-45. In contrast to pan
HDACI, selective-HDAC6 inhibitor may possess different mechanism of
action in suppressing DNA repair proteins. First, A452 induced
accumulation of DNA breaks in HT29 cells cultured with A452 may result
in part from an impaired capacity for DNA DSB repair. Several proteins
involved in the DNA damage repair pathway are targets of lysine
acetylation 46, and acetylation of DNA repair proteins has been shown to
alter their activity 47,48. Second, target proteins of HDAC6 include the
chaperone protein HSP90 14,49. Acetylation of Hsp90 impairs its chaperone
function and exposes its client proteins such as DNA repair proteins to
degradation, resulting in defective DNA repair and cell death.
We found that A452 markedly enhanced SAHA-, irinotecan- or
capecitabine-induced transformed cell apoptosis, as evidenced by
increased PARP cleavage and caspase-dependent cell death. In light of the
findings that (a) A452 induced more cell death in HCT116 cells bearing
wild p53, (b) HDAC6 inhibitor can lead to upregulation of p53, we
rationally assumed that the combined treatment with A452 and other anti-
cancer agents increased apoptosis probably via inducing p53 expression in
HCT116. In contrast, HT29 cells bearing mutant p53 induced cell death via
39
differently modulating of mutant p53 by A452. The highly accumulated
mutant p53 protein, a hallmark of almost 50% of human tumors, is a
clinically relevant target for intervention. It is the hyperstability of mutant
p53 that is the basis for its gain of function and dominant-negativity (over
wild p53 in case of heterozygosity) that promotes malignancy and
chemoresistance 50. Aberrant accumulation of mutant p53 does not occur
in normal cells 37 but is tumor-specific due to massive upregulation of
HSP90 chaperone machinery that almost ubiquitously accompanies
malignant transformation 51,52. Depletion of mutant p53 was shown to
decrease tumor cell proliferation in vitro and in xenografts, inhibit invasion
and metastasis, and sensitize tumor cells towards genotoxic therapy 53-56.
Li et al. show that SAHA preferential cytotoxicity in mutant p53 cancer
cells by destabilizing mutant p53 through inhibition of the HDAC6-HSP90
complex 57. In consistent with this finding, our data showed that selective
HDAC6 inhibitor A452 enhanced cell death in mutant p53 HT29 cells by
destabilizing mutant p53 protein. Like SAHA, A452 probably may
destabilize mutant p53 via preventing formation of HDAC6-Hsp90 complex
and stabilizing MDM2, resulting in degradation of mutant p53. Thus, this
data suggest that A452 leads to cell death by reduction of hyperstable
mutant p53 in mutant p53 bearing cancer cells and by increase of wild p53
in wild p53 bearing cancer cells. However, more evidences should be
obtained to verify the possibility. Because cancer cells that overexpress
mutant p53 are generally highly resistant to conventional
chemotherapeutic drugs, destabilization of mutant p53 is indeed an
effective strategy for treating these cancer cells. Therefore, HDAC6
inhibitor, by virtue of depleting mutant p53 or increasing wild p53, could
become centerpiece in anticancer therapy.
40
In summary, we discovered a HDAC6-selective inhibitor, A452,
that has the potential to enhance anticancer drug efficacy in combination
therapy of human cancers, The present findings suggest that combination
therapy with a selective HDAC6 inhibitor and certain anticancer agents
may be a strategy for therapy of sensitive tumors while sparing normal
cells. The chemosensitization of anti-cancer agents by A452 has
significant potential in CRC chemotherapy. Further studies are necessary
to confirm our findings in patients with advanced CRC.
41
Reference
1 Jemal, A. et al. Global cancer statistics. CA Cancer J Clin 61, 69-90,
doi:10.3322/caac.20107 (2011).
2 Efficacy of adjuvant fluorouracil and folinic acid in colon cancer.
International Multicentre Pooled Analysis of Colon Cancer Trials
(IMPACT) investigators. Lancet 345, 939-944 (1995).
3 Johnston, P. G. & Kaye, S. Capecitabine: a novel agent for the treatment
of solid tumors. Anticancer Drugs 12, 639-646 (2001).
4 Grothey, A., Sargent, D., Goldberg, R. M. & Schmoll, H. J. Survival of
patients with advanced colorectal cancer improves with the availability of
fluorouracil-leucovorin, irinotecan, and oxaliplatin in the course of
treatment. J Clin Oncol 22, 1209-1214, doi:10.1200/JCO.2004.11.037
(2004).
5 Koopman, M. et al. Sequential versus combination chemotherapy with
capecitabine, irinotecan, and oxaliplatin in advanced colorectal cancer
(CAIRO): a phase III randomised controlled trial. Lancet 370, 135-142,
doi:10.1016/S0140-6736(07)61086-1 (2007).
6 Mayer, R. J. Targeted therapy for advanced colorectal cancer--more is not
always better. N Engl J Med 360, 623-625, doi:10.1056/NEJMe0809343
(2009).
7 Seymour, M. T. et al. Different strategies of sequential and combination
chemotherapy for patients with poor prognosis advanced colorectal cancer
(MRC FOCUS): a randomised controlled trial. Lancet 370, 143-152,
doi:10.1016/S0140-6736(07)61087-3 (2007).
8 Tol, J. et al. Chemotherapy, bevacizumab, and cetuximab in metastatic
colorectal cancer. N Engl J Med 360, 563-572,
doi:10.1056/NEJMoa0808268 (2009).
9 Ratto, C. et al. Prognostic factors in colorectal cancer. Literature review
for clinical application. Dis Colon Rectum 41, 1033-1049 (1998).
10 Verdel, A. et al. Active maintenance of mHDA2/mHDAC6 histone-
deacetylase in the cytoplasm. Current biology : CB 10, 747-749 (2000).
11 Boyault, C. et al. HDAC6-p97/VCP controlled polyubiquitin chain
turnover. EMBO J 25, 3357-3366, doi:10.1038/sj.emboj.7601210 (2006).
12 Hook, S. S., Orian, A., Cowley, S. M. & Eisenman, R. N. Histone
deacetylase 6 binds polyubiquitin through its zinc finger (PAZ domain)
and copurifies with deubiquitinating enzymes. Proceedings of the National
Academy of Sciences of the United States of America 99, 13425-13430,
doi:10.1073/pnas.172511699 (2002).
13 Seigneurin-Berny, D. et al. Identification of components of the murine
histone deacetylase 6 complex: link between acetylation and ubiquitination
signaling pathways. Molecular and cellular biology 21, 8035-8044,
doi:10.1128/MCB.21.23.8035-8044.2001 (2001).
42
14 Bali, P. et al. Inhibition of histone deacetylase 6 acetylates and disrupts the
chaperone function of heat shock protein 90: a novel basis for
antileukemia activity of histone deacetylase inhibitors. J Biol Chem 280,
26729-26734 (2005).
15 Haggarty, S. J., Koeller, K. M., Wong, J. C., Grozinger, C. M. & Schreiber,
S. L. Domain-selective small-molecule inhibitor of histone deacetylase 6
(HDAC6)-mediated tubulin deacetylation. Proc Natl Acad Sci U S A 100,
4389-4394, doi:10.1073/pnas.0430973100 (2003).
16 Hubbert, C. et al. HDAC6 is a microtubule-associated deacetylase. Nature
417, 455-458, doi:10.1038/417455a (2002).
17 Zhang, Y. et al. Mice lacking histone deacetylase 6 have hyperacetylated
tubulin but are viable and develop normally. Molecular and cellular
biology 28, 1688-1701, doi:10.1128/MCB.01154-06 (2008).
18 Mehnert, J. M. & Kelly, W. K. Histone deacetylase inhibitors: biology and
mechanism of action. Cancer J 13, 23-29,
doi:10.1097/PPO.0b013e31803c72ba (2007).
19 Richon, V. M., Garcia-Vargas, J. & Hardwick, J. S. Development of
vorinostat: current applications and future perspectives for cancer therapy.
Cancer Lett 280, 201-210, doi:10.1016/j.canlet.2009.01.002 (2009).
20 Ropero, S. & Esteller, M. The role of histone deacetylases (HDACs) in
human cancer. Mol Oncol 1, 19-25, doi:10.1016/j.molonc.2007.01.001
(2007).
21 Campas-Moya, C. Romidepsin for the treatment of cutaneous T-cell
lymphoma. Drugs Today (Barc) 45, 787-795,
doi:10.1358/dot.2009.45.11.1437052 (2009).
22 Duvic, M. et al. Evaluation of the long-term tolerability and clinical
benefit of vorinostat in patients with advanced cutaneous T-cell lymphoma.
Clin Lymphoma Myeloma 9, 412-416, doi:10.3816/CLM.2009.n.082
(2009).
23 Marks, P. A. & Breslow, R. Dimethyl sulfoxide to vorinostat:
development of this histone deacetylase inhibitor as an anticancer drug.
Nat Biotechnol 25, 84-90, doi:10.1038/nbt1272 (2007).
24 Ma, X., Ezzeldin, H. H. & Diasio, R. B. Histone deacetylase inhibitors:
current status and overview of recent clinical trials. Drugs 69, 1911-1934,
doi:10.2165/11315680-000000000-00000 (2009).
25 Bradner, J. E. et al. Chemical genetic strategy identifies histone
deacetylase 1 (HDAC1) and HDAC2 as therapeutic targets in sickle cell
disease. Proc Natl Acad Sci U S A 107, 12617-12622,
doi:10.1073/pnas.1006774107 (2010).
26 Fusco, C. et al. The E3-Ubiquitin Ligase TRIM50 Interacts with HDAC6
and p62, and Promotes the Sequestration and Clearance of Ubiquitinated
Proteins into the Aggresome. PloS one 7, e40440,
doi:10.1371/journal.pone.0040440 (2012).
43
27 Lee, J. Y. et al. HDAC6 controls autophagosome maturation essential for
ubiquitin-selective quality-control autophagy. EMBO J,
doi:10.1038/emboj.2009.405 (2010).
28 Rao, R. et al. HDAC6 inhibition enhances 17-AAG--mediated abrogation
of hsp90 chaperone function in human leukemia cells. Blood 112, 1886-
1893, doi:10.1182/blood-2008-03-143644 (2008).
29 Marcus, A. I. et al. The synergistic combination of the farnesyl transferase
inhibitor lonafarnib and paclitaxel enhances tubulin acetylation and
requires a functional tubulin deacetylase. Cancer research 65, 3883-3893,
doi:10.1158/0008-5472.CAN-04-3757 (2005).
30 Bazzaro, M. et al. Ubiquitin proteasome system stress underlies
synergistic killing of ovarian cancer cells by bortezomib and a novel
HDAC6 inhibitor. Clin Cancer Res 14, 7340-7347, doi:10.1158/1078-
0432.CCR-08-0642 (2008).
31 Hideshima, T. et al. Small-molecule inhibition of proteasome and
aggresome function induces synergistic antitumor activity in multiple
myeloma. Proceedings of the National Academy of Sciences of the United
States of America 102, 8567-8572, doi:10.1073/pnas.0503221102 (2005).
32 Kawada, J., Zou, P., Mazitschek, R., Bradner, J. E. & Cohen, J. I. Tubacin
kills Epstein-Barr virus (EBV)-Burkitt lymphoma cells by inducing
reactive oxygen species and EBV lymphoblastoid cells by inducing
apoptosis. J Biol Chem 284, 17102-17109, doi:10.1074/jbc.M809090200
(2009).
33 Choi, E. et al. Structure and property based design, synthesis and
biological evaluation of gamma-lactam based HDAC inhibitors. Bioorg
Med Chem Lett 21, 1218-1221, doi:10.1016/j.bmcl.2010.12.079 (2011).
34 Simbulan-Rosenthal, C. M., Rosenthal, D. S., Iyer, S., Boulares, A. H. &
Smulson, M. E. Transient poly(ADP-ribosyl)ation of nuclear proteins and
role of poly(ADP-ribose) polymerase in the early stages of apoptosis. J
Biol Chem 273, 13703-13712 (1998).
35 Namdar, M., Perez, G., Ngo, L. & Marks, P. A. Selective inhibition of
histone deacetylase 6 (HDAC6) induces DNA damage and sensitizes
transformed cells to anticancer agents. Proceedings of the National
Academy of Sciences of the United States of America 107, 20003-20008,
doi:10.1073/pnas.1013754107 (2010).
36 Falck, J., Mailand, N., Syljuasen, R. G., Bartek, J. & Lukas, J. The ATM-
Chk2-Cdc25A checkpoint pathway guards against radioresistant DNA
synthesis. Nature 410, 842-847, doi:10.1038/35071124 (2001).
37 Lang, G. A. et al. Gain of function of a p53 hot spot mutation in a mouse
model of Li-Fraumeni syndrome. Cell 119, 861-872,
doi:10.1016/j.cell.2004.11.006 (2004).
38 Olive, K. P. et al. Mutant p53 gain of function in two mouse models of Li-
Fraumeni syndrome. Cell 119, 847-860, doi:10.1016/j.cell.2004.11.004
(2004).
44
39 Manic, S. et al. Mechanisms controlling sensitivity to platinum complexes:
role of p53 and DNA mismatch repair. Curr Cancer Drug Targets 3, 21-
29 (2003).
40 Blumenschein, G. R., Jr. et al. Phase II trial of the histone deacetylase
inhibitor vorinostat (Zolinza, suberoylanilide hydroxamic acid, SAHA) in
patients with recurrent and/or metastatic head and neck cancer. Invest New
Drugs 26, 81-87, doi:10.1007/s10637-007-9075-2 (2008).
41 Kelly, W. K. et al. Phase I study of an oral histone deacetylase inhibitor,
suberoylanilide hydroxamic acid, in patients with advanced cancer. J Clin
Oncol 23, 3923-3931, doi:10.1200/JCO.2005.14.167 (2005).
42 Marchion, D. C. et al. Sequence-specific potentiation of topoisomerase II
inhibitors by the histone deacetylase inhibitor suberoylanilide hydroxamic
acid. J Cell Biochem 92, 223-237, doi:10.1002/jcb.20045 (2004).
43 Adimoolam, S. et al. HDAC inhibitor PCI-24781 decreases RAD51
expression and inhibits homologous recombination. Proc Natl Acad Sci U
S A 104, 19482-19487, doi:10.1073/pnas.0707828104 (2007).
44 Munshi, A. et al. Histone deacetylase inhibitors radiosensitize human
melanoma cells by suppressing DNA repair activity. Clin Cancer Res 11,
4912-4922, doi:10.1158/1078-0432.CCR-04-2088 (2005).
45 Zhang, Y. et al. Attenuated DNA damage repair by trichostatin A through
BRCA1 suppression. Radiat Res 168, 115-124, doi:10.1667/RR0811.1
(2007).
46 Choudhary, C. et al. Lysine acetylation targets protein complexes and co-
regulates major cellular functions. Science 325, 834-840,
doi:10.1126/science.1175371 (2009).
47 Chen, C. S. et al. Histone deacetylase inhibitors sensitize prostate cancer
cells to agents that produce DNA double-strand breaks by targeting Ku70
acetylation. Cancer Res 67, 5318-5327, doi:10.1158/0008-5472.CAN-06-
3996 (2007).
48 Sun, Y., Xu, Y., Roy, K. & Price, B. D. DNA damage-induced acetylation
of lysine 3016 of ATM activates ATM kinase activity. Mol Cell Biol 27,
8502-8509, doi:10.1128/MCB.01382-07 (2007).
49 Kovacs, J. J. et al. HDAC6 regulates Hsp90 acetylation and chaperone-
dependent activation of glucocorticoid receptor. Molecular cell 18, 601-
607, doi:10.1016/j.molcel.2005.04.021 (2005).
50 Goh, A. M., Coffill, C. R. & Lane, D. P. The role of mutant p53 in human
cancer. J Pathol 223, 116-126, doi:10.1002/path.2784 (2011).
51 King, F. W., Wawrzynow, A., Hohfeld, J. & Zylicz, M. Co-chaperones
Bag-1, Hop and Hsp40 regulate Hsc70 and Hsp90 interactions with wild-
type or mutant p53. EMBO J 20, 6297-6305,
doi:10.1093/emboj/20.22.6297 (2001).
52 Whitesell, L. & Lindquist, S. L. HSP90 and the chaperoning of cancer. Nat
Rev Cancer 5, 761-772, doi:10.1038/nrc1716 (2005).
45
53 Adorno, M. et al. A Mutant-p53/Smad complex opposes p63 to empower
TGFbeta-induced metastasis. Cell 137, 87-98,
doi:10.1016/j.cell.2009.01.039 (2009).
54 Bossi, G. et al. Mutant p53 gain of function: reduction of tumor
malignancy of human cancer cell lines through abrogation of mutant p53
expression. Oncogene 25, 304-309, doi:10.1038/sj.onc.1209026 (2006).
55 Muller, P. A. et al. Mutant p53 drives invasion by promoting integrin
recycling. Cell 139, 1327-1341, doi:10.1016/j.cell.2009.11.026 (2009).
56 Terzian, T. et al. The inherent instability of mutant p53 is alleviated by
Mdm2 or p16INK4a loss. Genes Dev 22, 1337-1344,
doi:10.1101/gad.1662908 (2008).
57 Li, D., Marchenko, N. D. & Moll, U. M. SAHA shows preferential
cytotoxicity in mutant p53 cancer cells by destabilizing mutant p53
through inhibition of the HDAC6-Hsp90 chaperone axis. Cell Death Differ
18, 1904-1913, doi:10.1038/cdd.2011.71 (2011).
46
국문요약
대장암 치료에서의 기존 항암제와 HDAC6
inhibitor 와의 combination therapy 에 대한 연구
신 동 희
연세대학교 일반대학원
약학과
탈아세틸화 효소 중에서 가장 잘 알려진 histone deacetylase 6 (HDAC6)는
cytoplasmic enzyme 으로써 생체 내의 중요한 반응들을 조절하고 관여한다.
HDAC inhibitor (HDACI)는 임상에서 암 치료에 사용 중인 여러 화학
약물들과의 병영투여를 통해 현재 굉장히 좋은 치료제로 주목 받고 있다. 이
연구에서는 γ-lactam base 의 구조를 가지고 HDAC6 를 특이적으로 억제하는
A452 를 이용하여 연구를 진행하였다. A452 는 암세포인 HCT116, HT29,
LNCaP, MCF, A549 cell 에서 세포 죽음과 성장 억제 효과를 보인 반면,
정상세포 BJ cell 에서는 그 효과를 나타내지 않았다. 또한 A452 는 대장암
세포주에서 p53 의 wild / mutant type 에 따라 다른 세포독성을 나타냈다.
이는 A452 가 서로 다른 type 의 세포에서 다른 mechanism 을 거쳐 p53 을
조절하는 것으로 예상된다 (wild type p53 을 가지는 cell 에서는 Mdm2 를
불안정하게 해서 p53 을 증가시키고, mutant type p53 을 가지는 cell 에서는
47
Mdm2 를 안정하게 해서 p53 을 감소시킨다). A452 는 대장암 세포주에서
pan-HDAC inhibitor 인 SAHA, topoisomerase I inhibitor 인 irinotecan,
그리고 DNA synthesis inhibitor 인 capecitabine 에 의해서 세포죽음을
증가시킨다. 이 약물들과 A452 와의 병영효과는 하나의 약물만 처리했을
때보다 두 약물을 같이 처리 했을 때의 PARP 의 잘린 형태를 통해서 알 수
있다. 또한 H2AX 의 phosphorylation 이 증가하는 것을 통해서 DNA
damage 도 증가시킨다는 것을 확인 하였다. 하지만 기존 약물인 cisplatin 은
A452 의 세포독성 효과를 증가시키지 않았다. 즉, A452 는 HDAC6 를
선택적으로 억제시키는 약물이고, 대장암 세포주에서 A452 의 효과는 몇몇의
약물들에 의해서 증가된다.
핵심 단어 : Histone deacetylase 6, HDAC6-selective inhibitor,
anticancer agent, apoptosis, colorectal cancer
