SARCOPLASMK RETICULUM CALCIUM ATPASE (SRCA) GENE EXPRESSION IN MYOCARDIAL BIOPSIES IN

DILATED CARDIOMYOPATHY AND SUSPECTED MYOCARDITIS:

MOLECULAR/PHYSIOLOGIC CORRELATION

Hui Mei Yang

A thesis submitted in conformity with the requKements for the degree of Master of Science

Graduate Department of The Institute of Medical Science University of Toronto

O Copyright by Hui Mei Yang 1998

National Li'brary u*d of-& BibiiiWque nationde du Canada

Acquisitions and Acquisitions et Bibiiographic Services seMces bibliographiques

395 Wellington Sireet 395. rue Wellington OtEawaON K1AON4 Ottawa ON K1A ON4 Canada Canada

Y a P & volt.rliYlries

Our NP NDbe rliiVnncs

The author has pmted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque natiode du Canada de reproduce, loan, distribute or sell reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de r n i c r ~ c h e / ~ de

reproduction sur papier ou sur format électronique.

The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fiom it Ni la thèse ni des extraits substantiels may be printed or othefwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.

Abstract

SARCOPLASMIC RETICULUM CALCIUM ATPASE (SRCA) GENE EXPRESSION IN MYOCARDIAL BIOPSIES IN DILATED CARDIOMYOPATHY AND SUSPECTED MYOCARDITIS: MOLECULAR/PHYSIOLOGIC CORRELATION Master of Science, 1998, Hui Mei Yang, The Institute of Medicd Science, University of Toronto.

In cardiac muscle, calcium uptake by the sarcoplasmic reticulum ca2+ -ATPase (SRCA) is

primarily responsible for catdiac relaxation. SRCA rnRNA has been shown to be decreased

in heart failure. To defuie the contribution of gene expression to hemodynamic status in

living patients, a pol yrnerase c hain reaction (PCR) based quantitative technique to assess

SRCA mRNA was developed Right ventricular endomyocardial biopsies were obtained

nom 11 patients with dilated cardiomyopathy and 1 1 patients wîth suspected myocarditis

and total RNA isolated. Intemal control RNA was transcribed in vitro from a synthetic

DNA containing the SRCA sequences and coamplified with target RNA in the reaction. The

mRNA levels of SRCA were correlated with simultaneous hemodynamics. Steady state

mRNA levels of SRCA of the biopsies range from 9.6 x 106 to 1.51 1 x 10' molecules 110

ng total RNA and did not correlate with left heart hemodynamics (LVEDP, Tau, dPldt and

capillary wedge pressure). In conuast, SRCA rnRNA positively correlate with right hem

pressures including pulmonary artery pressure and right ventncular systolic pressure.

Acknowledgments

This work could not have been hished without the help and support ofmany individuals.

1 would like to thank Dr. Tom Parker, my supervisor, for his excellent guidance, time and patience, encouragement, hancial support and for providing a stimulating working environment.

To Dr. Michael Sole and Dr. Peter Li y my thesis committee members, for their tirne and patience, scientik expertise and valuable comments.

To The Center for Cardiovascular Research, The Toronto Hospital and the University of Toronto for financial support.

To Dr. John Parker for generously providing the human cardiac biopsy samples and Dr. Jose Azavedo for delivering human hemodynamic data.

To Tammy Martino for providing human cardiac total RNA; and Lily Wee for her assistance in carrying out Northern blot experiments.

To Dr. J i m Tsopons for his helpful advice in statistics and Eendship; to Chris McMahon and Graham Slaughter for their technical support and friendship; to Linda Kozak for her administrative assistance and fiendship.

To Jack Liew, Dr. MinShun Zhao, Dr. Weei-Yuam Huang, Amy Hao Ly and Kem Thai for their technical advice and fnendship.

To Anne Schofield and Monica Diana for their assistance in delivering cardiac biopsies and pathological iriromiation.

To my father for his encouragement.

Finally, I would like to thank my husband James for his constant support, inspiration and understanding, and to my daughter Victoria and my son Victor for bringing me the joy and happiness of life.

List of Abbreviations

Aldo: Aldosterone

a - M H C : Alpha myosin heavy chak

ANF: Atriai naûiuretic factor

Ang II: Angio temin II

AP: Aorta pressure

BNF: Brain natriuretic factor

f3-MHC: Beta myosin heavy chah

cDNA: Complementary DNA

Cm: Congestive Heart Failme

CI: Cardiac mdex

CO: Cardiac output

CV: Coefficient variation

DNA: Deoxyribonucleic acid

dP/dt: F k t derivative of left ventricular pressure by t h e

EDTA: Ethyienediaminetetraacetic acid

FGF: Fibmbiast growth factor

GAPDH: Glyceradehyde-3-phosphate-dehydrogenase

GTP: Guanosine triphosphate

LVEDF: Left ventncular end diastolic pressure

M-MLV RT: Moloney Mirrine Leukemia Virus Reverse Uanscnptase

mRNA:

MMP 1 :

m:

PAdia:

P Amean:

P M :

PAsys:

PAWP:

PCR:

PKLB:

RA:

RAAS:

RNA:

RNase:

RT:

RV:

RVP:

RVsys:

RYR:

Sm:

Messenger ribormcleic acid

Matrix metalloprotemase 1

New York Heart Association

Pulmomuy artexy diastolic pressure

Pulmanary artery mean pressure

Pulmonaly artenai pressure

Rilmonary artery systolic pressure

Puimonary artery wedge pressure

Polymerase Chain Reaction

Phospholamban

Right atrial pressure

Renin-angio tensm-aldosterone sys tem

RibonucIeic acid

Eüinuclease

Reverse transcription

Right ventricle

Right ventricular pressure

Right ventrïcular systolic pressure

Ryanodine receptor

Sodium dodecyl sulfare

SERCA

SHR:

SL:

SR

SSPE:

TAE:

Tau:

TBE:

TGFB:

Sarcoplssmic reticuhrm dcim ATPase gene

Spontaneously hypertensive rat

sarcolemma

Sarcoplasmic retidum

Sodium chloride / sodium phosphate/ EDTA

Tris-acetate / EDTA

Time constant of left ventricular ceiaxatim

Tns-borate / EDTA

Type B tra~~sfomiing growth factor

Table of Contents

. . ........................................................................................................................... Abstract ........... .. 11

... ........................................................................................................................... Acknowledgments 111

. . ...................................................................................................................... List of Abbreviations iv

.................................................................................................................................. List of Tables .xi

. . ................................................................................................................................. List of Figures xi1

....................................................................................................... Chapter 1 : Introduction 1

.................................................................................................... ..................... 1 . 1 Background .. 1

1 .1.1 Cardiac failure .............................................................................................................. 1

1 -1 -2 Systolic and diastolic dysfunction of the heart .......................... .... ........................... 2

............................................................................... 1 . 1. 3 Adaptivc changes in heart failure 8

1.1.3.1 Cardiac hypertrophy .................................................................................... 8

............................. 1.1.3.2 Myocardial collagen matrix remodelling in heart failure 10

1.1.4 Contractile pro teins and gene expression in h y p e ~ p h i e d and failing heart .......... -12

..... 1.1 -5 Signal transduction, growth factors, pro to-oncogenes and cardiac hypertrophy 17

1.1.6 Subcellular basis of calcium movement and relaxation in myocardium ..................... 21

...................................................................... 1 . 1.7 SR caZ' transport proteins and genes 25

1.1.8 SR c~ '+-ATP~s~ gene expression during cardiac muscle development ..................... 26

............. 1.1.9 SR kc t i on and gene expression in cardiac hypertrophy and heart failure 28

1.1.9.1 Animal models of cardiac hypertrophy ..................................................... 28

1 . l . 9.1 .a Thyroid hormone-induced cardiac hypertrophy ........................ 28

1 . f .9. 1. b . Volume/pressure overload-induced cardiac hypertrophy ......... 30

.................... 1 . i . 9.1 . c. Hypertrophy in spontaneously hypertensive rat 3 2

1.1.9.2 Animal models o f heart fisilure .................................................................. 32

1.1 .9.2. a. Heart faiIure in hereditary cardiomyopathie syrian hamster ...... 32

. . ....................... 1 1.9 .2 b Heart failure by c hronic rapid ventncular pacing 33

1.1 .9.2.c Heart failme induced by dnigs .............................................. ...... 34

Cardiac gene expression during transition from compensated ....................................................................... hypertrophy to heart fdur 34

1.1.9.4 Human hypertrop hic cardiomy opathy and heart failure ........................... 36

Alterations of gene expression in animai models of acute myocardial ................................................................................................................ infarc tion 38

. . . ......................................................... ........................ Lirmtations of available human data ..,.,. -39

............................................................................................................................. Hypotheses 40

. . .................................................................................................. Aims and specific objectives 41

............................................................................................................... Chapter 2: Methods 43

2.1 Introduction of the quantitative approach used in this study .................................................. 43

2.2 H m heart biopsy sarnples ................................................................................................... 45

.................................................................................................. 2.3 Total cellular RNA extraction 45

.................................................................... 2.4 Synthetic Intend Standard DN A preparation -46

................................................................. 2.5 Subcloning of the synthetic DNA into pBluescript 47

. . ..................................................................................................... ....... Vitro transcription ... 49

. . 2.7 Removal of the DNA template foilowing in vitro transcnphol~ ............................................ 50

2.8 The intemal standard ............................................................................................................... -50

2.1 0 PCR amplincati0 il ................................................................................................................. 53

2.1 1 The specificity of the SR ca2+-~~pase primers ................................................................... 55

2.12 Determination of the ratio of sample RNA and intenial control RNA used for cDNA synthesis .............................................................................................................. 56

................................................................................ 2.13 Detennination of the exponential phase 56

2.15 Quantitative analysis of SR c~?' -ATP~s~ mRNA levels ................................

2.1 7 Northem blo t analysis of SR C ~ ~ ' - A T P ~ S ~ in rats heart . . ............................................. .................................................. after myocarchal infarc tion ..... 65

................................................................................................................ Chapter 3: Results 67

3.1 Characterization of group 1 patients with suspected myocarditis .................................... A 7

3.2 Vanability of SR ca2+-~TPase mRNA levels in duplicate biopsy samples .......................... 70

3.3 Correlation between SR ca2+-~TPase mRNA levels and clinical parameters h m ..................................................................... patients with suspected myocarditis (group 1) -70

3.4 Characterization of group 2 patients with dilated cardiomyopathy .................... ... ........... -79

3.5 Correlations between expression levels of mRNA for the SR ca2+-~TEkse and clinical parameters from patients wi th dilated cardiomyopathy ( g~oup 2 patients) .......... ... 82

3.6 Correlations between clinical parameters of group 2 patients and SR C ~ ~ + - A T P ~ S ~ mRNA levels nonnalized with GAPDH .............. .., ........................................................... 87

3 -7 Comlation between SR ca2+-~'Tpase mRNA levels and clinical parameters h m combined group 1 and group 2 patients .............. ... ............................................................ 91

3.8 SR ca2+-ATE'ase expression in infarc ted rat hearts ................................................................ 97

Chapter 4: Discussion ............................................................................. -99

4.1 The development of the RT-PCR quantitative technique . technical aspects ...................... ..99

4.2 Variability of SR ca2'-A~pase mRNA from duplicate biopsies ...................................... 102

4.3 Alterations in SR ~a~+-A'T'~ase gene expression in human heart disease . . ........................................................................................................................ O new mights 103

.................................................................................................... 4.4 Significance of this study 112

.............................................................................................. References 114

List of Tables

Table 1: Oligonucleotides of 5' primers and 3' pnmers for PCR of 3 cardiac genes ..................... 54

Table 2: Characterization of patients with suspected myocarditis (group 1, included in correlation analysis), their hemodynamic data and mRNA levels of

2+ SR Ca -ATPase.. ...................................................................................................... ..68

Table 3: Histologie findings fiom group 1 patients. ............... .. ................................................. ..69

Table 4: SR ca2' -~TPase mRNA levels in 5 duplicates of group 1 patients. .......... .... ...- -.7 1

Table 5: Characterization of patients with dilated cardiomyopathy (group 2), their hernodynamic data and mRNA levels of SR ca2+ ATPase. ........................................... 80

Table 6: Histologie hdings from group 2 patients .............................................................. 8 1

Table 7: SR ca2' -ATPase mRNA showed positive correlation with right sided cardiac pressures fkom patients of suspected rnyocarditis and dilated

.......................................................................................... cardiomyopathy. .... ..... .86

List of Figures

Figure 1: Micromanometer recordmgs of left ventricular pressure and its . . first denvative. dP/dt ................................................................... .... ................................ 5

Figure 2: Diagrammatic representation of ventricular diastolic pressure-volume relations for normal. stiff. and cornpliant ventricles ........................................................ 7

Figure 3: Schernatic presentation of sarcomere structure and the events that produce myocardial excitation-contraction coupling and myocardial relaxation ........................ 13

Figure 4: Partial schematic presentation of ce11 signaling in response to pressure-overload in the myocardium .................................................................. 1 8

Figure 5: Schematic presentation of calcium fluxes in the myocardium ..................................... -24

Figure 6: Synthesis of intemal standard by overlap extension PCR .......................................... A 8

Figure 7: Diagrammatic representation of quantitative PCR using an interna1 control RNA (CRNA) produced from a synthetic DNA .............................................. 52

Figure 8: Autoradiogram of PCR products as a function of cycle number .................................. 58

Figure 9: Plots of PCR products as a bc t i on of the number of amplification cycles ................ 59

Figure 10: Autoradiogram demonstrating quantitative PCR products ......................................... 62

Figure 11 : Quantitative PCR pmduc ts from Molecular Image System ....................................... 63

Figure 12: Quantitative analysis of SR ca2'-ATPase mRNA level in an . . endomyocardial biopsy sarnple ............. .... .......................................................... 64

Figure 13: SR cap -ATPase mRNA levels positively correlate with puimonary artery systolic pressure From patients with suspected myocarditis ........................... 73

Figure 14: SR ca2' -ATPase mRNA levels positively correlate with pulmonary artery diastolic pressure fkom patients with suspected myocarditis .......................... 74

Figure 15: SR ca2' -ATPase mRNA levels positively correlate with pulmonary artery mean pressure from patients with suspected myocarditis ............................... 75

xii

Figure 16: SR ca2& -ATPase mRNA levels positively correlate with right ventricular systolic pressure From patients with suspected myocarditis ..................................... 76

Figure 17: SR ca2+ -ATPase mRNA levels negatively correlate with cardiac output from patients with suspected myocarditis. ............................................................... ..77

Figure 18: SR ca2+ -ATPase mRNA levels negatively correlate with aortic pressure * . fiom patients with suspected myocarditis. ............................................................... ..78

Figurel9: SR ca2'-ATPase mRNA levels positively correlate with nght ventricular systolic pressure from patients with dilateci cardiomyopathy ................................... 83

Figure 20: SR ca2' -ATPase mRNA levels positively correlate with pdmonary artery diastolic pressure fkom patients with dilated cardiomyopathy ........................ 84

Figure 21: SR ca2' -ATPase mRNA levels positively correlate with pulmonary artery mean pressure from patients with dilated cardiomyopathy ............................. 85

Figure 22: SR caZ' -ATPase mRNA levels when nomalized with GAPDH positively correlate with right ventricular systolic pressure from patients with dilated cardiomyopathy ...................................................................... - 3 8

Figure 23: SR ~ a " -ATPase mRNA levels when nomalized with GAPDH positively correlate with pulmonary artery diastolic pressure from patients with dilated cardiomyopathy.. ...................................................................... 89

Figure 24: SR caZ' -ATPase mRNA Levels when nomlized with GAPDH positively correlate with pulmonary artery mean pressure h m

.................................................. patients with dilated cardiomyopathy ................ .. 90

Figure 25: SR caZ'-ATPase mRNA levels positively correlate with right ventricular systolic pressure fiom combined patients of

............................................... suspected myocarditis and dilated cardiomyopathy.. ..92

Figure 26: SR caZ4 -Anase mRNA levels positively correlate with right ventricular diastolic pressure h m combined patients of

............................................... suspected myocarditis and dilated cardiomyopathy ..93

Figure 27: SR ~ a " -ATPase mRNA levels positively correlate with pulmonary artery systolic pressure fiom combined patients of suspected myocarditis

.................................................................................... and dilated cardiomyopathy.. ..94

xiii

Figure 28: SR ca2' -ATPase rnRNA levels positively correlate with pulmomry artery diastolic pressure From combined patients of suspected myocarditis and dilated cardiomyopathy.. .................................................................................... ..95

Figure 29: SR ca2+ -ATPase mRNA levels positively correlate with pulmonary artery mean pressure h m combined patients of suspec ted myocarditis

................................................................................... and dilated cardiomyopathy.. ..96

Figure 30: Northern Blot and ethidium bromide staining of SR ~a~'-ATPase RNA in .................................................................................................... inf'arcted rat heart.. .-98

Figure 31: Schernatic presentation of proposed mode1 of SR ca2' -ATPase mRNA levels in .............. cardiac hypertrophy and failure .. .......................................................... 109

xiv

Chapter 1 : Introduction

1.1 Background

1.1.1 Cardiac failure

As the result of the improved standard of living and quality of life, the Life expectancy has

increased greatly during the past 20 years. Yet cardiovascular disease continues to be the most

serious threat to life and health in the developed world. Heart disease is the leading cause of death

followed by cancer and cerebrovascular diseases in that order. Heart failure is the end stage

consequence of a wide variety of heart diseases, notably hypertensive, coronary, rheumatic, and

congenital heart disease. Two million or more Americans (and by extrapolation 200,000

Canadians) have congestive heart failure (CHF), and the 400,000 new cases that occur yearly

require over 900,000 hospitalization each year (Kannel et al 1 99 1 & Ho et al 1 993). B ecause

cardiovascular disease accounts for nearly one-half of North Amenca's mortality and much of the

continent's morbidity, its cost to the economy is by Far the largest for any diagnostic group, an

estimated $1 10 billion in 1 984 ( Kannel et al 1986). Based on years of cardiovascular data

compiled in Framingharn, Mass, there appears to be a 1 % prevdence of C HF in individuals aged

50 to 59 years. The incidence of CHF increases with advancing age to approximately 10% of

people aged 80 to 89 years (McKee et al 1971). With an increasing geriatnc population, cardiac

failure is becoming a formidable problem. The prognosis of patients presenting with kart failure

I

is generally poor; and in several series 50% of symptomatic patients died within 12 months

(Packer 1987), a mortality in excess of common solid organ tumours. Sudden death, presumably

from ventricular arrhythmia, and progressive failure are the common modes of death. Despite the

availability of a variaty of phannacologic agents encompassing glycosides, diuretics, adrenergic

blokers, angiotensin converting enzyme mhibitors and direct acting vasodilating agents, as well as

surgical approaches such as volume reduction and transplantation, the population of patients

with CHF is continuing to increase ( Kannel et al 1994 & Cahalin 1996) and the overall impact on

rnortality has been modest. Preventive programs require early detection, treaûneuts which do not

potentiate or induce arrhythmia and are not hampered by a kequent lack of symptoms during the

early deveiopment of disease. Thus, preventive management must be employed before the heart

has exhausted its reserve and compensatory mechanisms (Kannel et al 1986). Unfortunately, our

understanding of the fundamental biology contributing to the progression of disease remains

relatively nidimentary, imposing m e r limitations on early therapeutic interventions.

1.1.2 Systolic and diastoüc dysfunction of the kart

Cardiac performance is dependent on both appropriate systolic and diastolic funchon.

With a few exceptions, heart failure is a low cardiac output syndrome characterized by systolic

myocardial dys funchon, diastolic dysfunction or both. Thus heart failure exists when the hart

fails in one or both of its primary fûnctions: 1) during systole, to propel blood into the great

vessels under increased pressure and 2) during diastole, to receive blood into the cardiac ventricles

at low pressure (Grossman 1990).

Systolic dysfunction is detined in tems of insufficiency of cardiac output relative to the

metabolic needs of the body. In the most common forms of cardiac failure (Le. following

myocardial infarction), impairment of systolic function dominates the clinical presentation. The

velocity and extent of ventricular contraction and the rate of pressure developmeat are decreased

in hart failure (Gault et al 1968, Harnby et al 1970 & Field et ai 1973). Systolic function of the

myocardium is a reflection of the interaction of' myocardial preload, afierload, and contractility

(reviewed in Grossrnan 1 986). Preload is the load which stretches myo fibrils during diastole and

determines the end-diastolic sarcomere length. For the left ventricle (LV), this load is o f h

measured as the leR ventricular end-diastolic pressure (LVEDP). Increased preload enhances the

extent and velocity of myocardial shortening. Thus, afterload is also uicreased, and this mcrease

will lessen the increases in extent and velocity of myocardial shortening due to increased diastolic

fiber stretch. Mterload is the force resisting systolic shortenhg of the myofibrils varing

throughout systole as the ventricular systolic pressure nses and blood is ejected fiom the

ventricular chamber. LV systolic stress approximates the force resisting myocardial fiber

shortenhg within the wall of the ventricle (Grossrnan 1986). An inmase in end-systolic wali

stress will result in a decrease in myocardial fiber shortening. For the intact veniricle, an increase

in afterload (end-systolic wall stress) will result in a fa11 in stroke volume and ejection fiaction.

Contractility is the level of activation of cross bridge cyclhg of the heart muscle sarcomere which

accounts for alterations on performance induced by biochemical and hormonal changes.

Since it was fint passed into the human body in 1929, cardiac catheterization has brought

an enormous reservoir of physiologic and anatornic knowledgs of heart disease; it has made it

possible to evaluate both systolic and diastolic hinction of the myocardium (Grossman 1986).

One of the most widely used measures of myocardial contractility is the maximum rate of nse of

LV systolic pressure, dP/dt. It has been shidied in humaa patients with micromanometer

catheters and found that maximum dP/dt in normal LV ranged h m 84 1 to 1696 fTlfnHg/msec

(Figure 1) (Gleason and Braunwald 1962). Exercise, infusion of riorepinephrine, isoproterenol or

atropine caused increase in dP/dt, felt to parallel changes in intrinsic muscle contractility (Gleason

and Braunwald 1962 & Bowditch 187 1). Extensive studies have been done to examineci the

influence of changes in afterload , preload and contractility on maximum dP/dt and have shown

that maximum dP/dt rises with increases in afterload and preload, but the changes are smaller than

10% in the physiologic range (Grossman et al 1 972, Wallace et al 1963, Zimpfer et al 198 1,

Broughton et al 1980 & Barnes et al 1979). Thus, peak dP/dt serves as a relative load-

independent measure of rnyocardial contractility, and by extension, systolic performance.

In several clinical senes, heart failure occurs in the absence of measurable impairnent of

systolic function and results From disordered diastolic filling. Diastolic heart failure is

characterized by increased resistance to diastolic füling of one or both cardiac ventricles. The lefi

ventricular (LV) relaxation rates, assessed by maximum rates of LV pressure deche (-dP/dt), and

the mean velocity of circderential fiber length shortenhg in early diastole are also decreased

(Grossman et al 1979). Physiologically, LV diastolic hinction is summated in the relation

between LV pressure and volume (PV) during diastole ( Grossman 1986). An upward shift in the

diastolic PV relation is regarded as increased LV diastolic chamber s t f iess and a downward shiR

Figure 1. Microminometer recordhm of kft veatricalrr pressure and ib f i rst derivative, dP/dt.

A A patient with noCm81 Ieft venîxicdar bction. Isoproterd markedy inmeases wntractüity with large increments m positive dP/dt. Atropine produces tachycardia, which results in a treppe effect and a rise in positive dP/dt above controI ( Gleason & Braunwaid 1962).

B. Methoxamine raïses arterid and LV systolic pressure, but does not ïncre85e positive dPldt. In contrast, h e combineci a and f5 adrenergic e f k t s of norepinephrine increase anth LV systoiic pressure and +dP/dt.

indicates decreased stifiess or increased LV diastolic c h b e r cornpliance (Figure 2). One of the

simplest ways of quantimg the time course of LV pressure decline is to masure the maximum

rate of pressure fall, peak -dEVdt. However, because of the load dependency of peak -dP/dt,

other indices including the time constant of LV isovolumic relaxation have been introduced. The

time constant of LV isovolumic relaxation ( T or tau) was fiat calculated by the equation (Weiss

et al 1976) :

p = A t t B

where P is the LV isovolumic pressure decline, t is the t h e after peak negative dPldt and A and

B are constants. This c m also be expressed as:

l n P = A t + B

A plot of In LV pressure versus t h e allows calculation of the slope A, a negative nurnber whose

units are sec -' . The time constant tau or T of isovolumic pressure fa11 is then defined as -UA,

expressed in milliseconcis, and is the t h e that it takes P to decline lle of its value (Grossman

1986). It is worth note that asynchrony of the relaxation process within the ventncular chamber

may result in a prolongation of T, and T is probably not completety independent of loading

conditions. However, the influence of altered loading is relatively small (Grossman 1986).

Therefore, prolonged tau may reflect slow myocardial active relaxation.

Systolic and diastolic dysfunction co-exist and contribute to the clinical presentation of

patients with heart failure, that is impairment of forward cardiac output with elevation of cardiac

filling pressures. Similarly the molecdar basis of impaired systolic and diastolic performance

may be both distinct and inter-related.

NORMAL

COMPLIANT ( t DISTENSIBILITY 1

I

VOLUME *,

Figare 2. Diagrammatic representation of venhieuiar diastoiic pressurtvolume rektions for normai, sbüf, and compliiiit ventricles. The upward or downward displacement changes of the m e are associateci with a change in venmcdar distensibiiity. If the LV diastolic PV plot shiRs upward, the LV chamber has become less distenst'ble; a higher diastolic pressure is required to fl.I or distend the chamber ofits prior volume. Similady, a downward SM in the diastolic PV plot indicates an increase in LV diastolic distensiiility. Modined fiom Grossrnan 1986.

1.13 Adaptive changes in heart fdnre

1.1 3.1 Cardiac hypertrophy

Cardiac hypertrophy refers to augmenteci myocardial mass resulting fiom predominantiy

incresed myocyte volume and is a conservai response to imposition of load on a cardiac chamber,

primady the ventricles. The developrnent of cardiac hypertmphy is a common feature that

normally precedes or accompanies the development of the clinical syndrome of heart failure. The

two most common types of mechanical cardiac stress (overload) are that resulting from an

increased resistance to ventncular emptying of increased afterload ( i-e., aottïc stenosis, systernic

hypertension, etc.), and that resulting fiom an increased preload or increased ventricular filling

(Le., aortic or mitral regurgitation, ventncular septal defkct, myocardiaI infarction, etc.)( Schlant

et al 1986). The basic response of myocardium to an increased afterload (pressure overload) is to

contract more forcefidly but more slowly. By contrast, the ventricle dilates when it is subjected

to an acutely increased preload.

The classic type of cardiac hypertrophy caused by pressure overload is termed concentric

hypertrophy in which there is marked thickening of the lefl ventricular walls (includmg the

ventricular septum), but there is no increase in the size of the lefi ventncular cavity (Schlant et al

1986). It has been suggested that the Uicreased aAerload stimulates myocardial thickening by

replication of sarcomere in parallel (Grosman et al 1983). ui concentric hypertrophy due to

pressure overload there may be special difficulties with the delivery of adequate amounts of

oxygen to the myocardial cells, particuiarly in the endocardium. Some of the factors responsible

for this include the elevated myocardial oxygen requirements and the very high mhamyocardial

pressure, which M e r impairs systolic coronary blood flow ( Vmcent et al 1974, Brazier et al

1975 & Downey et al 1975). An elevated ventricular diastolic pressure, which may be neccessary

to fil1 the hypertrophied ventride, will fiirther impede diastolic coronary blood flow to the

endocardium ( Brazier et al 1974). In addition, the growth of capillaries may be relatively less

than the growth of myocytes, and the dimision distance h m myocardid capillaries to the center

of the hypertrophied myocardial cells may be significantly increased (Honig et al 1974). Overall,

although hypertrophy has the beneficial effect of restoring wali stress toward normal and thereby

improving cardiac performance, the increased muscle mass predisposes the hypertrophied

ventncle to myocardial ischernia Furthemore, a late transition fiom "compensated"

hypertrophy to myocardial failure often occurs although its biochemical and structural basis is

still obscure. This transition to failure is clearly associated with depression of systolic

performance as well as changes in diastolic relaxation and ventricular distensibility (Grossman

1 990).

The ventricular hypertrophy induced by increased left ventrîcular preload (volume

overload) is the development of eccentric hypertrophy in which the venhicular chamber and the

left ventricular wall increase in size proportionately (Schlant et al 1986). It has been suggested

that this type of hypertrophy is produced by a chronic increase in diastolic wall stress and is

associated with the synthesis of additional sarcomeres, predominantly in series (Grossman et al

1975). Since increased preload also inmases systolic wall stress and afterload , some replication

of sarcomeres in parallel also occurs and helps to normalize systolic stress ( Schlant et al 1986).

The marked ventricular dilatation of chrcmic volume loadhg is pmduced by several mechanisais,

including an increase in individual sarcomere length, the synthesis of new sarcomeres in series and

parallel with previous sarcomeres, "slippage" between and within myofibrils and fibers, and the

rearrangement of myocardial fibers along the normal cleavage planes of the ventricle ( Bramwald

et al 1976, Ross et al 197 1, Spotnitz et al 1972, Spotnitz et al 1972, Spotnitz et al 1973, Yoran

et al 1973, Sonnenblick et al 1974, Spotnitz et al 1976, Katz 1965, MacGregor et al 1974,

Grossman et al 1983 & Meerson et al 1972). The signalhg rnechanisms that differentially

contribute to eccentric versus concentric hypertmphy are unknown.

1.1.3.2 Myocardial collagen matrix remodeliing in heart faiiure

While cardiac myocyte growth is a common denominator to left ventncuiar hypertrophy,

the accumulation of fibrillar collagen secondary to fibroblast activation contributes importantly to

myocardial mass and influences performance. Myocardial fibrosis is a diffuse perivascular and

interstitial accumulation of fibrillar collagens within the normal connective tissue structures of the

myocardium. In vivo stuclies have connmied that the growth of myocyte and non-myocyte ceUs

are independent of each other (Briila et al 1990). The hypertrophie remodelling of the

myocardiurn is either a homogeneous or a heterogeneous process, based on whether or not there

is a proportionate or disproportionate growth of the myocardial collagen matrix (Weber

et al 1987). Disproportionate growth of non-myocyte myocardial tissue, particularly the

development of myocardial fibrosis may contribute to progressive diastoiic and /or systolic heart

failure. Thus, trophic factors that promote disproportionate non-myocyte tissue growth or

collagen gene expression will lead to abnormal myocardial structure, representing a feature of

pauiologic hypertrophy with myocardial failure (Brilla et al 1995).

Previous studies have dernonstrated that the trophic factors that mediate cardiac myocyte

and fibroblast growth can be independent of one another. Cardiac myocyte growth appears to be

primady regulated by haernodynarnic stimuli while cardiac fibroblast activation with subsequent

more dependent on humoral regdatory systems, Le. hormones and growth factors (Brilla et al

1995). Several growth factors have been considered as potential growth promoters for cardiac

fibroblasts. Transforming gmwth factor f3 1, platelet-denved growth factor and insulin-like growth

factor 1 are each known to stimulate fibroblast-mediated collagen synthesis (Fine et al 1987 &

Goldstein et al 1989).

The importance of the renin-angiotensin-aldosterone system ( RAAS) in myocardial

collagen ma& remodelling in hart fadure have been studied in several models in the rat ( Brilla

et al 1990). Cardiac fibroblasts express type 1 and LI1 collagen and matrix metalloproteinase 1

(MMPI), the key enzyme for degradation of fibrillar collagem. Collagen synthesis increased

~ i ~ c a n t l y in a dose-dependent rnanner after incubation with either angiotensin II (An@) or

aldosterone (Aldo) compared with untreated control cells in cultured adult cardiac fibmblasts.

This increase in collagen synthesis in AngII-or-Aldo s thulated fibroblasts could be comple tel y

abolished by AngiI-type 1 or mineralocorticoid receptor antagonisis, respectively. In addition,

An@ significantly decreased MMP 1 activity, while Aldo had no eKect on collagen degradation

11

(Brilla et al 1994). These findings suggest that both effectm hormones of the RAAS can d k t l y

lead to collagen accumulation m culhned adult cardiac fibroblasts.

Myocardial diastolic stifiess and contractility are both increased with moderate

myocardial fibrosis; and a rnarked elevation in diastolic stiEmess is associateci with severe

fibrosis, where overali collagen volume hction is increased skfold above controis and accounts

for nearly 25% of the myocardial volume. In the Iate stage of myocardial remodelling, with

progressive myocardial fibrosis due to continued RAAS activation, systolic dysfimction appears

( Weber et al 1990). These structural alterations within the myocardial collagen ma& together

with relevant changes within cardiac myocytes explain in part why a progressive deterioration of

diastolic and uitimately systolic LV function occures that would lead to progressive heart failure

(Brilla et al 1995).

1.1.4 Contractile proteins and gene expression in hypertrophied and faiiing heart

In cardiac as in skeietal muscles, the basic unit of contraction is the sarcomere which is

composed of a diverse set of proteins working together to generate force and contraction. Two

major components of the sarcomere are the thick and thh filaments (Figure 3). Myosin is the

main component of the thick filament of sarcomere. It is a hexameric molecule that composed of

two heavy chains and four light chains. The heavy chin subunits that contam the site for

ATPase activity exist in two isoforms, alpha myosin heavy chain (a-MHC) and beta myosin

F i 3. Schematic presentation of sueomere structure a ~ d the events that produce myoeudiil excitation-conîraction coupling and myocardinl nlaution. Two major components of the sarcomere are the thick and thin filaments. The thick filaments coasist primarily of myosin, while the thui filaments are composed predominantiy of acth, tropomyosin, and the troponin cornplex. Wrili depolarization of the cardiac cell membranes, the Na+ charnels open, followed by the Ca2+ channels. The initial ûanssarcolemmai infi= of Ca2+ triggers the reiease of Ca* from the sarcoplasnic retidum- Ca? 'lm 'uigher concentration then bmds to troponin C which produces codonnationd changes in whole troponin (troponin I- troponin C-troponin T cornpiex) that relieves a troponin I interaction with actin, allowing the uderaaion of actin and myosh to produce contraaion. M: myo* A: achq Tm: tropomyosin; T: troponin T; 1: troponin 1; C: troponin C. Moaed and reproduced f?om Ilconornidis 1996.

heavy chain ($-MHC) (Lompre et al 1990 & Nakal-Ginard et al 1989). The thin filaments of the

sarcomere are composed predominantl y of act in, tropomyosin, and the troponin corn plex. The

thin filament can contain tbree actin isoforrns, a-skeletal actin, a-cardiac actin and a-srnooth

actin ( Lompre et al 1990 & Black et al 1991). Actin-activated myosin ATPase activity generates

force and leads to contraction. These isomyosin and isoactin genes are expressed differently with

ontogeny, aging, and hypertrophy, and this plays a role in the regdation of contraction ( Lompre

et a1 1 990).

Ressure and volume overload produce in the myocyte both qualitative changes,

phenotypic conversions characterized by protein isofom switches and quantitative changes

characterized by modulation of single genes through a mechanogenic transduction the pathways

of which are not fülly elucidated (Geistek-Lowrance et al 1 990, Katz 1990, Schwartz et al 1990

& Tanigawa et al 1990). The qualitative changes involve differential expression of multigene

families of contractile proteins, especially myosin heavy chain and actin.

Al1 situations of pressure overload or of combineci pressure and volume overload activ

the BMHC gene and deactivate the a-MHC one in rodent mudels. Because P-MHC is

predominant in rat fetal ventricies, the induction of BMHC in rat ventricles developed the

concept of reactivation of a fetal program with hemodynarnic overloading. In contrast, the

induction of PMHC by overload in human venûicles is not obvious because human ventricles

contain mainly BMHC under basal conditions. In rodents, the change fiom a-MHC to p-MHC

(or isomyosin V 1, the a-a homodimer, to V3, the homodimer) results in a slower rate of

ATP cycling by myosin, which fully accounts for the slower velocity of contraction of the

hypertrophied fiber. The result is an improved economy of force development ihat has d l y

been considered as adaptative ( Schwartz 1992).

Pressure overload also induces changes in the expression of the a-actin isoforms. In adult

rat, the a-cardiac actin isoform is almost exclusively present. With the onset of pressure-

overload-induced hypertrophy, the a-skeletal isoactin geue in rats is transiently upregulated, and

because it is also active in utero, the a-skeletal isoactin gene represents the second example of a

fetal program reactivation b y hemodynarnic overload (Takahashi et al 1 992, Schwartz et al 1 986

& lzumo et al 1988). It has been show that a-skeletal isoactin expression is associated with

increased contractile function in BALWc m o w hearts (Timothy et al 1994) although it is not

clear how a switch fiom a-cardiac actin to a-skeletal isoacth rnight lead to Functiond alterations

in the myocardium since the two isoactins differ by only four amino acids out of a total of 3 75

(Vandekerckbove and Weber 1979). However, three of the four amho acid diffemces found

between these two protiens occur at the myosin binding site (Sutoh 1982). Thus, it has been

postulated that a-skeletal isoactin can activate the cardiac a-rnyosin heavy chain ATPase

activity to a greater degree than cm a-cardiac actin (Timothy et al 1994), providing an adaptive

augmentation of myocardial contractility.

Interestingly, after imposition of pressure overload in the rat heart, the h e course of

upregulation of BMHC and a-skeietal actin genes is not the same. The amount of BMHC

messenger ribonucleic acid (mRNA) increases in proportion to the extent of hypertrophy and

1s

persists as long as the overload is maintaineci, but a-skeletal actin mRNA returns to control

values (Schwartz et al 1 986 & Inmio et al 1 987 ). Furthmore, during the early stages of cardiac

hypertrophy secondary to pressure overload, skeletal a-actin mRNA is detected earlier than fb

MHC mRNA and skeletal a-actin mRNA is detectable throughout the entire lefi ventncte,

wheras p-MHC mRNA is observed mainly around large coronary arteries and in the inner half of

the lefi ventricular wall ( Schiafio et al 1989). Further extendmg our understanding of alterations

in sarcomere structure, it has also been dernonstrated that smooth muscle a-actin, &

tmpomyosin, and atrial myosin light chams, each found in fetal ventricles, are similady induced

by pressure overload ( Black et al 1991 & h o et al 1988).

In addition to alterations in the sarcomere, the development of compensateci hypertrophy

in rodents has been associated with an increase in the ventricular ievels of the mRNAs encodmg

atrial natnuretic factor (ANF) to levels seen in fetal hearts (Mercadier et al 1989). ANF is one of

the fmt detectable changes in cardiac gene expression in the activation of a pmgram of early gene

expression. Unlike the absence of changes in contractile protein gene expression in human hem

disease, ANF could not be detected in normal ventricle but was abundant in fading human heart

(Feldman et al 199 1). Further studies have shown that in faihg heart, elevated expression level

of ANF negatively correlates with the expression level of SR C~" -ATP~S~ both in humans and in

rats with chronic aortic banding (Arai et al 1993, Takabashi et al 1992 & Feldman et al 1993)

suggesting that elevation of ANF gene expression in the ventricle could be considered as a

molecular marker of human heart failure (Feldmm et al 199 1).

As noted above for transitions in myosin and actin, these genetic alterations have been

viewed as initially adaptive responses to maintain myocardial hct ion and conserve energetics.

However, altematively, such transitions rnay be ultimately maladaptive. As one example, the

expression of BMHC post-infârction in the rat is associated with adverse ventricular

remodelling and impaired hemodynamic performance (Orenstein m al 1995). Perhaps, such

changes in gene expression are neither adaptive nor rnaladaptive and represent conserved

responses of myocardial phenotype to trophic signals in the absence of the capacity for ceil

division.

1.1.5 Signal transduction, growth factors, prot~ncogenes and cardiac hypertrophy

Studies from both in vivo and Ui vitro models have provided insight into the potential

signalhg pathways that might regdate cardiac genes during the development of cardiac

hypertrophy (Figure 4). The mechanisms by which the hemodynamic stress itself leads to

cardiac muscle gene program during myocardial hypertrophy are largely mknown and a cardiac

mechano-receptor temains elusive. However, it has been shown that mechanical stretch alone

induces hypertrophy and the associated pattern of gene expression in cultured neonatal rat

cardiac myocytes (Sadoshima et al 1993). In this in vitro rnodel, stretch causes release of

angiotensin II from cardiac myocytes, indicating that Ang Il may be an initial mediator of the

stretch respmse and triggers the subsequent autocrine/paracrine production of other trophic

factors and intracellular signalling pathway s (Sadoshima et al 1 993). Whether similar mechani-

17

? Catdiac Mechanoteceptor

Proto-oncogenes: eg . H-ras CAMP, PKC, Ca".

inositol phosphates. etc. \ Cell Growth 4-, Transcription Factors \ \

Nuclear Proteoncogenes: eg. c-fos. c-;un. c-myc

U biguitous and cardiac-specif ic / "Faal' Gene Expression Tmphic Factors

BMHC. skeletal and Local: TGFP1. FGFs, All, etc. smooth muscle Systemic: Catechotamines

u-actin, ANF, etc. Al I/Aldosterone

Figure 4. Partid schematic presentation of c d signaIlhg in tesponse to pressure-overioad in the myocardim. Cardiac musde is capable of expressing fetal program of genes in response to pressuce-overload. Systemic neurohumoral stimulation as wen as polypeptide growth -ors piay d e in sustaining the hypertrophic phenotype suggesting an autocrine or paracrine ktor mode1 of the hypertrophic response. Both pressure-overload and growth factor signalling is associated with activation of transcription facon which are encoded by nuclear protwncogenes and important in the reguktion of gene expression and in cardiac growth. Modined fiom Parker 1993.

exist in adult tissue remains controversial. S tretc h-mduced cardiac hypertrophy activates

multiple messemgers such as protein kinase C, tyrosine kinases and mitogen-activated protein

kinases ( Sadoshima and izumo 1993, Yamazaki et al 1993). Activated protein kinase C (PKC) is

capable of activating ANF gene regulation, indicating that PKC is one potential proximal pomts

in the signaling pathway (Chien 1992).

In addition to angiotensin II, other identifiable growth factors are produced by cardiac

non-muscle cells or by the myocytes themselves in response to hymodynamic stress, and that

these factors, through speci fic cell-surface recepton and intracelluiar mgnding cascades, regulate

transcription of gmes of the contractile apparatus, as well as others involved in ce11 growth

(Lembo et al 1995). Fibroblast growth factor (FGF) and transforming growth factor (TGFBl) are

induced by myocardial ischemia, infafction, and load (Parker 1993). Ischemic myocardiurn induce

coilateral vesse1 growth and increase TGFB in cardiac myocytes and endothelial ce11 growth

factor, a precursor of acidic FGF in arteries (Quinckler et al 1989 & Roberts et al 1990). In rat,

both TGFBl and basic FGF expression is suppressed in infarcted cardiac muscle but upregulated

in surrounding suMving myocytes which undergo compensatory hypertrophy (Chiba et al 1989

& Thompson et al 1988). Similarly, basic FGF and TGFB are hduced rapidly in catdiac muscle

cens after aortic banding (Komuro et al 199 l), and insulin-like growth factor1 and endothelin

expression are also induced by overoad (Ito et al 1992). Like h g II, these growth factors induce

hypertrophy and fetal gene expression in cardiac muscle (Parker et al 199 1 ) in keeping with an

autocrine paramine role in hypertrophy.

Cellular oncogenes are a diverse group of n o m l homologues of ûamforming vira1 genes

whose proteins participate in the cellular response to peptide growth factors and whose

mutations can transform cells in culture. The protooncogeues c-cis, crk and raf can encode for

growth factors themselves (Mulvagh et al 1988, Parker et al 199 1 8r Simpson et al 1989),

implying that the cellular oncogene pretein products are important in regulating ceIl growth.

Recent studies have provided direct evidence that the RAS pro-oncogene, a low molecular

weight GTP ( guanosine triphosphate ) binding protein, can activate the expression of the ANF

gene, a market of venûicular cell hypertrophy (Chien 1992). Expression fkom the c-Fos, atrial

natriuretic factor ( M F ) and myosin Iight chain-2 (MLC-2) promoters during phenylephnne-

induced cardiac hypertrophy requires activation of this pathway ( Thorbum et al 1995),

suggesting that G protein is part of the signalling pathway that couples the a adrenergic receptor

to the fetal gene programme. In addition to the G-protein dependent signalhg pathways, it is

apparent that other second messengers also play important roles in this response. Nuclear proto-

oncogenes whose protein products are limited to the nucleus include c-fos, c-myc, c-jun, jun B

( Parker 1993, Bilsen and Chien 1993). They can be induced rapidly by growth factors and other

phamiacologic agonists, as well as by over-expression of ras whose protein is upstream of the

signalling pathway of the cell( Parker et al 1991). C-myc, c-fos, and c-jun is re-expressed m a

variety of experimental models of cardiac hypertrophy (Mulvagh et al 1988 & Starksen et al

1 986). Induction of c-fos is required for the activation of ceil proliferation following stimulation

with growth factors (Riabowol et al 1988). These data suggest that the mduction of proto-

oncogenes is an essential feature of the hypertrophie response. Forced expression of fos and jun

20

can activate the transcription of fetal cardiac genes (Parker et al, in press). However, due to the

large number of nuclear proto-oncogenes involved, their cornplex interactions, and the diEerent

levels of ceIl fùnction that they affect, their precise role in mediahg cardiac hypertrophy in vivo

has not been established (Bilsen and Chien 1993).

1.1.6 Subcellular basis of calcium movement and relaxation in myocardiurn

The calcium ion (ca23 plays a central role in wdiac excitation-contraction coupling. The

process of myocardial relaxation is controlled by cellular mechanisms that restore cytosolic

calcium concentrations at rest to about IO-' movliter ( Ami et ut 1994). The intracellular

concentration of calcium in cardiac muscle is considered to be regdated by different membrane

systems such as sarcolemxna (SL), sarcoplasmic reticulum (SR) and mitochondria. It can be

conceived that defects in one or more these membrane systems will disturb calcium homeostasis

in the myocardial ce11 and produce cardiac dyshction ( Dhalla et al 1978).

Mitochondria are cellular organelles whose main hmction is to generate ATP through

oxidative phophorylation. They have also been shown to accumulate a large quantity of calcium

by both ATP-and respiration-dependent mechanisrns. Although many shidies have shown

impaired changes in calcium transport, calcium uptake activity and oxidative phosphorylation

activity in mitochondria From failing hearts due to different heart diseases, the exact mechanisms

of calcium tramport and the participation of mitochondria in excitation-contraction couplhg

remain to be understood ( Dhalla et al 1978).

Sarcolemma is known to be composed of basement membrane and plasma membrane. The

basement membrane contains glycoprotein and mucopolysaccharides, while the plasma

membrane is composed of phospholipids and various enzyme systems which are involved in the

regdation of ionic permerability and modulation of myocardial contractility. Both basement

membrane and plasma membrane are believed to play a crucial role m the excitation-contraction

couplhg process. Depolarization of the cardiac cell is associateci with calcium influx through

sarcolernma and calcium release h m sarcolemma1 stores and thus result in contraction, whereas,

relaxation is partly a result of calcium efflux through sarcolemma by some energydependent

mechanisms. Bidirectional exchange of calcium with cations such as Na+, C, H' and possibly

M ~ Z ' is also believed to occur at the sarcolanmal level, although the exact mechanisms in this

process are not understood. Thus, any alteration in the composition and structure of sarcolemma,

either in the basement membrane or plasma menbrane, can change caicium infimes and calcium

release, and subsequently produce abnormalities in cardiac contraction and relaxation processes

(Dhalla et al 1 976, Dhalla et al 1977, Langer et al 1 976 & McNutt 1975).

Sarcoplasmic reticulum (SR) is a tubular system which is in close contact with the

contractile apparatus (myofibril), sarcolemma as well as the transverse tubules ( T tubules)

(Dhalla et al 199 1). This membme system is considered to represent a rapidly exchangeable

calcium pool which plays an important role in heart function and metabolism. The structure of

the SR in cardiac muscle is very similar to that described in skeletal muscle. The cardiac SR is

composed of two main components: the junctional SR (terminai cisternae) and the longitudinal

tubules. A contraction-relaxation cycle is initiated when ca2' charnels are opened by

depolarization of s a r c o l m a permittmg ca2' to enter the cytoplasm. This small CC innux

induces the release of a much larger quantity of activated ca2" fkom the intracellular stores in the

SR. The released ca2' interacts with troponin C of the regdatory compiex of the contractile

apparatus to initiate cardiac contraction. Relaxation occurs as ca2+ dissociates h m the

contractile apparatus and sequestered mto the SR by the SR C ~ ~ ' - A T P ~ S ~ pump (Dhalla et al

1982 Br Hasselbach 1964 ) (Figure 5). On the basis of its remarkable ability to accumulate calcium

by energy-dependent mechanisms and to lower the intracelldar concentration of calcium to

initiate the relaxation phase of caniiac muscle, any alteration in the function of SR can be

conceived to affect the cardiac contraction-relaxation cycle.

Alterations in the regdation of mtracellular cap at any of the steps in contraction

relaxation coupling cm cause cardiac contractile dyshction and leads to failtue. The signalling

function of ~ a ' ' demands a very tow ionic concentration of ~ a " inside the myocardial cells

(about 10,000 fold lower than outside) and significant changes a n therefore be achieved easily.

During each depolarization only a very small amount of ~ a " entering the ce11 needs to be

extnided to prevent ~ a ' - overioading of the myocytes (Opie et al 199 1). The bullc of ~ a "

released from the SR must be reuptaken to its original stores (SR) in order to be released during

the next contraction relaxation cycle. Membrane sy stems regulating the intracellular ca2' have

either a low or a high ~ a " afflliity, thus s e h g different purposes in the various phases of the

cardiac cycle (Carafoli et al 1985).

Figure i Schematic presentation of d u m finxu in the nyooudium. The depolarhion of the cardiac ceii membranes induces the opening of the Na' channeis and the Ca* charnels. The initial ~anssarwlernmal i n f h of Ca? triggers the release of Ca" fiom the sarcoplasnnc reticuium Relaxation is initiateci by active uptake of Ca2+ by the SR Ca2 '-ATPase, which is under the control of phospholamban. Most of the fiee calcium that is responsible for contraction is reieased fiom the sarcoplasmic reticulum. During relaxation, Ca* e88w may ocnir botb by Cah-ATPase and by a Na+- c$* exchanga. Mitochondria mi@ acî as a "briffer" against excessive changes in the fkee cytosoiic dcim concentraton SR = sarcoplasmic retidum; MIT0 = mitochondria Modifieci and nproduced h m Opie 1984.

1-13 SR ca2+ transport proteins and gens

The contraction and relaxation of cardiocytes are regulated by inhacellular calcium

concentrations, which, in hini, are controlled primarily by the release and reuptake of ca2' by the

SR ln ment years, the major SR proteins controlling ~ a 2 ' uptake, storage, and release have been

isolated, and sequencing of complementary DNA (cDNA) encoding them has provided the

deduced amino acid sequences (Lytton et al 1 99 1 ). The contraction of cardiac myocytes is

triggered mainly by ~ a ' + release fhxn the SR through calcium release channels, also r e f d to as

the ryanoâine receptor (RyR) (Fleixher et al 1989) and the inosital 1.4,s-triphosphate receptor

(fP3R)( Furuichi et al 1989, Marks et al 1990 & Moschella et al 1993). Three distinct isofonns of

Ca'- release c h e l (RyR) have been described by cDNA cloning (Takeshima et al 1989, Marks

et al 1989, Zotzato et al 1990, Otsu er al 1990 & Coronado et al 1994). The cardiac ryanodine

receptor (RY2) mRNA is unique to hart muscle and is not expressed in fast- or slow-twitch

skeletal muscle ( Zorzato et al 1990 & Arai et al 1992).

Muscle relaxation is initiated by Amdependent aanspoa of ~ a ' - uptake into the SR

Five distinct C a ' - - ~ ~ ~ a s e iso forms encoded by three different genes (SERC A 1, SERCA2, and

SERCA3) have been identified: the adult fast-twitch skeletal muscle isoform (SERCAla)( Brandl

et al 1987). its alteniatively spliced neonatal isoform (SERCAlb)(Bra.mil et al 1987 & Brand et

al 1986), the cardiac/slow-hvitch skeletal muscle isofom (SERCA2a)('acLennan et al &

Zarain-Hetzkg et al 1 990 ), its altematively sp iiced smooth muscldnonmuscle

isoform(SERCA2bXde la Bastie et al 1988 , Lytion et al 1988 & Lytton et aI 1989) and an

isoform expressed in a broad variety of muscle and nonmuscle tissues (SERCA3) (Burk et al

1989 ). Ln cardiac muscle, the SERCA2a isoform is primarily expressed, both in the atrium and

the ventncle (Arai et al 1993). The relaxation mechanisms inclu.de calcium extrusion through the

sarcolemma by sodium-calcium exchange and sarcolemmal calcim pumps, but the most

important one is uptake of cytosolic calcium through the SR ca2 ' -~~pase.

The function of SERCA2a is inhibited by its interaction with a regulatory

phosphoprotein, phospholarnban, but inhibition is relieved by both cyclic AMP (CAMP) and

calmoduiin-dependent phosphorylation of phospholamban (Tada et al 1982). Phospholamban is

encoded by a single gene, and the same protein is expressed in cardiac and slow-twitch skeletal

muscle tissues (Fujii et al 1988).

ca2* inside the SR membrane is stored at a high concentration, which is due to binding

with a number of ca2*-binding proteins in the lumen of the SR: calsequestrin and calreticdin

within the junctional SR and glycoproteins of 53 and 160 kD (1 30 kD in cardiac muscle) within

the longitudinal SR ( FIiegel et al 1989, Campbell et al 198 1, Michalak et al 1980 & Leberer et al

1989). Calsequestrin, a high-capacity, moderate-affity ca2+ binding protein, is the major

determinant of the ca2+ storage capacity of SR. Two distinct isoforms of calsequestrin have been

identified, the skeletal muscle isofonn being expressed in both fast- and slow-twitch fiben and

the cardiac isoform king expressed exclusively in the cardiac muscle ( Fliegel et al 1987, Scott et

al 1988, Arai et al 199 1).

As noted previously, acute as well as chronic forms heart failure involve mechanical

dysfunction during systole andlor diastole. The rapid ~ a " release from and cal' reuptake into

SR are processes that critically detennine normal systolic and diastolic myocardial function.

Calcium uptake by the SR is the main mechanism responsible for cardiac relaxation. The SR ca2'

pump can be considered to be the transport system that presides over the rapid and fme

regulation of intraceilular ca2' linked to the contraction/relaxation cycle and a potential site for

pathologie regulation in cardiac hypertrophy and failure.

1.1.8 SR C P ~ + + - A T P ~ S ~ gene expression during cardiae muscle development

The expression levei of the SR c ~ ~ ' - A T P ~ s ~ during cardiac muscle development had been

studied in animal models by use of gene-specific probes (Arai et al 199 1,1992 & Nagai et al

1989). The SERCA2a is the primary isoform in developing atrial and ventricular muscle (Ami et

al 199 1 & Nagai et al 1989). The level of SERCA2a transcript gradually increases with cardiac

muscle development, but there is no isoform switching during cardiac muscle development The

cardiac muscle also transcribed trace amounts of SERCA2b ( the smooth muscle/nonmuscie

isoform). However, its expression level does not change significantly with development (Arai et

al 1992 & Lytton et al 1989). It has also been observed that at the end of fetal life and in the

early postnatal period , the amount of SERCA2a mRNA increases and remains in a stable high

level during adulthood (Lompre et al 1991). Therefore, during cardiac muscle development,

cardiac growth requires quantitative modulation of the expression level of a single isoform

(SERCMa), but no isoform changes.

1.1.9 SR function and gene expression in cardiac hypertrophy and heart failure

1.1.9.1 Animal models of cardiac hypertrophy

1.1 .9.l.a. Thyroid hormone-induced cardiac hypertrop hy

A number of studies have emphasized the importance of alterations in myocardial

contractility and relaxation that occur during cardiac hypertro p hy and failure. These alterations

have been reported in several animal models which have been developed to study both the

process of cardiac hypertrophy and the underlying mechanisms altering cardiac performance.

Thyroid hormone-induced cardiac hypertmphy is a weil-defined experirnental modei used to

investigate mechanisms altering cardiac function. Thyroid hormone-induced cardiac hypertrophy

is associated with an increased rate of tension development and an enhanced velocity of tension

decline (MaciCinoon & Morgan 1986 , HesenfÙss et al 199 1, Skelton et al L 976, Alpert et al

1986, Conway et al 1976 & Goodkind et al 1974). Although some of these changes in contractile

properties cm be attnbuted to changes in myosin heavy chah expression as manifest by

augmented a-MHC transcription ( Schwartz et al 1983 ), recent studies have indicated that the

ca2' cycling function of the sarcoplasmic reticulum is also altered in this model of hypertrophie

cardiac muscle. It has been reported that the rate of ca2*uptake and the rate of ca2+dependent

ATP hydrolysis by the SR is significantly increased in hypeahyroidism (Suko 1973). Moreover,

intracellular ~ a " transient measurement using calcium-sensitive bioluminescent assays has

28

demonstratecl that hyperihyroid state results in a rapid calcium release and reuptake, apparently

without altenng the peak level of fiee cytoplasmic ca2+ during contraction (MacKinoon et al

1986 & Beekman et al 1988).

Several other studies have shown that thyroid hormone significantly increases the mRNA

levels of ryanodine receptor and SR ~ a ~ ' - ~ ~ ~ a s e , which is in parallel with the ca2+-~TPase

protein level, suggesting that the increase in the ca2'-~'Pase is accompanied with the

upregulated gene expression but without switch From cardiac ca2'-~TPase (SERCA2a) to fast-

hKitch skeletal ~ a ' + - ~ ~ ~ a s e (SERCAl a) (Nagai et al 1989, Rohrer et al 1988 & Arai et al 199 1).

The levels of mRNA encoding the SR C ~ ~ + - A T P ~ S ~ has been shown to be increased, whereas the

phospholamban rnRNA levels to be decreased in the ventricles obtained From hyperthyroid

rabbits (Nagai et al 1989). Another study using primary isolated neonatal rat myocardial cells

incubated with triiodo thyronine (T3) has shown that T3 decreases phospholarnban mRNA levels

to about a half of control in 24 hours, whereas SR c~ '+-ATP~s~ mRNA gradually increases with

time. The same study has also shown that T3 increases Vmax of ~ a " uptake, indicating that

thyroid hormone stimula tes C~" -ATP~S~ but also decreases phos pholarnban (Kirnura et al

1994). interestingly, both hyperthyroid and hypothyroid hearts have no effect in the expression

levels of calsequestrin ( Arai et al 1991), suggesting that in response to thyroid honnone level, the

genes encoding SR ~ a " transport proteins are regulated in a discordant manner. These results

demonstrate that alterations in SR functions are primarily due to the altered expression of genes

encoding SR proteins in this model. It is also important to emphasize that the induction of

hypertrophy by thyroid hormone results in a phenotype distinct h m that induced by load, with

the absence of fetal genetic reprogranmiing.

1.1.9.l.b. Volumdpressure overload-induced cardise hypertrophy

Alterations in SR function and its ca2+-~'T'pase gene expression have also been

extensively studied in volurne/pressure overload-induced cardiac muscle hypemophy. In

pressure-overload hypertrophy in rats induced by abdominal aortic constriction, the function of

SR as assessed by the oxalate-stimulated caZ' uptake is decreased. This decrease is accompanied

by a parallel reduction in the number of functionally active c a 2 + - ~ ~ p a s e molecules, as

determined by the level of ~a-dependent phosphorylated intexmediate (Limas et al 1980 ). In

pressure overload-induced cardiac hypertrophy by pulmonary artery banding, the ATP-

dependent ~ a " uptake and the expression levels of SR ca2' -ATPase, ~a"-release channel

(ryanodine recep tor), phosp holamban and calsequestrin are decreased significantly (Matsui

et al 1 995). In the descending thoracic aorta banding adult guinea pigs, the rates of ca2' uptake

and the affinity of SR C ~ " - A T P ~ S ~ for ca2+ are significantly depressed and these changes are

associated with depressed protein levels of the SR ca2+ -ATPase and phospholamban assessed

by quantitative immunoblotting ( Kiss et al 1995).

However, different degree, acuteness or duration of hemodynamic Ioads can produce

various types of cardiac conditions and gene expression. There is no changes in the concentration

of c ~ ~ ' ' - A T P ~ s ~ mRNA and protein in miid hypertrophy but a significant decrease in severe

hyperiiophy (de la Bastie et al 1990 ). There is a enhanced calcium transport by sarcoplasmic

30

reticulum in mild cardiac hypertrophy induced by pressure overload in rat (Limas et al 1980 ) and

a 20% increased SR ca2' -ATPase activity in mild cardiac hypertrophy induced by volume

overload in turkeys ( Shen et al 1991). Another study ushg the pressure overload-inducecf rat by

abdominal descending aorta banding has shown that the cardiac Ry2 mRNA concentration is

decreased by 50% in severe hypertrophy but not in mild hypertrophy; and both the density of

the high-affiity sites and the Ry2 protein level are decreased by 25% (Rannou et al 1996). Most

recently, in cardiac hypertrophy produced in rats by supraremal abdominal aorta constriction,

C ~ ~ ' - A T P ~ S ~ and Ry2 mRNA levels are increased in rnildly hypertrophied hearts but are

diminished in severely hypertrophied hearts; and ca2+ uptake capacity shows similar changes

along with a positive correlation with ca2+-~TPase mRNA level. In contrast, the level of

calsequestrin mRNA expression is unaltered and that of a-actin is markedly increased ove^ a

range of severity of cardiac hypertrophy ( Arai et al 1996). These hdings suggest that the

expression of SR genes for ca2' uptake and release is up- or down-regulated dependent on the

degree of pressure overload or the magnitude of the cardiac hypertrophie response. These studies

in the voldpressure overload-induced cardiac hypertrophy fiuther suggest that the myocardial

response to load does not involve the uniform down-regdation of sarcoplasmic reticulum ~ a " -

ATPase to the lower levels seen in fetal ventricles but may be bimodal with initial upregdation

by load and dowmegulation at later the-points.

l.l.9.l .c. Hypertrophy in spontaneously hypertensive rat

The spontaneously hypertensive rat (SHR) is another frequently used model in the

study of cardiac hypertrophy. The SHR develops cardiac hypertrophy before the onset of

hypertension suggesting that cardiac hypertrophy in SHR is not entirely due to hemodynamic

overload (Sen et al 1974). A lower resting ca2+ transient and a prolonged tirne to peak ca2"

transient have been reported in the spontaneously hypertensive rat ( Bing et al 199 1) even

though the involvement of the alterations of SR gene in the development of abnomal ca2' cyclmg

stiII remains to be established.

1.1.9.2 Animal models of heart failure

1.1.9.2.a. Heart failure in hereditary cardiornyopathic syrian hamster

The hereditary cardiomyopathic syrian hamster is the most widely used model to study

the alteration of ~ a " cycling in cardiac failure (Bajusz et al 1969). It has been observed that the

velocity and capacity of caZ' uptake are dramatically diminished in hereditary dilated

cardiornyopathic hamster; but the ratios of ca2' uptake velocity to capacity, an estimate of the

functional capability of the SR C ~ ~ ' - A T P ~ S ~ are not changed suggesting a decrease either in the

volume of SR or in the number of SR C ~ ~ ' - A T P ~ S ~ pump sites, with no changes in specific

activity of the C ~ " - A T P ~ S ~ enzyme in cardiomyopathic hamsters (Whitmer et al 1988). Another

study demonstrates that the density of ryanodine receptors was increased in SR h m

cardiomyopathie hamster hearts early in the development of cardiomyopathy, suggesting an

increase in the amount or velocity of ca2' release from SR may contriiute to the development of

ca2' overload in this model of cardiomyopathy (Sepp et al 1994).

1.1.9.2.b Heart failure by chronic rapid ventricular pacing

Heart failure induced by chronic rapid ventricdar pacing is a good mode1 to study the

relation between the mechanical properties and ca2' handling m the failing heart. A defect m ca2'

handling has been shown in this animal model. A study using dogs with congestive heart failure

produced by either rapid ventricular pacing or dilated cardiomopathy demonstrates that activities

are decreased by 36% for the SR ~ a ~ ' - ~ T P a s e pump, 78% for the ca2' release channel

(ryanodine recep tor) and 53% for total ca2+-cycling (Cory et al 1994). S tudy in dogs with heart

failure induced by nght ventricular pacing has shown that at early heart failure, there is decreased

activity of the SR ca2' release channel (O'Brien et al 1994), a 50% decrease in activity of the

myocardial SR caZ' pump and a 75% reduction in SR caZ+ release channel activity (Cory et al

1993). The SR c~'--ATP~s~ activity and SR caZ4 uptake are diminished to half of that of the

control muscle. Importantly, the decrease in SR C~''-ATP~S~ activity is correlated with left

ventricular ejection fraction, an index of degree of myocardial failure (O'Brien et al 1990).

1.1.9.2.c Heart fdure induced by drugs

hg-provoked severe kart failure is another mode1 which demonstrates the abnomal

intracellular ca2' accumulation and decreased SR C ~ " - A T P ~ S ~ activity. A significant decrease in

SR ca2'-~Pase activity has been shown in chronically adrninistered adriamycin

cardiomyopathy in dogs ( Olson et al 1974 , Tomplison et (11 1985 & Kusuoka et al 199 1).

Chronic diabetes due to streptozotocin administration has been shown to induce heart

dysfunction characterized by prolonged relaxation tirne as wetl as decreased ca2' transport and

ca2-~TJ?ase activity; but no significant reduction has been found m the relative levels of SR

C ~ " - A T P ~ S ~ mRNA expression and SR c ~ ~ + - A T P ~ s ~ protein (Zarain-Herzberg et al 1994).

These data indicate that abnomial ca2' cycling exists in cardiac hypertrophy and heart failure

induced by drugs and is one of the important causes of cardiac dysfunction.

1.1.93 Cardiac gene expression during transition from compensated hypertrophy to heart failure

After the initiation of hernodynamic stress, the heart undergoes adaptive changes such as

preservation of systolic pressure development and the extent of muscle shortening , a decrease in

the maximum velocities of shortenhg and lenghtening of the muscle and a slowhg of relaxation

(Jouannot et al 1975, Lecarpentier et al 1982, Lecarpentier et al 1987, Lorell et al 1987 & Fifer et

al 1986). Cardiac hypertrophy is widely recognized as an adaptive response that nomializes wall

stress and compensates for an increased load (Gmssman 1980). When the load is chronically

persistent, compensated hypertrophy may progress to heart failure. The mechanism that

contributes to the transition €rom compensated cardiac hypertmphy to heart failure has remained

unknown. There is evidence to suggest that a loss ofkontractile proiein from the myocardium

may contribute to the impaired cardiac function in failhg heart ( Pagani et al 1988). In aging and

hypertension, however, myocyte loss due to myocardial ce11 death and hypertrophy of the

remaining viable myocytes has been proposed to account for irnpaired function and failure

(Anversa et al 1986, Capasso et al 1990 & Engelmann et al 1987).

Alterations in cardiac gene expression during the transition from stable hypertrophy to

heart failure have been studied using spontaneously hypertensive rats with heart failure (Sm-F)

and without heart failure(SHR-NF) (Boluyt et al 1994). This study has documented a significant

loss of a-MHC mRNA from both ventricles of failing hearts, with no significant change in

MHC mRNA levels; a biventricular increase in ANF mRNA levels but no increase in levels of a-

skeletal actin mRNA; a threefold to fivefold increase in fibronectin and collagen mRNAs in both

ventricles but no significant decrease in SR ~a''-~'T'~ase mRNA levels in either ventride during

the transition to failure though SR C ~ " - A T P ~ S ~ mRNA levels has decreased 24% in RV in SHR-

NF compared to control. By contrast, a study using two distinct groups of rats 20 weeks after

aortic banding (20-week nonfailed left veninclular hypertrophy and 20-week failed left

ventriclular hypertrop hy ), has s hown that when compared with the age-ma tc hed control group,

PMHC mRNA increases greater than twofold, ANF mRNA level increases about sixfold in lefl

ventricular myocardium of both gmups (Feldman et al 1993). Of importance in this shidy is the

finding that SR c a 2 - ~ ~ p a s e mRNA levels has decreased by 50% only in the lefi ventricular

rnyocardium of rats with cardiac failure but not in rats of nonfailed le ft ventricular hypertrophy

group. These studies suggested that the expression levels of SR ca2' transport gene are not

related exclusively to imposition of load; and the pattern and regdation of cardiac gene expression

(specifically SR ca2'-~TPase gene) during the transition From compensatory hypertrophy to

heart failure may be model-dependent and the potential for smiilar transitions in human beings

remain to be elucidated.

1.1.9.4 Human hypertrop hic cardiomyopat hy and heatt f d u r e

The SR ~ a " transport Function in failing human hearts has also been studied. ca2' cycling

in cardiac muscle can be assessed by bioluminescent ca2' indicaton a e q u o ~ or hua (Gwathwey

et ni 1987, Beuckelrnam et ai 1992 & Morgan et al 1990 ). Tension-independent heat is

considered to result from the energy consumed for ~ a " transport in cardiac muscle and can be

used to estimate the ~ a " uptake rate. Dilated cardiomyopathie muscle has shown increased

resting [ ca27 i levels, decreased peak [ ca2' ] i levels, slower rise and slower decline of CC

transient and a 50% reduction of ca2' uptake rate, indicating that the calcium release function and

calciirm uptake (sequestenng) function are impaired in human heart failure ( Gwathmey et al

1987, Morgan et al 1990 & Hasenfuss et al 1992 ).

In recent years, the major SR proteins controllhg ca2+ uptake, storage and release have

been defined. Molecular cloning has provideci sequences of the genes encoding SR protehs.

36

Analysis of gene expression level has observed that the messenger RNA(mRNA) for ca2'-

ATPase is rnarkedly decreased by 48% in leR ventricular specimens of patients with heart failure

undergohg heart transplantation (Mercadier et al 1990 ). Another stuây using failing humau

hearts from cardiac transplant recipients with a diagnosis of dilated cardiomyopathy, pnmary

pulmonary hypertension, or ischernic heart disease has demonstrated that the expression level of

mRNA for ca2'-~TPase is inversely correlated with brain natriuretic factor (BNF) and atrial

natriuretic factor (ANF) mRNA level which has been s h o w to increase in moderate heart failure

and to be highest in severe human heart failure (Arai et al 1993). However, other studies have

s h o w that in temminally failing human myocardium resulting fmm dilated cardiomyopathy and

ischemic cardiomyopathy, ca2' uptake activity, c a 2 ' - ~ ~ p a s e activity and the expression levels

of SR ~ a " -ATPase and phospholamban are decreased significantly, whereas both SR ca2' -

ATPase and p hosp holamban protein levels are unchanged in failing compared wi th nonfailing

tissues (Schwinger et al 1 995, Flesch et al 1 996 & Linck et al 1 996). These data may M e r

suggest that an alteration of the SR c~ '+-ATP~s~ activity contributes to an altered intracellular

~ a ' ' handling and myocardial relaxation in human heart failure; and the changes in SR caZ*-

ATPase and phospholamban steady-state protein levels may not contribute to these alterations.

The dissociation between protein and mRNA levels may provide evidence for a post-

transcriptional or post-translational regulation of these proteins.

Other studies have examined the expression Level of phospholamban in human hart

failure. Phospholamban rnRNA level is reduced in kart failure caused by dilated

cardiomyopathy, coronary artery diseaase and primary pulmonary hypertension. Impor*intly,

this reduction is in parallel to that of ~ a ~ ' - ~ ~ ~ a s e and is inversely correlated with the ventricular

ANF mRNA level (Ami et al 1993 & Feldman et al 199 1 ) . Analysis of the levels of cardiac

ryanodine receptor mRNA has shown a decrease in end-stage heart failure c a w d by coronary

artery disease, primary pulmonary hypertension but decreased or unchanged levels of mRNA in

dilated cardiomyopathy ( Arai et al 1993 & Brillantes et al 1992). In addition, the same study by

Arai et al ( Arai et al 1993) has demonstrated that the decrease in the mRNA of ryanodine

receptor is in parallel to that of cd+-~TPase and phospholamban, and the mRNA level of

ryanodùie receptor is invenely correlated with that of ANF M A . It has been shown that the

two cardiac intracellular calcium release channels were regulated in opposite directions in end-

stage hart failure: RyR mRNA levels are decreased by 3 1% whereas IP3R mRNA levels are

increased by 123% (Loewe et al 1995). However, in hart failure caused by dilated

cardiomyopathy, coronary artery disease, or primary pulmonary hypertension ,there is no

signScant change in the level of calsequestrin mRNA (Ami et ai 1993 & Takahashi et al 1992).

These data indicate that except calsequestnn, the expressions of c~''-ATP~s~. phospholamban

and ryanodine receptor are coordinately regulated in human heart failure (Ami et al 1993). Taken

together the bulk of the current literature support a downregulation of SR ca2+ - ATPase activity

and/or gene expression.

1.1.10 Alterations of gene expression in animal models of acute myocardial infarction

Coronary artery ligation in rats has been widely used to examine the cardîac phenotype

38

and remodelling after acute myocardial mfarction. Acute myocardial mfarction is associated with

enhanced expression of insulin-like growth factor 1 and insulin-like growth factor 1 receptor

which may activate genes essential for the reconstitution of tissue mass ( Reiss et al 1994).

Myocardial ùifat-ction is also accompanied by over-expression of angiotensinogen gene,

angiotensin II receptor , c-myc, c-jun and ANF (Lindpaintner et al 1993, Reiss et al 1993 &

Kanda et al 1993). Post-infarction PMHC is re-expressed persistently out to day 35 and

strategies for BMHC downregulation are associated with improvements in myocardial

performance (Orenstein et al 1995). It has recently been reported that skeletal a-actin gene is

re-expressed in rat myocardium at 7 days post-infarction, but subsequently down-regulated at

&y 7 accompanied by the induction of S 100B, a protein normally expressed in brain (Tsoporis

et al 1997, in press ). These data suggest that post-infarct cardiac myocytes undergo phenotypic

changes involving cellular hypertrophy and gene re-programmùig which is comparable to the

hypemophic response of the hart to acute pressurelvolume over-load. In addition the post-

infarct mode1 allows analysis of the temporal sequence of gene expression in association with

progressive ventricular remodelling and the development of systolic and diastolic myocardial

dysfuntion, and the analysis of differences in gene expression between left and nght ventricle.

1.2 Limitations of available human data

Studies to date on buman cardiac hypertrophy and heart Failure involve myocardium

39

procured at post-mortem or from the recipients undergoing cardiac transplantation or hearts

subject to hi& dose of therapeutic medication, reflecting exclusively end-stage or agmal diseased

myocardium. Studies on human with mild cardiac hypertrophy and kart failure and during

transition €mm cardiac compensation to decompensation are currently lacking. Furthennore, the

unavailability of large pieces of cardiac tissure has been the essential limitation to study the

molecular biology of human heart failure in living patients. The ability to study gene expression

in myocardium from intact living human beings, at an earlier stage of heart failure, will provide

better understanding of human heart failure, contributions of altered gene expression to

progression of disease, and possibly provide means to monitor the response to therapeutic

interventions.

1.3 Hypotheses

The quantitation of low abundance of mRNA cm be achieved by quantitative PCR by

using a synthetic RNA as an intemal standard. This method is sensitive and accurate. The

hypotheses of this study are:

(1) A quantitative PCR method wili provide a suitable way to quanti@ the amount of

SR caZ' -ATPase mRNA in a myocardial biopsy sample.

(2) Altered expression of SR c~''-ATP~s~ in living human patients with heart failure

correlates with hemodynamic rneasures of cardiac systolic and diastolic performance.

1.4 Alms and specifk objectives

Cardiac adaptation to hemodynamic stress involves both quantitative (hypertrophy) and

qualitative (pattern of gene expression) changes. Previous studies have provided evidence that

SR ca2''-~~I?ase gene expression levels is altered m cardiac hypertrophy and heart failure both in

experimmtal animal models and in human beings. However, experiments on animal models have

documenteci dissimilar patterns of SR c~*'-ATP~s~ gene expression during transition nom

compensated hypertrophy to decompensated heart failure. It is unclear whether these changes

happen in humans. Sample unavailability has made it unachievable to monitor the changes of gene

expression in different stages of human cardiac hypertrophy and heart failure. Myocardial

infarction in rats induced by coronary artery ligation has been shown to result in phenotypic

transitions, cardiac hypertrophy and utimately congestive heart failure. Alteration in SR ca2'-

ATPase gene expression after myocardial infarction has not been studied The specific objectives

of this study are to:

1. Develop a PCR based strategy to quantitate cardiac specific gene expression, specifically,

the SR C ~ " - A T P ~ S ~ gene expression as assessed by steady-state mRNA levels in

myocardial biopsy samples from patients with suspected myocarditis and dilated

cardiomyopathy .

2. Evaluate possible correlations between SR C~"-ATP~S~ gene expression in living human

being with concorni tant phys iologic rneasurements of myocardial systolic and diastolic

performance.

3. Assess the steady state levels of SR ca2'-~Pase mRNA using Northern blot analyses

post myocardial infarction in rats.

Chapter 2: Methods

2.1 Introduction of the quantitative approach used in this study

A number of methodologies ( Le. dot blots, in situ hybridization, Northem blotting) have

been used for the detection and quantitation of mRNA levels. However, if target mRNAs are

present in relatively low abundance or large quantities of s t h g materiai are unavailable, these

methods might not be ~ ~ c i e n t l y sensitive to reprodicibly ensure mRNA detection and

quantitation. The Polymerase Chain Reactim (PCR) is a powemil molecular biological tool that

allows a small quantity of DNA to be amplified. It is by far the most sensitive known method to

detect gene expression. This technique invoives enzyrnatic amplification of nucleic acid sequences

via repeated cycles of denaturation ( double-stranded DNA separated at a high temperature),

oligonucleotide annealing ( two convergent DNA primers anneal to opposite strands of the target

DNA at low temperatures), and DNA polymerase extension (extension of the annealed primer

along the DNA strands at 72Oc by the heat-stable Taq polymerase in the presence of excess

DNA triphosphates)( Mullis et al 1986 & Saiki et al 1988). However, in rnost instances, the PCR

technique had only provided qualitative results. The availability of quantitative PCR should

provide valuable method to quantiQ the amounts of specific -As in small quantities of

tissue.

The application of RT-PCR (reverse transcriptase-polymerase chah reaction) makes it

possible to analyze srnall numbers of mRNA in a limitai amount of tissue, that is, isolation and

purification of small quantities of RNA, reverse transcription of RNA to complementary DNA

(cDNA) and the PCR for amplification of srnall quantities of cDNA. It has been diffîcult to

quantitate the absolute amount of specific mRNA without an intemal standard of known

concentration. The literature describes a number of approaches to the quantitation of PCR

product ûriginall y, attempts to quantitate PCR amplification of mRNA sequences have invo lved

the use of a relatively invariant mRNA such as Bacth or an unrelated template as an interna1

standard ( Chelly et al 1988 & Rappolee et al 1988). However, this approach provides only

comparative data, in part because of differences in eficiency between the primer pairs for the

standard and the target mRNAs. Altematively, quantitative PCR cm be done by generating an

allelic variant ( e.g., a small deletion or insertion in the gene of interest) such that there is a mal1

difference in the size of the PCR product of this intemal standard and the PCR product of the

native mRNA. Another method that would permit distinction between the PCR products of the

standard and target RNAs is to mate a restriction enzyme site in the target gene ( Wang et al

1989). However, these approaches require that a new standard be constmcted for each target

gene.

In selecting a methodology for the quantitation of cardiac specific mRNAs, efforts have

been made to fùlfill a number of criteria and overcome problerns associated with the methods

descnbed before. The method would be required to control for cDNA synthesis and PCR

reaction, to produce a standard curve and to aliow quantitahg multiple genes of interest. In this

study, an approach fint described by Wang et al ( Wang et al 1989) was selected. A DNA

44

template £km which an RNA molecule with the same primer binding sites as the target RNA

molecule could be transcribed is first consûucted. The target RNA and this intemal standard were

reverse-hanscnbed then coamplified incorporating a radiolabeled nucleotide. Gel slices containhg

the PCR pmducts were subjected to Cerenkov counting or analysis by a computerized phospho-

imager. The amount of target mRNA in the sample was quantitated by extrapolating against a

standard c w e generated with the same intemal siandard.

2.2 Human hart biopsy samples

Endomyocardial biopsies were obtained at the time of diagnostic procedures from right

ventricles of patients with suspected myocarditis (1 1 patients, group 1 ) and dilated

cardiomyopathy (1 1 patients, group 2). Following infonned consent, samples of group 1 patients

were pmcured at The Toronto Hospital, patients' ages ranged from 4 to 74 years ( mean age 41.3

years, fmale = 9, male = 2). Biopsy samples of group 2 patients were obtained kom

Cardiovascular Clinical Research Laboratory, Mount Sinai Hospital, Toronto, Ontario, and

patients' ages ranged h m 3 1 to 76 years (mean age 48.5 years, fernale%, male=S). After removal

h m the heart, biopsy samples were immediately fiozen in liquid nitrogen and stored at -80°C

until used.

2.3 Totai cellular RNA extraction

Total cellular RNA was isolated fkom the fkozen myocardial biopsy sample ushg a

45

modification of the acid guanidiniiimi thiocyaaate/pheno~chlomfomi extraction (Chornczynski &

Sacchi). The hzen tissue was homogenized in 1.3 ml of fresh made RNazol( 4 M guanidiniurn

thiocyanate, 25 rnM sodium citrate, pH7,0.5% sarcosyl, 0.1 M B-mercaptoethanol, 0.2 M

sodium acetate, pH4 and 0.5 volume of phenol) using a tissue grind pestle (sz22 , Kontes

Scientic Glassware, Fisher) until the tissue goes into homogenate. Sequentially, 120~1 of

chlorofomi/isoamyl alcoho1(48:2) were added , mixed thoroughly by vortex for 10 seconds and

cooled on ice for 15 minutes. The supernate was transferred to a kesh tube aRer the mixture was

centrifuged for 15 minutes at 4OC 14 k rpm . Equal volume of ice-cold isopropyl alcohol was

added and mixed well by inversion. RNA was precipitated at -70°C for ovemight. Following

centrifugation for 15 minutes at 4OC at 14 k rpm, the RNA pellet was washed with ice-cold 70%

ethanol( resuspended in 70% ethanol and sedimented ) twice then dried in vacuum pump for 15

minutes. RNA was stored in DEPC water at -70°C. RNA concentration was assessed

spectrophotometrically using a spectrophotometer and microcuvettes (Phamarcia).

2.4 Synthetic Interna1 Standard DNA preparation

Two long oligonucleotides (92 nt each) containhg 20 bp overlapping ends were designed

to contain sequences of interest and synthesized by Vitrogen (London, Ont.). 0.5 pg of each of

the long oligonucleotides were mixeci together for the first PCR (overlap extension PCR)

(Figure 6). The PCR was performed in a DNA thermal cycler 480 ( Perkin Eixner-Cetus) in a

total volume of 50 pl containhg 50 mM KCI, 1.5 mM Mg&, 10 mM Tris-HC1200 p.M each

dNTPs, and 2.5 units of Thermos aquaticus DNA polymerase (Taq polymerase) (Phamacia).

The reaction was denatured at 94" C for 7 minutes, annealed at 50° C for 2 minutes and extended

at 72" C for 3 minutes. The reaction went through seven additional cycles with the denahvation

step reduced to 1 .S minutes. One rnicroliter of this reaction mix was used as template for the

second PCR. In the second PCR, 50 pmol of each of the 2 primers (18 bases each) spanning the

5' and 3' ends of the template fortned from the first PCR were added to the 50 pl PCR Mx as

desaibed above and subjected for 25 cycles of amplification ( denature at 94' C For 1.5 minutes;

anneaIing at 55' C for 2 minutes; extension at 72' C For 3 minutes).

2.5 Subcloning of the synthetic DNA into pBluescript

After the second PCR, the synthetic DNA templates were cloned into pBluescnpt II KS

(+/-) phagernid ( Sambmok et al 1989). The synthetic DNA templates produced in second PCR

were fmt purified using Magic PCR Pres DNA Purification System (Promega). 16 pl of purified

PCR product and 0.2 pg pBluesmpt phagernid was digested with EcoRI and BamHI in 20 ~1

volume with 1 x buffer B(10 m M Tris-HCl, 5 mM Mgch, 100 mM NaCl and 1 m M P

mercaptoethanal ). The digestion reaction was carrïed out in 37 O C for 3.5 hours and in 6S°C for

additional 20 minutes to inactivate the enzyme activity. The digested DNA fbgxnent and

phagernid were purified separately using Magic PCR Preps DNA Purif~cation System (Promega).

PCR 1 3' 5'

PCR 5'

Figure 6: Synthesis of intemal stindard by overiap extension PCR 0 S ~ g each of the two long oligonucleotides (92 nucleotides) with overlapping ends (mdicated by broken lines) were mixeci together in standard PCR (100 pl vohime). The reaction was denaturd at 94'C for 7 min, mealeci at 5S°C for 2 min and extended at 72°C for 3 min. The reactions went through seven additional cycles with the denaturation s e p reduced to 1.5 min. One microiiter of this reaaion mk was used as template for second PCR In the second Pm two primers (20 nucleotides each) spamhg the 5' and 3' mds of the template formed m PCR 1 were added to the standard PCR mix and subjected for 25 cycies of ampiifidon

The ligation reaction was canied out in 20 pl volume containmg 1 x ligation buffer (0.05 M Tris-

HCl pH 7.6, 10 mM MgC12, 10 mM dithiothreitol and 50 pg bovine semm albumin), 2 units T4

ligase, 6 pl DNA fragment and 2 pl pbluescript phagemid in 16°C for ovenllght. The ligation mix

(10p.i) was transformed into 200 pl competent cells and was plated onto 1.5% agar plate

containing 40 pg/ml Ampicillin, 50 pl of X-gal(2% stock solution) and 25 pl IPTG (O. 1 M stock

solution). Single white colony was picked and grown in 3 ml LB containing 40 pg/ml Ampicillin

for ovemight. Phagemid DNA was prepared fiom the ovemight culture using Wizard Minipreps

DNA Purification System (Promega). The phagemid DNA was sequenced by automated cycle

sequencing reaction. The sequences of sites for binding of p r i m a for the SR C ~ ~ ' - A T P ~ S ~ were

confirrned to be 100% correct.

2.6 In Vitro transcription

The pBluescript containing the intemal control synthetic DNA was first linearized to

produce transcripts derived front the insert sequence only. 4.8 pl of phagemid DNA was

digested with 20 units of BssHn. (New England Biolabs) in 20 pl reaction rnix containing 100

mM NaCl, 10 mM Bis Tris Propane-HCl, 10 mM MgCl* and 1 mM DIT). The reaction was

carried out in 50°C for one hour then in 65OC for 10 minutes. The BssHU Eragment (about 300

bases) was pwified h m a low-melting agarose gel using Magic PCR Preps DNA Purification

Systern (Promega). The In Vitro transcription was perfomed in 1 O0 pl volume containing 10 rnM

DIT, 1 x transcriptiom buffer (40 rnM Tris-HCI, 6 mM MgC12, 2 2 Spermicide and 10 mM

NaCl), 100 units RNasin ribonuclease inhibitor ( Promega), 2.5 mM each ATP, GTP, CTP and

UTP, linearïzed template DNA and 50 unites T7 RNA poiymerase ( GIBCO BU). The mixhire

was incubated at 37OC for one how and additionai 30 minutes after additional 20 units T7 RNA

poiymerase was added.

2.7 Removai of the DNA template foilowing in vitro transcription

Mter performing the in vitro transcription reaction, 40 units RQ 1 RNase - fkee DNase

(Promega) were added and incubated at 37OC for 30 minutes followed by phenoVchloroform

extraction. 50 pl each of phenol and chlorofom was mixed weli by votexing with the reaction

mixture. Following one minute of centrifugation at 14K rpm at room temperature, the supernates

were mixed with equal volume of chloroform. After the mixture was spun at 14K rpm for 1

minute, RNA pellet was washed with ice-cold 70% ethanol once and resuspended in 30 pl DEPC

treated H20 and stored at -70°C. The concentration of the inteml control RNA was assessed

spectrophotometrically.

2.8 The interna1 standard

The end result of PCR is an exponential increase in the total number of DNA hgments

that include the sequences between the PCR primers. If the efficiency of amplification method is

100%, the total amouni of target DNA formed followmg amplification can be represented at a

theoretical abundance of Zn, where n is the number of PCR cycles perfomed. However, in

praaice, the efficiency of amplification can deviate h m ideal. SmaU ciifferences in efficiency

could lead to large difference in the yield of PCR product. The rnethod selected in this shidy

overcomes the problern of possible variations in efficiency in quantitative PCR by hcluding an

intemal control RNA in the PCR reaction.

The internal control synthetic DNA was made by overiap extension PCR which was

previously described (Kanangat et al 1992)(Figure 6). î h e 164 oligonucleotides produceci by

overlap PCR were cloned into pBIuescript phagemid. The structure of the pBluescript phagemid

containhg the internal control are shown in figure 7. The internai control contains the 5' primers

of 3 genes of interest (SR c~''-ATP~s~, phospholamban and TGFB) followed by the

complementary sequences of their 3' pnmen. The size difference between the PCR products

fmrn the two RNAs permit easy separation by gel electrophoresis. Unique restriction enzyme

recognition sites (RsaI, BgUI and MspI) were located after the set of 5' primes and the set of 3'

primers to provide the provision of additional pairs of primer inserted as needed. The unique

BamHI and EcoRi sites are used to clone the synthetic DNA into pBluescript. The polyA tail at

the 3' end is used to facilitate reverse transcription using oligo(dT) (Figure 7).

cRN# 176 bp

+ ' cDNA - / -

total RNA PCR 107 bp

t myocardial biopsy

Figure 7: Diagrammatic representation of quantitative PCR using an internai contml RNA (CRNA) produced from a synthetic DNA. The synthetic DNA contains 5' p h e r s of3 target genes (SR Cah-ATPase, TGFP and phospholamban) foUowed by the complimentary sequences of their 3' primers. Restriction enzyme linkers are placed after the set of 5' prima and the set of 3' primers to aiiow insertion of additionai pairs of primer as needed. nie multiple primer region flanked by poly A sequences was subcloned into pBluescript downstream of T7 poiymerase promoter. The interna1 standard utilizes the same primer sequences as the target mRNA by design but yields a PCR product of different sire which perds easy separation of the dCNA product fiom the target mRNA product by gel electrophoresis.

2.9 Reverse-transe ri ption

A 20 pl reverse transcription reaction mixture containing 50 mM Tris-HCl (pH 8.3), 75

mM KCI, 3 mM MgC12, 0.5 mM each MTP, dTTP, dATP and dCTP, 20 units RNasin

ribonuclease inhibitor (Promega), 0.2 pg hexamer @âN6)(Pharmacia), 10 m M DTT, 200 units

Moloney Murine Leukaemia Virus Reverse transcriptase (M-MLV RT) (GIBCO BRL), 0.25pg

human heart total RNA and lng intemal control RNA was incubated at 37OC for one hour and

additional 5 minutes at 95°C then stored at -20°C.

2.10 PCR amplification

The oligonucleotides of 5' and 3' primers of SR ca2'-~TPase, phospholamban and TGFB

were chosen f?om the published report ( Lytton et a2 1988, Fujii et al 199 1, Quan et al IWO)

(Table 1). In this study, only the levels of the SR ~a' '-~'I '~ase gene were quantitated. The 5' and

3' primer of SR C ~ " - A T P ~ S ~ spanned a mial1 intron (8 1 bp) for easy identification of

amplification from contaminating genomic DNA if there is any. The same primer sequences are

used but the sues of PCR products from human kart RNA and intemal control RNA are

different based on the design of the interna1 control template. These primers were also chosen to

have 100% homology with the same gene of rat hart accomiodating the initial experiments on rat

heart tissues.

Tablel. Oligonucleotides of 5' primers and 3' primers for PCR of 3 cardiac genes

- -

GAGACGCTCAAGmGTG 1 76 107 - -

SRCA2a

PHLB I

TGFP ..

r I 1

. --

AGAACATCTGGCTCGTG

CAATACCTCACTCGCTC

CGAGGTGACCTGGGCACCATCCA TCAC

ATCATCGTOATGCTTCTC

GTGGGTCGCAAGCCCAAGCTGGA GCAG

144

405

72 I

100

DNA amplification was perfomed Ui 50 pl volume as desaibed before except that 37.5

pmol of each of the 5' and 3' primers of SR c a 2 + - ~ ~ p a s e and 0.5 pl of "P-CIC-~CTP were added

to the reaction. The PCR profile involved denahvation at 94OC for 1.5 minutes, primer annealmg

at 50°C for I .5 minutes, and extension at 72°C for 1.5 minutes. This reaction was carried out for

28 cycles.

2.1 f The specifieity of the SR C ~ ~ + - A T P P S ~ primers

The control RNA obtained by in vitro transcription using T7 RNA polymerase from the

synthetic gene was demonstrated to be of free of significant template DNA by doing PCR from

the control RNA without pnor doing reverse transcription. After 30 cycles of amplification of

the control RNA, no PCR produc ts can be visualized after ethidim bromide stainning. The

specificity of the SR C a ' + - ~ ~ ~ a s e primers was verified by perfomhg PCR using the primen

and first-strand cDNA fiom control RNA and from hurnan heart RNA. As designed and

expected, the SR C ~ ' \ A T P ~ S ~ primen gave single sharp band of 107 bp PCR product for

intemal control RNA and single sharp band of 176 bp product for sample RNA (Figure 10 &

Figure 1 1) , and no nonspecific PCR product could be seen in all samples. The nature of each

band was confirmed by sequencing.

2.12 Determination of the ratio of sample RNA and internal control RNA used for eDNA sy nthesis

It is very important to note that in quantitative PCR using a internal control RNA as a

standard, the starting amounts of the control RNA can influence the amplification effciency of

the sample RNA and vice verm. In this study, thmefore, initial experiments had been doue on

adult rat heart tissues to investigate the proper ratio of intenial control RNA and sampie RNA

should be used in the first-strand cDNA synthesis in order to allow both RNAs to be amplified

within the exponential range. In the case of rat heart tissue, 1 ng of internal control RNA and

about 0.25-0.3 pg of tissue RNA were found io be the suitable ratio. For group 1 and group 2

patients, 1 ng of internai control RNA, 0.25 pg and 0.3 pg of tissue RNA, respectively, were

used to do the quantitation.

2.13 Determination of the exponential phase of ampüficatioo

Having established the specificity of the SR C ~ ~ + - A T P ~ S ~ pnmen, and the proper ratio

of starting RNAs, the next step was to detennine the optimum number of PCR cycles required to

keep the amplification in the exponential phase and also to amplify only the specific product. To

do this, one tenth of the fint-strand cDNA from one of the human samples was amplified for 12,

14, 16, 18,20,22,24,26, 28 and 30 cycles. The PCR products were eletrophoresed on a 6%

TBE polyacrylamide gel. The appropriate bands representing amplification products from

differemt cycles were excised From the dried gel. Radioactivity nom the bands was plotted a g a k t

the nwnber of PCR cycles. At the p r e d e t d e d ratio of human heart RNA and control RNA,

the rates of amplification were exponential for both the intemal control and sample RNA when

the PCR reaction was performed for 24 to 30 cycles (Figures 8 & 9). It is ideal to keep the PCR

cycles to the minimum number in order to avoid nonspecific amplification, therefore, 28 cycles

was chosen for a11 quantitation experiments.

2.14 Electrophoresis

7.5 p1 each of PCR reaction mixture and 1 -5 pi of 6 x sample buffer (Novex) were

eletrophoresed in 6% polyacrylamide TBE gel (Novex) m 1 x Tris-borate/ EDTA buffer

according to the instruction (Novex). For the initial experiments doue on rat kart tissues, the

mini gel was dried for 1 hour then exposed on a Kodak film; and the s p d c bands were cut out

from the dried gel according to the autoradiogram and their radioactivities were determmed by

Cerenkov counting. Otherwise, the gel was transferred ont0 a cellophase small membrane (Novex)

and dried in a vacuum pump (Virtis, New York), then analyzed in a computerized

phosphoimager.

Figure 8. Autoradiogram of PCR products as a function of cycle number. 0.25 pg of human hem total RNA and 1 ng intemal control RNA were reverse-transcribed. One tenth of the first-strand cDNA was amplified for 12, 14, 16, 18,20,22,24,26,28,and 30 cycles. Afier the indicated number of cycles, samples were removed and analyzed by electrophoresis. Lanes 1 - 10 represent amplification cycles 12, 14, 16, ... 30, respectively. Base pair (bp) sizes of sample (176) and control(107) are indicated. Radioactivity of SR ~ a ~ + - ~ ' I ' ~ a s e PCR products for intemal control RNA and sample RNA increase with increasing cycle number.

- cpm (c ) 18n - cpm(s) 18n I

Cycle number

F i 9. Plots of PCR prodncts as a funetion of the number of amplif~cation cycles. PCR products shown in Figure 8 were cut out fiom the gel and radio- was determined by Cereakov couting. The variable concentdons ofthe intemal standard RNA (molec~Iles) and the sample total RNA (ng) were plotted against the number of amplification cycles. When PCR was perfomed for 22 to 30 cycles, the dopes of the m e s for the human heart cDNA and the internai control cI>NA were similar, therefore, the ampiifïcation &ciency couid be assuneci to be the sarne for both cDNAs w i t h the exponemial ranges.

2.15 Quantitative analysis of SR c ~ ' ~ - A T P ~ s ~ mRNA leveb

The SR c~'*-ATP~s~ mRNA levels h m 18 endomyocardial biopsies h m 1 1 patients

with suspected myocarditis ( group 1) and 1 1 endomyocardial biopsies fkom 1 1 patients with

dilated cardiomyopathy ( group 2) were quantitated using the interna1 control RNA described

above. Because of the dimculty ofacquiring human cardiac biopsies, initial experinients had been

doue using adult rat heart tissues before pursuing studies on hurnan biopsy samples following

procedures 2.3 to 2.12 to ensure this developed quantitative PCR technique is accurate and

reliable. Before the computerized phospho-image system was available in the laboratory,

intensity rneasurements of the PCR products were done on the Cerenkov counting machine

( initial experiments on rat hem tissues and cardiac biopsies from group 1 patients). For

quantitative analysis. one tenth of the kt-strand cDNA fkom each of the samples was serially

1 :2 diluted for seven cimes then subjected for 28 cycles of ampiification with the presence of SR

~a''-~TE'ase primers and '*~-a-dcTP. After electrophoresis, appropnate PCR products were

subjected to Cerenkov counting or analysis in a computerized Moiecular image System ( Bio-

Rad)( Figure 10 & Figure 1 1). A standard cuve was constmcted with varying concentrations of

intemal control RNA used in the analysis and the corresponding counting of their PCR products

( Figure 12). Since in the exponential phase of the PCR reaction, the efficiency of PCR for the

two RNAs is the same, the amount of target mRNA is quantitated by extrapolating against the

standard curve. As in figure 12, the molecule number of mRNA (Yc) in 10 ng total RNA (Ys= 1 O)

nom sample can be calculated by solving the equations as below:

60

Yc=Ac+BcX Ys=As+BsX

when Ys = 10 (ng), X = (1 O - As) , thus, Yc (molecules) = Ac + Bc i l O - As)

Bs Bs

and was expressed as molecules mRNA per l h g of total human heart RNA (Figure 12). The SR

ca2'-~Vase mRNA levels from two groups of patient are show in Table 2 and Table 4.

2.16 Statistical analysis

Correlation analysis were made in each group of patients between SR C~''-ATP~S~

mRNA levels and their haemodynamic data. Correlations were also made when the two groups of

patients were combined. Al1 correlations were tested by lmear regression analysis using Pearson

Correlation method. The test was considered significrmt when p value4.05. Variability of the

mean of SR c~''-ATP~s~ mRNA levcls in duplicate biopsy samples ( two separate biopsies

taken kom the same patient at the same procedure ) was tested using coefficient of variation

(CV), which is defied by CV = SD/M x 100%, where SD is the standard deviation, M is the

mean value fkom the two duplicate biopsies.

Figue 10. Autoradiogram demoIlSfraüng serial dihrtEons of quantitative PCR products. Trines 1-7 repfesent FCR pmdms h m serial 1:2 dilutions of one te& of a cDNA mixture reverse tmnscribed h m 0.25 vg of human heart total RNA plus 1 ng of interna1 control RNA after amplifiaiion for 28 cycles. The dried gel containing @taîive PCR products was exposed onto a Kodak film for 15 hours. The 176b products h m sample RNA and the 107-bp pucts h m intemal c0iltroI are i n d i d

Figure 11. Serial Dilution of Quantitative PCR products analysed by Molecular Image System. Lanes 1-8 represent PCR products from serial 1:2 dilutions of one tenth of a cDNA mixture reverse transcribed from 0.25 pg of human heart total RNA plus 1 ng of interna1 control RNA after amplification for 28 cycles. The dried gel contaking quantitative PCR products were analysed in a Molecular Image System (Bio-Rad). The 176-bp products fiom sample RNA and the 107-bp products ftom intemal control are indicated.

, 100

10 ' total

- RNA (4)

, 1

O. 1

Figure 13. Quantitative a d y & of SR CsM-ATP= M A ievd in rn endomyocaxdiai biom wmpk 0.25 pg of human heart total RNA and 1 ng of- ~0ntr01 RNA were revezse-tm~~&ed to cDNAs. One tath of the cDNA niamne was 1 3 serially ûiiuted for seven times and ampüfied for 28 @es. The intendnies of each band of the PCR procfucts were Aclterrnined by Molenilar Image System and plotteci against the concaltcationa of hternal control RNA (standard m e ) and brmian heart total RNA used in the adysis. Since the rates ofamplification were e x p o n d for both intanal corn01 RNA and human heart RNA, and the two dopes were in parallei, the moleaile number of mRNA in 10 ng of total RNA can be caladated by solving the two equations as bebw:

in ttiis patient, there are 2.135 x 1 O' m o l d e s of SR Ca%%TPase mRNA in 10 ng human h m total RNA

64

2.17 Northern blot andysis of SR c a 2 + - ~ ~ p a s e in rats h a r t after myocardinl infarction

Sprague-Dawley rats were subjected to proximal left coronary artery ligation. At 1,2,7,

14,21,28 and 35 days after the operation, rats were sacrificed and RNA was extracted from peri-

infarct myocardium using acid guanidinium thiocyanate-phenol-chlorofom method as described

be fore (Orenstein et al 1995). For each sample the total RNA (1 5 pg) was denatured in

fomialdehyde, nm in 1.2% agarose-formaldehyde gel and tramferred ovemight onto a positively

charged nylon membrane (Gene Screen plus; dupont, Wilmington, DE). The transfer was done by

an absorption process using I O x SSPE (1.5 M NaCl, 0.1M NaH2P04 x H20, 0.01 M EDTA) as

a tramferring buffer. The filters were incubated in prehybridization buffer (5 x SSPE, 50%

formamide, 5 x Denhardt's solution, 1% SDS, 100g/rnl denatured salrnon sperm DNA ) for 4

hours at 42'C. The filters were then hybndized ovemight at 42OC in fresh prehybridization

butTer containing the denatured 32~-labelled rat SR ~a~'-~TPase-specific probe. The filter was

sequentially washed for 30 min with 2 x SSPE at room temperature, and then 1 x SSPE at 52OC,

followed by 0.1 x SSPE and 0.1% SDS at 52T until the radioactive background was negligible.

The filter was then autoradiographed at -70°C with intensifjkig screens.

To confirm equality of loading of the extracted RNA from the heart samples, the same

blots were M e r washed with 0.1 x SSPE and 0.1% SDS at the boiling temperature for 15 min

and rehybridized with rat GAPDH and B a c t h probes, which are housekeeping genes to act as

controls.

The SR ~ a " - ~ ~ ~ a s e specific probe of 176-bp was derived by PCR gene amplification of

rat SR c a 2 + - ~ ~ p a s e target using the same primers as in quantitative PCR in human. Reverse-

transcription-PCR amplification was the same as described in 2.10 & 2.1 1 except that rat heart

total RNA was used as target RNA. The amplified SR c~*'-ATP~s~ product was excised and

M e r purified with Sephaglas (Phannacia Fine Chernical) and labelled with a--"pdATP.

Chapter 3: Results

3.1 Characterization of group 1 patients with suspected myocarditis

18 right ventncular endomyocardial biopsies obtamed km 1 1 patients were investigated

in group 1 experiments. These patients were a11 hospitalized with acute CHF and were suspected

of having acute viral myocarditis. Al1 the biopsies were procureci at the same time when cardiac

pressures were meanireci using fluid filled catheter-manometer. Duplicate biopsies ( two separate

biopsy fragments ) were taken from seven patients. The cardiac output of these patients ranged

fiom 2 to 6.7 L h i n and cardiac index ranged from 2.12 to 3.88 L/mm/m2. A broad range of PA

pressure, RV pressure, RA pressure and LV pressure can be seen in this patient population. The

clinical characteristics of 1 lpatients ( group 1) submitted to endomyocardial biopsy and

quantitative PCR are summarized in Table 2.

In group 1 patients, retrospective clinical data were rniuing in two patients ( patient #9 &

patient # 1 1). In addition, RNA from patients #8 and # 10 was not suficient to adequately

quantitate mRNA levels of SR c~''-ATP~s~. Therefore, these four patients (#8 to #Il) were

excluded fkom the correlation analysis.

In this group of patients, endomyocardial biopsies were submitted for pathologic

analysis. One patient's pathologic report was unavailable for review and archivai slides were not

located. Two to six pieces of cardiac tissue were studied from each of the 10 patients. No

evidence of myocarditis was presented in any of the biopsies. Four of the patients provided no

67

Table 2. Characterization of patients with suspected myocarditis ( group l), hemodynamic data and mRNA levels of SR Ca2' -ATPase

PAP RVP RA fmmHgl (mmHg) (mmHg)

LVEDP 1 mRNA (x 1 0' rnolocule/ 1 0ng total RNA) Patient Age(yr) CO Sex (Wmin) ( m m 9 Biopsy 1 Biopsy 2 Mean

CO, cardiac output; CI, cardiac index; PAP, pulmonary arterial pressure (systolic/diastolic/mean); RVP, right ventricular pressure (systolic/diastolic); RA, right atrial pressure; LVEDP, lefi ventricular end diastolic pressure; ND, not detectable; * patients excluded fiom correlation anrlysis.

positive abnomatities. The other six patients showed minimal to mild interstitial fibrosis, mild

cardiac fibre hypertrophy and mild fat infiltration. The histologic hdings Grom the biopsies are

compiled in Table 3.

3.2 Variability of SR ~a ' ' -~ ' I '~ase mRNA levels in dupücate biopsy samples

In group 1 patients, 7 of the 1 1 patients have two biopsy samples taken at the same time

of diagnostic procedure. To prevent variations in pmcessing h m affecting the experimental

resuits, al1 the sarnples from this group of patients were processed at the same time. However,

RNA from two biopsies ( #6 & #9) was not sufficient to quantitate mRNA SR ca2' ATPase.

Therefore, thses two patients were excluded kom the variability analysis. Sampling variability of

SR ca2' ATPase mRNA levels in two separate biopsies has been analysed using Coefficient of

Variation method and is shown in Table 4. The sampling variability between two separate

biopsies in these £ive patients is kom 2% to 83%. The mean variability of gene expression

between these separate biopsies is 38%.

3.3 Correlation between SR c~ '* -ATP~s~ mRNA levels and clinicd parameters from patients with suspected myocarditis (group 1)

Al1 patients h m group 1 were biopsied for suspected myocarditis. The hemodynamic

parameters were obtained using fluid filled catheters and this component of the study was done

retrospectively. The relationship between the expression levels of mRNA for the SR ca2'-

Table 4. SR CaB-ATPase mRNA levels and samphg variability in 5 dupikates of group 1 patients

(x 1 O' molecdes/l O ng total RNA)

Patient Biopsy 1 Biopsy 2 % variability 1 16.55 18-83 13 2 1 .O9 1.682 42 3 3 A65 5.765 49 4 2.164 2.216 2 5 3.032 7.514 - 83

mean 38

SR Ca2+-ATP~S~ rnRNA levels were detennined in two separate biopsies obtained in 7 patients. However, RNA fiom two biopsies fkom two patients was not sutncient to quantitate SR Ca2+- ATPase mRNA level. Thus, these two patients were ornitted from the variability study . Sampling variability nom two separate biopsies in one patient range fiom 2% to 83%. The mean variability of gene expression between two biopsies among these five patients is 38%.

ATPase and hemodynamic data was examined using Linear regression foilowed by Pearson

coefficient correlation method. The patient nurnber analyzed for each parameter were not the

same since in this group of patients some hemodynamic parameters were missing. SR ca2+-

ATPase mRNA levels positively correlated with right sided cardiac pressures including

pulmonary artery pressure ( systole, r=û.895, p=û.007, n=7; diastole, r=O.883, p=0.02 1, n=7;

mean, r4.883, p4.009, n=7) ( Figure 13. Figure 14 & Figure 15), nght ventncular systolic

pressure (r=O.82 1, ~ 4 . 0 2 5 , n=7) ( Figure 16) ( Table 7) and a trend towards a positive

correlation with right ventricular diastolic pressure (r=0.68 1, p4.094, n=7) and right atrial

pressure, r=0.664, p=0.106, n=7). These fmdings suggest that there is a direct relation between

SR c a 2 + - ~ P a s e gene expression levels and nght heart pressures in this patient population and

in particular, in patients with relatively mild cardiac fmction impairment.

The correlation between SR C ~ " - A T P ~ S ~ mRNA levels and leA sided cardiac parameters

were also analyzed. SR c ~ ' - - A T P ~ s ~ mRNA levels showed negative correlation with cardiac

output ( ~ 4 . 7 6 6 , p=0.046, n=-7) ( Figure 17), aortic pressure (r-0.768, p=O.O45, n=7) ( Figure

18) and a trend towards a negative correlation with left ventricular end diastolic pressure

(LVEDP) (F-0.730, y0.103, n=6). These results denote that in this patient population, there is

a weak inverse relation between nght ventricular SR C~"-ATP~S~ gene expression and LV output

and aortic pressures. This may reflect the contribution of seventy of left sided hemodynamic

embarrassrnent to elevated PA pressures which strongly and positively correlate with gene

expression.

Pulmonary artery systolic pressure(rnd3g)

Figure 13. SR CaB-ATPase mRNA levels positively correlate with pdmonary artery systolic pressure from patients with suspected myocarditis.

(MokcuWlO ag total RNA)

rnnnnnnnn L

Figure 15. SR CaBaATPase mRNA leveis positively correlate with pulmonary artery mean pressure from patients with suspected myocarditis.

Right ventricalv systoiic pressure (mmHg)

Figure 16. SR CaN-ATPase mRNA leveis positivety correlate with right ventricuiar systolic pressure from patients with suspected myocarditis.

CardYc output (litnlminute)

Figure 17. SR CaN-ATPase mRNA levels negatively correlate with cardiac output fmm patients with suspected myocarditk

Aortic pressure ( m e )

Figure 18. SR CaN-ATPase mRNA levels negatively correlate with aortic pressure from patients with suspected myocarditis.

3.4 Characterization of group 2 patients with dilateci eardiomyopatby

Al1 1 1 patients from group 2 were clinically diagnosed with dilateci cardiomyopathy and

no patient had CO-existent coronary artery disease. This group of patients were al1 out-patients

will less CHF symptoms and were seletively chosen for endomyocardial biopsy. Cardiac

pressures and other parametee of myocardial performance were measured prospectively at the

time when biopsy sample was taken using micromanometers in order to reduce the mass and

inertia of the pressure measurement system, decrease artifacts associated with overdamping and

catheter whip, and improve the frequency response characteristics which is necessary to

accurately measure the rate of ventricular pressure rise (+dP/dt) and other indices of cardiac

performance (Grossman 1986). The majority (73 %) of patients were in the II-III class according

to the New York Heart Association classification. Two patients were in class 1 (1 8%) and one

patient was in class IV (9%). Ejection £?action were from 23 % to normal. There were broad

ranges of cardiac output From 3 -3 to 6.7 L/mk and cardiac index from 1 -9 to 3 -3 L./min/m2. The

c harac teris tics of these patients, their hemodynamic paremeters and the SR C$=ATP~S~ mRNA

levels are shown in Table 5.

Biopsies from this group of patients were submitted for pathologic analysis. One

patient's pathologic report was unavdabte for review and archival slides were not located. Thé

histological data from group 2 patients are summarized in Table 6. Arnong the ten patients, four

to five pieces of cardiac tissue h m each patient were submitted for histological studies. Four

patients showed non-speci fic changes. Three patients were diagnosed with myocarditis whiie the

Table 5. Characterization of patients with dlated cardiomyopathy, their hernodynamic data and mRNA levels of SR Caw-ATPase

Patient 1 Ag=@) 1 Tau 1 .@dT 1 R* No. and Sex (mec) max fmmH@

Tau, tirne constant of lefl venricular relaxation; dPldT, first derivative of lefi ventricular pressure by the ; RA, nght ventricular pressure; RV, nght veniricular pressure (systolid diastolidmean); PA, pulmonary artery pressure (systolicl diastolid mean); PAWP, pulmonary mery wdge pressure; AP, aorta pressure (systolicl diastolid mm); LVEDP, leR veniricular end diastolic pressure; LV by RNA, ejection fnction; CO, cardiac output; CI, cardiac inclex; mRNA, messager ribonucleic acid ( moleculel 10 ng total RNA).

Table 6. Histologie data €rom patients with dilated cardiomyopathy (group 2).

Patient Evidence of myocacditis No No Yes - Yes No Yes No No No No

- No No Yes No Mild No Scattered

Inters titiai fibmsis No No Prominent - No No Yes Yes No No r n d

Fat infiltration No No No - No No Patchy No No No Patchy

other three showed changes consistent with dilated cardiomyopathy (muscle fiber hypertrophy, muscle fiber degeneration, interstitial fibrosis, endocardial fibrosis and fat infiltration).

3.5 Correlations between expression levels of mRNA for the SR ca2'-~~pase and cliaical parameters from patients with ditated cardiomyopathy ( group 2 patients)

Patients from group 2 were clinically diagnosed with dilated cardiomyopathy. SR ca2+-

ATPase mRNA levels showed significant positive correlation with most of the parameters of

augmented load on the right heart ( right ventricular systolic pressure, d . 6 1 5, p=0.044, n=l 1 ;

pulmonary artery diastolic pressure, r=0.656, p=0.029, n= Il; pulmonary artery mean pressure,

r=0.626, g~0.040, n= l 1 ) ( Figure 19, Figure 20 & Figure 2 1 )( Table 7). There is no correlation

between SR C ~ " - A T P ~ S ~ mRNA levels and right atrial pressure, nght ventncular diastolic

pressure, pulmonary artery systolic pressure and pulmonary artery wedge pressure. These

results are consistent with the results from group 1 patients indicating that the expression level of

SR C ~ - - A T P ~ S ~ positively correlaies with imposed Load in this patient population.

The SR c ~ ' - - A T P ~ s ~ mRNA did not show any correlation with parameters of lefi heart

function ( dP/dT max, F-0.343, NS, n=l 1; Tau, ~ 0 . 4 5 9 , NS, II=$; systolic AP, F-0.292, NS,

1142; diastolic AP , I= -0.073, NS, n= 12; mean AP, ~ - 0 . 2 16, NS, n=12), although it did show a

tendency towards a positive correlation with LVEDP (r=0.557,p=0.060, n= 12). The relationship

between SR C ~ " - A T P ~ S ~ mRNA and left-sided pressures is not apparent in this patient

population, and combined with the weak correlation in group 1 suggests that endomyocardial

biopsy ( RV) rnay provide little insight into left-sided cardiac dysfunction. In particular, no

correlation could be found between gene expression and measures of diastolic performance.

Figure 19. SR CaN-ATPase mRNA levels positively correlate with right ventricuiar systolic pressure from patients with dilated cardiomyopathy.

Figure 20. SR Car-ATPase mRNA leveis positive1y correlate with pulmonary artery diastok pressure fmm patients with dilated ardiomyopathy.

Figure 21. SR CaN-ATPase mRNA Lw& positively correlate with pulmonary artery mean pressure from patients with dilated cardiomyopathy.

Tabk 7. SR Ca*-ATPase mRNA showed positive condation with nght sided eudiac pressares from patients o f snspected m y o d i t h and dilrted diomyopathy

"

r v d r r e o aoll

r vrhie(MC) ~ = 7

r vdue(DCM+MC) p l 8

P m ' s

0.491

0.8% **

0594 *+

PAdia

0.656 +

0.833 * O S 7 *

PAmeaa

0.626 - 0.883 +*

0.630 **

RVqs

0.615 +

0.821 - OS94 +*

3.6 Correlatiuns between cünicnl parameters of group 2 patients and SR ca2+-~TPase mRNA IeveIs normalized with GAPDH

In the patient group with suspected dilated cardiomyopathy, SR ca2'-~'I'pase mRNA

levels were also expressed as mRNA molecule per unit of GAPDH (Glyceradehyde-3-

phosphate-dehydrogenase). This was done to control for variability in cellularity between biopsy

samples. The first strand cDNA used to do the quantitative PCR was also amplified using

GAPDH primers. The ethidium bromide stained PCR products were quantitated using a gel-doc

system ( Bio-Rad). SR C & A T P ~ S ~ mRNA Ievels were normalized according to the formula as

below:

mRNA per unit GAPDH = Molecule per 10 ne. total RNA GAPDH / GAPDHrnean

After normalized with GAPDH, SR C ~ ~ ' - A T P ~ S ~ mRNA levels persisted in showing positive

correlation with parameters from the right heart ( right ventncular systolic pressure, r=0.633,

~ 0 . 0 3 7, n= 1 1 ; pulmonary artery diastolic pressure, ~0 .700 , p=0.0 17, n= 1 1 ; pulmonary artery

mean pressure, ~ 0 . 7 3 4 , p 4 . 0 10, n= 1 1 ) ( Figure 22, Figure 23 & Figure 24). These results are

consistent with those when SR C ~ " - A T P ~ S ~ mRNA levels were expressed as mRNA moiecule

per 10 ng total RNA and support the initial correlations.

(MolecukllO ng total RNA)

Puhonary arterg diastotic pressure (mmHg)

Figure 23. SR Ca*-ATPase mRNA levels when normaiized with GAPDH positively correlate with puimonary artery diastolic pressure from patients with diiated cardiomyopathy.

Patmonay arterg mun pressure (mmHg)

Figure 24. SR CaN-ATPase mRNA levels when normalized with GAPDH pitively correlate with pulmoaary artery mean pressure from patients with diLted cardiomyopathy.

3.7 Correiation between SR ca2+-~TPase mRNA leveis and c l i n i d parrimeters from combined group 1 and groip 2 patients

Despite ciifferences in the approach to assess hernodynamics, the correlation between SR

ca2+-~TPase mRNA levels and clinical hemodynamic data when these two groups were

combined was tested. As expected, SR ca2'-~TPase &A levels showed positive correlation

with nght ventridar pressures ( systolic, d .637 , pi0.005, n=18; diastolic, 4 . 5 2 2 , p4I.026.

n=18) and puimonary artery pressure ( systolic, 4.594, ~ 4 . 0 0 9 , n=i8; diastoiic, M.567,

p 4 . O 14, n= 18; mean, 4.630, p=0.005, n= 18) ( Figure 25, Figure 26, Figure 27, Figure 28 &

Figure 29)flable 7). The combbed &ta again reveals no correlation with lefi-sided

hemodynamics.

Figure 25. SR CaN-ATPase mRNA levels positively correlate with right ventncuiar systolic pressure from combined patients of srispected rnyocarditis and dilated cardiomyopathy.

SOOOOOOO

Figure 26. SR Cas-~TPase mRNA levels positively correlate with right venticular diastoiic pressure from combined patients of suspected myocarditis and diiated cardiomyopathy.

Pnimonay artery systolic pressure (mmHg)

Figure 27. SR CaH-ATPase mRNA leveis positively correlate with pulmonary artery systoüc pressure from combined patients of suspected myocarditis and dilated cardiomyopathy.

(Molecu W t O mg total RNA)

Figure 29. SR CaN-ATPase mRNA levels positive& correlate with puimonary artery mean pressure from combined patients of suspectesi myocarditis and dilited cardiomyopathy.

3.8 SR CP~'-ATP~S~ expression in infarcted rat hearts

In order to provide a controlied experimental context for the hdings that SR ca2+-

ATPase mRNA levels showed positive correlation with hemodynamic load in the nght ventricle

in human, Northm blot analysis was performed using tissue from ùifarcted left ventricle in rats

in 1,2,7, 1 4,2 1,28 and 3 5 day s af'ter coronary ligation using cDNA encoding SR ca2'-~'Pase.

The tissue analysed was Eom surviving myocardium and included ventricular septum

(comparable to the site of hurnan RV endomyocardial biopsies). There was an increase in the

expression levels of SR ca2 ' -~~pase in the second day post-infarction when compared with

that of the €mt &y, which then gradually decreased to below basal levels at later time points

associated with veniricdar rernodelling and heart failure ( Figure 30). Mer nomalized with 28s

RNA, SR C ~ " - A T P ~ S ~ gene expression persisted in showing an increase 2 &ys post infarction.

By contras4 such a biphasic response was noi seen in sham controls (non-infart rat hearts).

Thus post-inf'arction in a rat mode1 the initial response of suMving myocytes to imposed load is

the augmented expression of SR ca2' -ATPase gene expression pnor to subsequent

downregulation.

Figure 30. Northern BIot and ethidium bromide staining of SR ca'+-~'I'~ase RNA in inf'arcted rat heart. ( A) Northern Blot of serial changes in mRNA expression of SR Ca2+- ATPase in infarcted rat heart. Representative RNA samples from the infarct heart tissue serially on days 1,2,7, 14,21,28, and 35 following coronary ligation. There was an increase in SR ca2+-~Wase gene expression on day 2 after coronary ligation then a gradua1 decrease throughout the observation period of up to 35 days. ( B) Ethidium bromide staining of RNA eletrophoresed in a 1.2% agarose gel containing formaldehyde demonstrating relative 28s RNA expression.

Chapter 4: Discussion

4.1 The development of the RT-PCR quantitative technique - technical aspects

The polymerase chah reaction (PCR) is a recently developed procedure for the in vitro

amplification of DNA sequences that has gained widespread acceptame in many areas of

moleciilar biology and is makmg an impact on medical diagnostics. The extreme sensitivity of

PCR brings with it a unique set of problems when attempting to use it as a quantitative method.

It has been demonstrated that mRNA levels can be quaatified using the PCR and a synthetic

RNA as an internal standard ( Wang et al 1989). The quantitative PCR method used in this study

was similar to that described by Wang et al in which a synthetic RNA molecule is used as an

internal control to allow the amplification reaction to be made quantitative. By presenting a

contml RNA in the reverse-transcription and amplification reactions, this technique provides a

reliable method for quantification of mRNAs of interest, which obviates inherent assay-to-assay

variations in sample preparation, reverse-transcription, and gene amplification.

It is necessary to emphasise that the intemal control described here could be used to

measure 3 different human cardiac genes in paraIlel since the synthetic interna1 standard contains

primer sequences and their cornplementary sequences of three target genes. An endomyocardial

biopsy sarnple usually weighs 3-5 mg which can yield about 2 pg of total RNA. In ihis study,

0.3 pg of total RNA is added to the reverse-transcription reaction; and only 1/10 of the first

strand cDNA mixture is to be amplified by PCR. The fact that this quantitative method can

provide sufficient sarnple for multiple PCR miction demonstrates a major advantage of this

technique, considering that much more RNA is required for Northem-blot analysis of multiple

genes. An added advantage of this PCR quantitative technique is that the constmct as designed

bas provision to accommodate other primers of target genes and can be readily rnodifîed to

analyse diverse genes of interest £tom any tissue.

Efficiencies of first strand cDNA synthesis and PCR amplification can influence the

accurate quantitation of mRNA levels by the technique applied in this study. Differences in

nucleotide sequences, length of poly(A) tails, and the distance between the PCR primen and the

poly(A) tail are among the facton that may affect the efficiency of cDNA synthesis of the target

mRNA and the intemal control RNA. However, these effects have been overcome by using

random prime hexamen instead of oligo dT primer.

There are numerous variables that could affect the efficiency of the PCR amplification.

Some of the facton that can be easily controlled are WTPs, MgC12, polymerase and the PCR

cycle profile. Another factor which has to be taken into account is the difference in length of the

target sequences and the intemal control sequences. In this study, however, the difference in

length of the target sequences (176 bp) and intemal control sequences(l07 bp) would not

significantly affect the amplification efficiency cons ide~g the fact that the Taq DNA

polymerase can incorporate >60 nucleotides per second. Primer efficiency is the most important

parameter among the various parameters that could affect the PCR amplification efficiency.

Previous observation (Wang et al 1989) indicated very clearly that it is critical to use the same

primers for amplification of the target mRNA and the interna1 standard in any attempt to

quantitate mRNA expression by PCR. By reverse transcription and amplification of the target

mRNA and intemal control RNA in the same tube, variable effects due to primer differences,

tube differences, differences in sample preparation, conditions of the reverse transcription, or the

PCR amplification are intemally controlled and will affect the yield of PCR product equally for

the target mRNA and the standard CRNA.

It has been demonstrated that the amount of an amplified DNA fiagrnent in a given

sample has a tremendous influence on the amplification efficieucy. When a high template

concentration is used or occurs as a result of the PCR amplifications, phenornena such as the

subsmte saturation of enzyme, product inhibition of enzyme, incomplete strand separation, and

product strand reannealing c m be limiting factors for efficient amplification. It is worth noting

that in quantitative analysis of mRNA levels with a standard control RNA, the concentrations of

the control DNA can affect the amplification efficiency of the sample cDNA and vice versa. In

this study, the quantities of intemal control RNA and sample RNA used in the first strand

cDNA synthesis were adjusted for each sample so that the ratios of sample ( 0.25-0.3 pg) and

control(1 ng) RNA would alIow for equal amplification efficiency (calculated between 8045%).

One of the limitations in quantimg mRNAs in small samples of tissue such as biopsy

samples is the difficulty in determining the quantity of total RNA precisely. In this study, the

concentration of RNA is acquired spectrophotometrically. The availability of sensitive

spectrophotometric instruments and microcuvettes has made it possible to obtain concentration

of total RNA accurately. Furthemore, the quantities of RNA were verified by repeating the

10 1

measurements at a different t h e . In this study, the total RNA yielded h m one endomyocardial

biopsy sample of human heart ranged h m 1.58pg to 6.24 pg (average yield, 2.85 pg) consistent

with a previous report (Feldman et al 1991). It is important to emphasize that this previous

report used "bopsy-sized" samples of myocardium from explanted end-stage hearts and the data

in this present study reflect the Fust use of this approach on achial biopsies with correlation of

gene expression with hemodynamics in intact living patients.

4.2 Variabüity of SR ~ a * + - ~ ~ F @ a s e mRNA from duplicate biopsies

Endomyocardial catheter biopsy had becorne a promising tool for the evaluation of the

morphologie-functional relationship and the follow-up of the morphologie course of cardiac

disease since its introduction in 1962. The variation of morphologic fmdings in different biopsy

specimens fkom a well defined part OF the heart had been well studied. A study using 112

biopsies nom 25 patients with hypertrophie cardiomyopathy suggest that five endomyocardial

biopsies are desirable and give the most information at an acceptable strain, considering the

sarnpling variability of fiber diameter (Coefficient of Variation, CV = 5%), volume density of

interstitiun ( CV = 9%), fibrous tissue ( CV =17%), endocardial diickness ( CV = 79%) and

muscle fiber disarray ( CV = 100% ) differed. Moreover, in the same study, the percentage of the

unusable biopsies was 28.6% ( Schwartzkopff et al 1987). However, variability and

reproducibility of assessing cardiac gene expression levels from cardiac biopsies have not been

studied by any investigators to date. Therefore, the finding h m this study that CO-efficient of

102

variability of SR ca2 ' -~~pase gene expression between two biopsies in one heart is 38%

compares with a mean sampling variability for rnorphological snidies is 42%. To mcrease the

precision of the estimation of cardiac gene expression From endomyocardial biopsies, a greater

number of biopsies would be required. This may not be possible in experirnental studies for both

technical and ethical reasons and as such our estimate of variability must be kept in mind when

interpreting any subsequent descriptions of the use of this approach.

4.3 Alterations in SR ca2+-~TPase gene expression in human henrt disease - new

insights

Previous studies using animal models and human failing heart sarnples showed that SR

c ~ ~ * - A T P ~ s ~ gene expression levels were altered in both cardiac hypertrophy and heart failure.

Thymid homone-induced cardiac hypertrophy is associated with increased SR C ~ " - A T P ~ S ~

gene expression (Nagai et al 1989 & Kimwa et al 1994) while in pressure overload-induced

cardiac hypertrophy, SR c~' '-ATP~s~ gene expression had been shown to be significantly

decreased (Matsui et al 1995). However, other studies showed no change or enhanced SR ca2+-

ATPase gene expression levels in mild cardiac hypertrophy with a decrease o d y in severely

hypertrophied heart (de la Bastie et al 1990, Limas et al 1980, Shen et al 199 1 & Arai et al 1996),

indicating that cardiac hypertrophy induced by pressure/volume overload is not invariably

associated with decreased expression of SR C ~ " - A T P ~ S ~ gene.

In anmial models of heart failure, SR c~'''-ATP~s~ activity was decreased 36% to 50% m

failing heart induced by chronic rapid veniricular pacing ( Coty et al 1993, Cory et al 1994,

O'Brien et al 1994 ). A significant decrease in SR ca2+-~TPase activity was also shown in cimg-

induced heart failure (Olson et al 1974, Tomplison et al 1985 & Kusuoda et al 1991). However, a

study camed out by Feldman et al in 1993 demonstrated that SR C ~ ~ * - A T P ~ S ~ mRNA levels

were decreased by 50% only in Failing ventricular myocardium of rats but not in rats with cardiac

hypertrophy without heart failm. These data Eûrther suggest that in animal models, dom-

regdation of SR c a - ~ ~ ~ a s e gene may contribute to the development of heart failure (or at least

serve as a marker for failure).

In human cardiac hypertrophy and heart failure, calcium release and calcium uptake

hmction are impaired (Gwathrney et al 1987, Morgan et al 1990 & Hasenfuss et al 1992). The

expression levels of SR C ~ " - A T P ~ S ~ were decreased up to 48% in myocardiwn from patients

with end-stage heart failure ( Mercadier et al 1990) and were inversely correlated with ventricular

ANF ( atrial natriuretic factor) mRNA ( Arai et al 1993 ). These fmdings suggest that SR ca2'-

ATPase gene expression is down-regulated in end stage heart fasure in human.

Unlike previous studies, the present study was undertaken to investigate the correlation

between SR C~"-ATP~S~ &A levels and hemodynamic rneasures of systolic and diastolic

perfomance in patients with clinical heart failure and suspected myocarditis or dilated

cardiomyopathy prior to the development of temiinal disease resulting in death or myocardial

transplantation. A prUnary finding was a stmng positive correlation between measures of

imposed load on the right ventricle (eg. PA systolic and PA mean pressures) and RV SR ca2*-

ATPase mRNA levels both in patients with suspected myocarditis and io patients with dilated

cardiomyopathy. One interpretation of this finding is that imposition of load on the right heart

results in augmentation of SR gene expression in proportion to the severity of that load at least at

the stage of disease studied. This would be in agreement with data that m fact mild experimental

cardiac hypertrophy is associated with augmented SR c a " - ~ ~ ~ a s e mRNA levels a n d h activity

(Limas et al 1980, Shen et al 1991 & Arai et al 1996). Histologie findings fiom both group 1 and

group 2 patients did demonstrate predorninantly mild myocyte hypertrophy and absence of

severe cardiac muscle damage or fibrosis in keeping with an early stage of RV pathology.

However, this conclusion is limited by the absence of data on the normal levels of expression of

SR ~ f l - ~ T P a s e mRNA in the right ventricle in the absence of disease. Normal RV could be

obtained at autopsy or from hearts not used for implantation. Mternatively. RV biopsy samples

could be taken from patients who have undergone heart transplantation. However, such tissue

may not be comparable to that obtained by biopsy in intact humans or may not be possible

because of ethical reason. Thus, it can not be definitively stated that the gene is upregulated From

normal levels by load in the RV but only that it is positively correlated It is unlikely that

patients with normal PA pressures have lower levels of SR ca2--~TPase expression as a

reflection of uicreased disease severity as more severe myocardial disease is associated with

increases in PA pressures not decreases. Similarly, a weak negative comlation between the SR

~ a " - ~ ~ ~ a s e mRNA and cardiac output was seen in gmup 1 patients in the face of a positive

correlation with right sided load

The result of this study is disparate from earlier studies in hiling to demonstrate a

uniform downregulation of SR ca2'-~TPase steady state message levels in patients with heart

failure. In addition, there was weak or no correlation between SR C ~ ~ + - A T P ~ S ~ gene expression

and detailed measures of left ventricular systolic or diastolic performance. It is unlikely that the

differences between the result of this study and those from previous literatures can be attributed

to differences in the techniques used to assess mRNA levels. The quantitative PCR approach has

been well validated by previous studies (Wang et al 1989, Feldman et al 1991 & Feldman et al

1993). In addition, initial experiments have k e n done in adult rat heart to make sure that the

internal control RNA was free of any contarninated DNA by PCR without doing cDNA

synthesis. All the biopsy samples h m each group were processed at the sarne time in order to

reduce the variations between samples. Effort have been made to insure the amplification for both

the internal control RNA and the sample RNA were within the linear range of the assay, and the

data were obtained from the exponential phase of the amplification. Furthemore, the identity of

the amplification products were confmed by sequence analysis. Therefore, it is more likely that

the results of this study differ from previous results because of invinsic differences in these

patient populations.

In previous studies, human cardiac tissues used to study SR c~*'-ATP~s~ mRNA levels

were taken h m patients undergohg cardiac transplantation, reflecting exclusively end-stage

failing hearts. In this study, however, cardiac biopsy samples were procured from living patients.

The majority of patients from group 2 are in New York Heart Association (NYHA) functional

classes II and III ( 73%, moderate symptoms), 2 patients are in class 1 (1896, mild symptoms) ,

and only 1 patient (9%) is in class N (severest), indicating that this group of patients are for the

most part not s u f f e ~ g h m end-stage heart failure and clearly distinct kom patient populations

undergoing cardiac transplantation. A second possible explanation for the resuit of this study

may be the existence of dispatities in gene expression during deveiopment of cardiac hypertrophy

and heart failure between right ventricle and left ventricle which is not assessed in this study. A

study conducted by Kolar et al in 1992 using two experimental models of cardiac hypertrophy

(chronic thyroxin or isoprenaline treatrnent of adult rats) showed that in the thyroxin treated

group, the functional reserve of the left ventricie rose very noticeably, whereas the nght

ventricular functional reserve did not differ from that in the controis. Tnis shidy also showed that

there was an incomplete regression of ventncular hypertrophy and persistent structural and

functional impairment in the left ventrîcle that did not happa in the right ventricle in the

isoprenaline treated animals. Another study done by Boluyt et al in 1994 showed that in SHFt.,

there was no significant decrease in LV SR C ~ ' - A T P ~ S ~ mRNA as a result of either

hypertension or during the transition from cardiac hypertrophy to heart failure, although there

was a 24% decrease in the right ventricle of SHR-NF, with no M e r decrease during the

transition to failure. This finding is contrary to the result of diminished expression of the SR ca2*

-ATPase gene after aortic constriction in the rat heart. These studies suggest that investigation of

gene expression in cardiac hypertrophy and the transition to heart failure in animals may be

model-dependent, and that hearts undergoing a comparable degree of experimental hypertrophy

and failure may have different hctional and structural properties as well as different patterns of

gene expression; and significant ciifferences can be found between the nght and left ventricular

response. Given the hypothesis that there may be disparities in gene expression between right

ventricle and lei? ventricle during cardiac compensation and heart failure, assessrnent of gene

expression levels in endomyocardial biopsy (right ventricle) may reflect mainly the alterations of

gene expression in the nght hem. Autopsy data on differences in right versus left ventricular

expression of the SR ca2+-~TPase gene are not available and no data on expression in LV

biopsies are provided in this study, again for the technical and ethical reasons of the higher risks

associateci with LV sampling.

The result showing that SR C ~ ~ ' - A T P ~ S ~ gene expression is increased 2 days after

coronary artery Ligation in rats supports the findings of positive correlations between SR ca2'-

ATPase gene expression levels and right hart pressures in human reflecting induction of the gene

by initial augmentation of load. The infarcted rat heart model also allows analysis of the

progression of heart disease to failure by remodelling of the leA ventricle. The downregulation of

SR c ~ ~ ' - A T P ~ s ~ gene expression at later stages post-infarction parallels changes in skeletal a -

actin gene expression (Tsoporis et al 1997) and likely reflects the development of decompensated

myocardial failure. The finding of animal data from this study is supportive of the human data

and may provide a new insight into the eifects of acute myocardial inf'arction in the expression of

~ a " transport proteins and therefore the development of cardiac diastolic dysfunction in a model

with ready clinical application.

While cytoskeletal actin mRNA has been widely used as a "control" for normalking

mRNA levels of interest, steady-state rnRNA level of p-actin is decreased in failing human hearts

(Feldman et al 1991). Thus, SR C ~ ~ + - A T P ~ S ~ mRNA has been noxmalized with GAPDH, a

constitutively expressed glycolytic enzyme wildly used as a house-keeping gene. BMHC has

Normal Mild Moderate Severe Failure Hy pertrophy

Figure 31. Schematlc presentation of proposed model of SR Ca2+ -ATPase mRNA levels in cardlac hypertrophy and failure Normal adult cardiac muscle has a relatively siable expression level of SR Ca2+ -ATPase which is portion 1 of the curve. After the hem is subjected to pressure/volume overload. the myocardium compensaies by cardiac hypertrophy, elevating calcium transport by sarcoplasmic reticulum ( Limas et al 1980) and increasing the expression bvels of SR C ~ " - A T P ~ S ~ which is portion 2 of the curve. If overload persists, the myocardium will undergo decompensation accompanied by abnormal calcium handling and reduction in the calcium transport as well as the expression of SR ~ a ' + - ~ ~ ~ t t s e irnitating portion 3 of the curve. In the end-stage of heart failure, the calcium transport capacity is further decreased and so as to the expression levels of SR ~a~+-ATPase reflecting portion 4 of the curve.

been used as control related to myocyte specific RNA (Mercadier et al 1990). However,

contradictory results regarding PMHC gene expression in human heart failure have been reported

(Feldman et al 199 1 & Ami et al 1993). Therefore, this study does not control for the volume of

cardiac myocytes in a single biopsy. However, 0u.r histologie data shows that these biopsies have

minimum non-myocyte tissue, such as fibrosis.

It has been suggested that alterations in steady-state levels of mRNA paraIIel changes in

the levels of their protein products ( Limas ei al 1980, de la Bastie et al 1990 & Arai et al 199 1 ) .

One of the limitations with quantitating gene expression at the mRNA level is that it is not

necessary correspondent between mRNA and protein levels. However, analysis of gene

expression may provide insight into the basis for functiooal protein modification. In addition,

there is substantial data showing dissociation between protein and rnRNA levels in contributing

to funetional impaiment, providing evidence for a post-transcriptional or post-translational

regulation.

The result of this study showing a positive correlation between SR C ~ " - A T P ~ S ~ mRNA

levels and right h a r t pressures is consistent with a recent study which demonstrated that SR

~ a ' ' - ~ T ~ a s e mRNA levels were upregulated in mild cardiac hypertrophy but downregulated in

severe cardiac hypertrophy induced by pressure overload ( Ami et al 1996), and can possibly be

explained by a proposed model of compensatory mechanism of' SR C ~ " - A T P ~ S ~ gene expression

when the heart is subjected to overload, develops progressive hypertrophy, and oniy

subsequently decompensates and fails ( Figure 3 1).

The c w e in figure 3 1 shows varied expression levels of SR C ~ " - A T P ~ S ~ gene during

110

different stages of cardiac hyperhophy and failure. Nomial adult cardiac muscle has a relatively

stable expression level of SR C ~ ~ + - A T P ~ S ~ which is portion 1 of the curve. m e r the heart is

subjected to ovedoad, the myocardium compensates by cardiac hypertrophy, elevating calcium

transport by SR ( Limas et al 1980) and increasing expression levels of SR c a 2 + - ~ P a s e (Arai et

al 1996) which is portion 2 of the curve. If overload penists, the myocardium will undergo

decompensation accompanied by abnormal calcium handling and reduction in the calcium

transport as well as the expression of SR C~''-ATP~S~ imitahg portion 3 of the curve. In the

end-stage of heart failure, the calcium transport capacity is M e r decreased and so as to the

expression levels of SR C ~ ~ ' - A T P ~ S ~ reflecting portion 4 of the curve. Assumingly, h e m , at

l e s t the right heart, analysed in this study both from group 1 and group 2 are in well

compensated stage which is portion 2 of the curve, and there is an increased expression levels of

SR ~ a " - ~ ~ ~ a s e when the right heart pressures go up. Comparably, previous studies used end-

stage failing heart tissues reflecting portion 3 or even portion 4 of the curve, showing that the

expression level of SR ca"-~TPase is downregulated in this stage of human myocardial disease.

Myocardial hypertrophy is widely recognised as an positive adaptive response that

normalizes wall stress and compensates for an increased load. Not only the amount of contractile

elements increase, but the h a r t itself undergoes complete remodelling at the organ, cellular and

nibcellular level. When the load is chronically elevated for an extended period of time,

compensated hypertrophy may progress to heart failure by unclear mechanisms. It rnakes

teleologic sense that hypertrophied myocardiurn which is subjected to elevated resting calcium

concentrations would initially augment transport mechanisms into the sarcoplasmic reticulurn.

Whether the progression to failure is mediated, in part, by downregulation of SR ca2'-~TPase

gene expression, allowing further pathologie calcium overload, or altematively downregulation is

only a marker of the development of failure awaits mechanistic testmg. Similarly the mechanisms

responsible For initial mduction of gene expression and subsequent trans-repression of the same

gene in myocytes require Çurther study .

4.4 Significance of this study

The technique of quantitative PCR developed in this study to detect cardiac-specific gene

expression levels in human endomyocardial biopsies provides a novel approach to understand the

molecular genetics of human cardiac hypertrophy and hart failure. Variabil ity of cardiac gene

expression beh~een duplicate endomyocardial biopsies has not been studied previously, and

provides insight into [imitations in interpretation of such data. Conclusions concerning the

opha1 number of biopsies required to precisely quantitate gene expression is lirnited by the

small number of patient observed in this shidy. In patients with suspected myocarditis and

dilated cardiomyopathy, SR C ~ " - A T P ~ S ~ gene expression levels positively comlate with right

heart pressures. That the SR C ~ " - A T P ~ S ~ is up-regulated early afier ùifarction in infarcted rat

heart is a new finding. These observations h m human and animal studies may suggest potential

rnechanism(s) of a compensatory responses of the heart to load which differs f?om the findings in

end-stage failing hearts. Irnpomtly, development of the quantitative PCR technique may

provide ways to better understand mechanism(s) underlying cardiac hypertrophy and failure, to

112

monitor changes in respmse to therapeutic medication in Living human bemgs at the level of gene

expression, and to extend the molecular investigation of cardiac disease to the bedside.

References

A f A N, Dhalla NS. Differential changes in leR and nght ventricular SR calcium transport in congestive heart failure. Am J Physiol. 1 992:262 :H868-H874.

Alpert Mt, Mulieri LA. Detenninants of energy utilization in the activated myocardium. Fed fioc. l986;45 :2597-2600.

Anversu P, Hiler B, Bicci R, Guideri G, Olivetti G. Myocyte ceil loss and myocyte hypertrophy in the aging rat heart. J Am Coll Cardial. 1 986;8 : 144 1 - 1448.

Arai M. Alpert NR, Periasamy M. Cloning and characterization of the gene encoding rabbit cardiac calsequestrin. Gene. 1991;109:275-279.

Arai M, Alpert N R MacLennan DJ, Barton P, Periasamy M. Alterations in sarcoplasmic reticulum gene expression in human heart Mure: a possible mechanisrn for alterations in systolic and diastolic propeties of the failhg myocardium. Circ Rex 1993;72:463-469.

Arai M, Otsu K, Mademan DH, Alpert NR, Periasamy M. Effect of thyroid hormone on the expression of mRNA encoding sarcoplasmic reticulum proteins. Circ Res. 199 1 ; 69:266-276.

Ami M, Otsu K, MacLennan DH, Penasamy M. Regulation of sarcoplasrnic reticulum gene expression during cardiac and skeletal muscle development. Am J Physiol. 1992;262:(CelZ Physiol 3 l):C6 14--C620.

Arai M, S d T and Nagai R Sarcoplasmic reticulurn genes are upregulated in mild cardiac hypertrophy but downregulated in severe cardiac hypertmphy induced by pressure overload. J Mol Cell Cardiol. l996;28: 1583- 1590.

Avruch J, Zhang XF and Kyriakis M. Raf meets Ras: completing the framework of a signal transduction pathway . Trenk Biocliem. Sci. 1 994; 1 9:279-2 82.

Bajusz E, Baker JR, Nixon CW, Homberger F. Spontaneous hereditary myocardial degeneration and congestive heart failure in a strain of Syrian hamster. Ann NY Acad Sci. 1969; 156: 1 05- 129.

Bames GE, Horwitz LD, Bishop VS. Reiiability of the maximum denvatives of left ventricular pressure and interna1 diameter as indices of the inotropic state of the depressed myocardium. Cardiovusc Res. 1979; 13:652.

Beekman RE, van Hardeveld V, Simonides WS. Effect of thyroid state on cytosolic kee calcium in resting and electrically stimulated cardiac myocytes. Biochirn Biophys Acta. 1988;969: 18-27.

Beuckelmann DI, Nabauer M, Erdrnann E. intracellular calcium handling in isolated ventrïcular myocytes h m patients wi th terminal heart failure . CircuIation. 1 992;8S : 1 046- 1 05 5.

Bing OHL, Brooks WW, Conrad CH, Sen S. Perreault Cl, Morgan JP. Intracellular calcium transients in myocardium from spontaneously hypertensive rats during the transition to heart failure. Circ Res. I991;68:1390-1400.

Black FM, Packer SE, Parker TG, Michael LH, Roberts R, Schwartz Ri & Schneider MD. The vascular smooth muscle alpha-actin gene is reactivated during cardiac hypemophy provoked by load JCZin Inves. 1991;88:(5):1581-1588.

Bloch W. A biochemical perspective of the polymerase chah reaction. Biochemistq. 199 l;30:2736-2747.

Boluyt MO, O'Neil L, Meredith AL, Bing OHL, Brooks WW, Conrad CH, Crow MT, Lakatta EG. Alterations in cardiac gene expression during the transition from stable hypertrophy to heart failure: marked upregulation of genes encoding extracellular matru< components. Circ Res. l994;75:23-32.

Bowditch HP. Uber die Eigenthumlichkeiten der Reizarbeit, wilche die Muskelfasem des Herzens zergen. Ber Verh der kongiglich sachsischen ges Wissenschaften ni Leipqig. 187 1 ; 23:652.

Brandl CJ, deLeon S, Martin DR, MacLennan DJ. Adult foms of C ~ " - A T P ~ S ~ of sarcoplasmic reticulum: expression in developing skeletal muscle. J Bi01 Chem. 1987; 262L3768-3774.

Brandl VJ, Green NM, Korczak B, MacLeman DJ. Two C~''ATP~S~ genes: homologies and mechanical implications of deduced amino acid sequences. Cell. 1986;44:597-607.

Brilla CG & Maisch B. Regulation of the structural remodelling of the myocardium: nom hypertrophy to heart failure. (Review). Eur Heurt J. 1994; 15(suppl D):45-52.

Brilla CG, Pick EL, Tan LB, Janicki JS, Weber KT. Remodelling of the rat right and lefi ventricle in experimental hypertension. Circ Res. 1 WO;67: 13 55- 1364.

Bdla CG, Rupp H and Maisch B. The renin-angiotensin-aldosterone system and myocardial collagen matrix remodelling in congestive heart failure. Eur Heart J. 1995; 16(supplO): 107- 109.

Brilla CG, Zhou G, Matsubara L, Weber KT. Collagen metabolism in cultured adult rat cardiac fibroblasts: response to angio tensin II and aldosterone. J Mol Ce11 Cardiol. 1 994;26: 809-820.

Brillantes A-M, Allen P, TakahashiT, Inimo S, Marks AR. Differences in cardiac calcium release

115

chamiel (ryanodine receptor) expression m myocardiurn fkom patients with end-stage heart failure caused by ischemic vernis dilated cardiomyopathy. Circ Ra. 1992;7 1 : 18-26.

Broughton A, Komer PI. Steady-state effects of preload and aAerload on isovolumic indices of contractility in autonomically blocked dogs. Cadiovasc Res. 1980; l4:245.

Buccino RA, Harris E, Spann JF Jr, et al. Response of myocardial comective tissue to development of experimtntal hypertrophy. Am J Physiol. l969;2 16:425.

Burch G, Giles T. Senile cardiornyopathy. J Chronic Dis. 197 1 ;24: 1.

Burk SE, Lytton J, MacLennan DH, Shull GE. cDNA cloning, funciional expression, and mRNA tissue disbiiution of a third organellar ~ a ' + pump. J Biol Chem. l989;264: 1586 1 - 1 5868.

Bumett JC. Kao PC, Hu DC, Heser DW, Heublein D, Granger .JP, Opgenorth TJ, Reeder GS. Atrial natriuretic peptide elevation in congestive heart failure in humans. Science 1986;U 1 : 1 145- 1147.

Campbell KP, MacLennan DH. Purification and characterization of the 53,000 dalton glycoprotein from the sarcoplasmic reticulum. J Biol Chem. 198 1 ;256:4626-4632.

Capasso JM, Palackol T, Olivetti G, Anversu P. Lefi ventricular failure induced by long-tm hypertension in rats. Circ Res. l990;66: 1400- 14 12.

Carafoli E. The homeostasis of calcium in heart cells. J nt02 Cell Cardiol. 1985; 1 7:203-2 12.

Carafoli E & Bing RJ. Myocardial failure. J Appl Cardiol. l988;3:3- 18.

Carrier L, Boheler KR, Chassagne C, dela Bastie D, Wisnewsky C, Lakatta EG, Schwartz K. Expression of the sarcomeric actin isogenes in the rat heart with developrnent and senescence. Circ Res. l992;70:999- 1005.

Chelly J, Kaplan JC, Maire P, Gautron S, Kahn A. Nature (London) 1988;333:858-860.

Chien R. Signaling mechanisms for the activation of an embryonic gene program during the hypertrophy of cardiac ventricular muscle. Basic Res Cardiol. 1992;87:49-58.

Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloro fom extraction. Anal Biochern. 1987; 1 62: 156- 1 59.

Conway G, Healitt RA, Fowler NO, Gabel M, Green S. The effect of hyperthyroidism on the sarcoplasmic reticulum and myosin ATPase of dog heart J Mol Cell Curdiol. 1976;8:39-5 1 .

116

Coronado R, Momssette J, Sukhareva M, Vaughan DM. Structure and function of ryanodine receptors. Am J Physiol. l994;266:C 1485-C 1504.

Cory CR, Shen H, O'Brien P.J. Compensatory asymmetry in down-regulahon and inhibition of the rnyocardial ca2' cycle in congestive heart failure produced in dogs by idiopathic dilated cardiomyopathy and rapid ventncular pacing. J Mol Cel Cardiol. 1994;26(2): 173- 1 M.

Cory CR, McCutcheon U, O'Grady M, Pang AW, Geiger JD, O'Brien PI. Compensatory dowuregulation of myocardial ca2+ chan.net in SR From dogs with heart failure. Am J Physiol. l993;264 (3 Pt 2):H926-937.

Davis W. The mitogen-activated protein kinase signal transduction pathway. J Bi01 Chem. l993;268: 14553014556.

de la Bastie D, Levitsky D. Rappaprot L, Mercadier W, Marotte F, Wisnewsky C, Brovkovich V, Schwartz K. Lompre A-M. Function of the sarcoplasmic reticulum and expression of its ca2+- ATPase gene in pressure overload-induced cardiac hyperirophy in the rat. Circ Res. 1 990;66:554-564.

de la Bastie D, Wisnewsky C, Schwqrtz K, Lompre A-M. (ca2' M~*' )dependent ATPase mRNA h m smooth muscle sarcoplasmic reticulurn differs h that in cardiac and fast skeletal muscles. FEBS Lett. l988;229:45-48.

Dhaila NS, Das PK, Sharma GP. Subcellular basis of cardiac contractile failure. JMol Cell Cardiol. 1978; 10:363-385.

Dhalla NS, Dixon IMC, Beanich RE. Biochemical basis of heart hnction and contractile fahre. JAppl Cmdiol. 1991;6:7-30.

Dhalla NS, McNamara DBmand MB. Heart sarcolemma as a dynamic excitable membrane. In The sarcolemma: Recent Advances in Studies on Cardiac Structure and metabolism. Vol. 9, pp. 1-19. Paul-Emile Roy and N.S DhaIla, Eds. Baltimore: University Park Press (1976).

D M a NS, Pierce GN, Panagia V, Singal PK, Bermish RE. Calcium movernents in relation to heart function. Basic Res Cardiol. 1982;77: 1 17-1 39-

Dhalla NS, Ziegelhoffer A, Harrow JAC. Regulatory role of membrane systems in heart function. Canad J Physiol Phar. 1977; 55:1211-1234.

Endo W. Calcium release h m the sarcoplasmic reticulum. Physiol Rev. l997;57:7 1-1 08.

EngeImann GL, Vitullo JC, Gemty RG. Morphometric analysis of cardiac hypertrophy during development, maturation, and senescence in spontaneously hypertensive rats. Cire Res. 1 987;60:487494.

Fabiato A. Calcium-induced release of calcium h m the cardiac sarcoplasmic reticulum. Am J Physiol. 1 983;24S(Cell Phvsiol 14):C 1 C 14.

Feldman AM, Ray PE, Silan CM, Merce JA, Minobe W. Bristow MR. Selective gene expression in failing human heart: quantification of steady-state levels of messenger RNA in endomyocardial biopsies using the polymerase chain reaction. Circulation. 1 99 1 $3 : 1 866- 1 8 72.

Fifer MA, Bourdillon PD, Lorell BH. Altered lefi ventricular diastolic properties during pacing- induced angina in patients with aortic stenosis. Circulation. 1986; 74:675-683.

Fine A, Goldstein RH. The effect of transfortning growth factor-6 on ce11 proliferation and collagen fornation by lung fibroblasts. J Biol Chem. l987;262:3897-3902.

Flesch M, Schwinger RH, schnabel P, Schiffer F, van Gelder 1, Bavendiek U, Sudkamp M, Kuhn- Regnier F, Bohm M. Sarcoplasmic reticulum ~ a ' - - ~ ~ ~ a s e and phospholamban mRNA and protein levels in end-stage heart failure due to ischemic or dilated cardiomyopathy. J Mol Med. 1996;74(6):32 1-332.

Fliegel L, Burns K, Opas M, Michalak M. The high-affïnity calcium binding protein of sarcoplasmic reticulum: tissue distribution, and homology with calregulin. Biochim Biophys Acta. 1989;982: 1-8.

Fliegel L, Leberer E, Green NM, MacLennan DH. The fast-twitch muscle calsequestrin isofom predominates in rabbit slow-twitch soleus muscle. FEBS Zen 1989;242:297-300.

Fliegel L, Ohnishi M, Carpenter MR, Khanna VK, Reithmeir RAF, Mademan DH. Amino acid sequence of fast-twitch skeletal muscle calsequestrin deduced kom cDNA and peptide sequencing. Proc Nat1 Acad Sci USA. 1 987;84: 1 167- 1 17 1.

Furuichi TS, Yoshikawa A, Miyawaki K, Maeda WN, Mikoshiba K. Pnmary structure and fûnctional expression of the inositol 1,4,5-trisphophate-binding protein P400. Nature (Zond). 1989;342:32-3 8.

Geistefer-Lowrance AAT, Kass S. Tanigawa T, Vosberg HP, McKanne W, Seidman CE, Seidman JG (1990). A molecular basis for familial hypertrophie cardiomyopathy: a P-cardiac myosin heavy chai. gene missense mutation. Cell62:999- 1006.

Gibbs CL, Wendt IR, Kotsanas G, Young IR. Mechanical, energetic, and biochemical changes in I l8

long-terni volume overload of rabbit heart. Am J Physiol. 1992;262:H8 19-H827.

Gibbs RA. DNA amplification by the polymerase chah reaction. Anal Chenr. 199O;62: 1202- 1214,

Gilliland G, Perrin S, Blanchard K, and Bunn F. Analysis of cytokine mRNA and DNA: Detection and quantitation by cornpetitive polymerase chain reaction. Proc Notl Acad Sci USA. 1990;87:2725-2729.

Gleason WL, Braunwald E. Studies on the fint derivative of the ventncular pressure pulse in man. J Clin Invest. 1962; 4 1 $0-9 1.

Go LO, MoschelIa MC, Watras J, Handa KK, Fyfe BS, Marks AR. Differential regdation of two types of intraceliular calcium release charnels during end-stage heart failure. J C h Invest. 1995;95:888-894.

Golsstein RH, Poliks CF, Pilch PF, Smith BD, Fine A. Stimulation of collagen formation by insulin and insulin-like growth factor 1 in cultures of human Iung fibroblasts. Endocrinology. 1989; 124:964-970.

Goodkind MJ, Damback GR, Thrum PT, Luchi M. Effect of thyroxin on ventricular myocardial conûac tility and ATPase activity in guinea pig. Am J P hysiol. 1974;226:66-72.

Green NK, Gammage MD, Franklyn JA, Sheppard MC. Regdation by thyroid status of c-mye, c- fos. and H-ras mRNAs in the rat myocardium. J Endocrinol. 1 99 1 ; 1 30:239-244.

Grossman W. Diastolic dyshuiction and congestive heart failure. Circulation. 1990;8 l(supp1 I I I ) : III- 1-111-7.

Grossman W, et al: Alterations in preload and myocardial mechanics. Circ Res. 1972; 3 1 :83.

Grossman W, McLaurin LP. Diastolic properties of the left ventricle. Ann Intern Med 1976; 84:3 16.

Grossman W. Cardiac hypertrophy: usehl adaptation or pathological process? Ant JMed. 1980; 49576-584.

Gwathmey JK, Copelas L, Makinnon R, Shoen FJ, Feldman MD, Grosman W, Morgan P. Abnomial intracellular calcium handling in myocardium fiom patients with end-stage heart failure. Circ Res. l987;6 1 :70-76.

Hasenfuss G, Mulieri LA, Blanchard EM, Holubarsch C, Leavitt BI, Ittleman F, Alpert NR.

119

Energetics of isometric force development in control and volume-overload human myocardium: cornparison with animal species. Circ Res. 1 99 1 ;68:836-846.

Hasenfuss G, Mulieri LA, Leavitt BJ, Allen PD, Haeberle JR, Alpert NR. Alteration of contractile function and excitation-contraction coupling in dilated cardiomyopathy. Circ Res. I992;7O: 1225-1 232.

Hasselbach N. Relaxing factor and the relaxation of muscle. Prog Biophys Mol Biol. 1 964; 14: 1 67- 222.

Hewett TE, Grupp IL, Grupp G, Robbins S. Alpha-skeletal actin is associated with increased contractility in the mouse heart. Circ Res. l994;74(4)740-746.

Iwaki K, Sukhatme VP, Shubeita HE, Chien KR. a and adrenergic stimulation induce distinct patterns of immediate early gene expression in neonatal rat myocardial cells: fos/jun expression is associated with sarcomere assembly ; Egr- 1 induction is primady an a 1 mediated response. J Biol Chem. 1990; 265:13809-138177.

Ho KKL, Anderson KM, Kannel WB, et al. S u ~ v a l aRer the onset of congestive heart failure in Framingham Heart Study subjects. Circulation. 1 993;88: 107- 1 1 5.

Izumo S, Lompre AM, Matsuoaka R, et al. Myosin heavy chah messenger RNA and protein isoform transitions during cardiac hypertrophy . J Clin Invert. 1 987;79:970-977.

Izumo S, Nadal-Ginard B, Mahdavi V. Proto-oncogene induction and reprogramming of cardiac gene expression produced by pressure overload. Proc Nail Acad Sci. USA. 1 988;85:339-343.

Jouannot P, Hatt PY. Rat myocardial mechanics during pressure induced hypertrophy development and reversal. AM J Physiol. 1 975; 229:H355-H364.

Kanangat S, Solomon A, Rouse B.T. Use of quantitative polymerase cham reaction to quantitate cytokine messenger RNA molecules. Mol Imrnunol. l992;29(No. 1 0): 1 229- 1 23 6.

Kanda T, Nakano M, Arai M, Yamamoto A, S h i T, Murata K. Myocardial atrial natriuretic factor gene expression afier coronary Iigation in rats. Exp Clin Endocrinol. 1993; 10 l(3): 1 73- 177.

Kamel WB, Ho KKL. Thom T. Changing epidemiological leahires of cardiac failure. Br H m J. 1994;72:S3-S9.

Kannel WB, Pinsky J. Trends in cardiac failure: incidence and cause over three decades in the Framingham Study. J Am Coll Cardiol. 199 1 ; 1 7:87A. Abstract.

Katz A M. Cardiomyopathy of overload: A major deteminant of prognosis in congestive hart failure. N Engl J Med. 2 990; 3 22: 1 00- 1 1 0.

Katz AM. The cardiomyopathy of ovedoad: an unnatuni1 growth response. Eur Heurt J. 1995; 16 (Suppl0):llO-114.

Kimura Y, Otsu K, Nishida K, Kuniya T, Tada M. Thyroid hormone enhances ca2' pumping activity of the cardiac sarcoplasmic reticulum by increasing ca2'- ATPase and decreasing phospholamban expression. J Mol Ce1 Cardiol. 1 994;26(9): 1 1 45- 1 1 54.

Kirchberger MA, Tada M, Katz AM. Adenosine 3',5'-monophosphate-dependent protein kinase-catalyzed phosphorylation reaction and its relationship to calcium transport in cardiac sarcoplasrnic reticulum. J Biol Chem. l974;249:6 166-6 1 73.

Kiss E, Bal1 NA, Kranias EG, Walsh RA. Differential changes in cardiac phospholamban and sarcoplasmic reticular ca2+- ATPase protein levels. Effects on ca2' transport and mechanics in compensated pressure-overioad hypertrophy and congestive heart failure. Circ Res. i 995; 77(4):759-764.

Knowlton KU, Baracchini E, Ross RS, et al. Co-regulation of the aaial natriuretic factor and cardiac myosin light chah-2 genes during a-adrenegic s timuiation of neonatal rat vennicualr cells. J Biol Chem- 199 1 ; 266:7759-7768.

Knowlton KU, Michael M, Shubeita J. et al. The alA-receptor subtype mediates biochemical, molecular, and rnorphologic features of cultured rnyocardial ce11 hypertrophy. J Biol Chem (in press).

Komuro 1, Kurabayashi M, Shibazaki Y, Takaku F, Yazaki Y. Molecular cloning and characterization of a ca2' NIg'*-dependent adenosine triphosphatase From rat cardiac sarcoplasmic reticulum: regulation of its expression by pressure overload and developmental stage. J Clin Inver. l989;83: 1 102-1 108.

Komuro 1, Kurabayashi M, Takaku F, Yazaki Y. Expression of cellular oncogenes in the myocardiu. during the developmental stage and pressure-overloaded hypertrophy of the rat heart. Cire Res. 1988;62: 1075-1 079.

Kusuoka H, Futaki S, Koretsune Y, Kitabatake A, Suga H, Kimada T, houe M. Alterations of intracellular calcium homeostasis and myocardial energetics in acute afiamycin-induced heart Mure. J Cardiovasc Pharmacol. 1 99 1 ; 1 8:437-444.

Lamers JHJ, Stinis JT. Defective calcium pump in the sarcoplasmic reticulum of the hyperirophied rabbit heart. Life Sci. 1979;24:23 13-2320.

12 1

Langer GA. Events at the cardiac sarcolemma: localization and movement of contractile- dependent calcium. Fedn Prec. 1 976;3 5 : 1 274- 1 278.

Lecarpentier Y, Martin JL, Gastineau P. Hatt PY. Load dependence of marnmalian heart relaxation during cardiac hypertrophy and failure. Am J P hysiol. 1 982; 242 : H8S 5-H86 1.

Lecarpentier Y, Riou B, Clergue M. Lambert F, Chemla D. The contraction-relaxation coupling during pressure-induced cardiac hypertrophy. Eur Heurt J. 1990; 1 1 (suppl G):46-53.

Lecarpeutier Y, Waldenstrom A, Clergue M, C h d a D, Oliviero P, Martin JL, Swynghedauw B. Major alterations in relaxation during cardiac hypertrophy induced by aortic stenosis in guinea pig. Circ Res. l987;6 1 : 1 07- 1 16.

Lembo G, Hunter JJ & Chien KR. Singnaling pathways for cardiac growth and hypertrophy: Recent advances and prospects for growth factor therapy. Ana NY Acad Sci. 1995;752: 1 15-1 27.

Levi* D, de la Bastie D, Schwartz K, Lompre A-M. caZ'- ATPase and function of sarcoplasmic reticulum during cardiac hypertrophy . Am J Physiol. 1 99 1 ; 26 1 (suppl) :23-26.

Limas CJ. Calcium transport ATPase of cardiac sarcoplasmic reticulum in expenmental hyperthyroidism. Am J Physiol lW8;235:H745-H7S 1 .

Limas CJ, Spier SS, Kahlon J. Enhanced calcium transport by sarcoplasmic reticulum in mild cardiac hypertrophy . J Mol1 Cell Cardiol. 1980; 1 2: 1 1 03- 1 1 1 6.

Linck B, Boknik P, Eschenhagen T, Muller FU, Neumann J, Nose M, Jones LR, Schmitz W, Scholz H. Messenger RNA expression and immunological quantification of phospholarnban and SR ca2+- ATPase in failing and nonfaiiing human hem. Cordiovas Res. 1 996;3 1 (4):625-632.

Lindpaintner K, Lu W, Neidermaier N, Schieffer B, Just H, Ganten D, Drexler H. Selective activation of cardiac angiotensinogen gene expression in pst-infarc tion ventricular remodelling in the rat. J Mol Cell Cardiol. 1993;25(2): 133- 143.

Lompre AM, Lambert F, Lakatta EG, Schwartz K. Expression of sarcoplasmic reticulum ca2'- ATPase and calsequesûin genes in rat heart during ontogenic development and aging. Circ Res. 1991;69:1380-1388.

Lompre AM, Mercadier JJ, Schwartz K. Changes in gene expression during cardiac growth. inter Rev C'OZ. 1990; 124: 137-186.

Lorell BH, Grossman W. Cardiac hypertrophy : the consequences for diastole. J Am col1 Cardiol.

122

Lytton J & MacLennan DH. Sarcoplasmic reticulum. In: Fozzard HA, haber E, Jennings RB, Katz AM, Morgan HE, eds. TIte HeuH and CurdiovascuIar System. 2nd ed. New York, NY: Raven Press Publishers; 1992: 1203- 1222.

Lytton J, Zarain-Hertzberg A, Periasamy M, MacLennan DH. Molecular cloning of the mammaIian smooth muscle sarco(endo)plasmic reticulum c a 2 + - ~ ~ p a s e . J Bi01 Chem. 1 989;264:7059-7065.

Maciel LMZ, Polikat R, Rohrer D, Popovich BK, Dillmann WH. Age-induced decreases in the messenger RNA coding for the sarcoplasmic reticulum ca2+-~'T'~a.se of the rat hem. Circ Res. 1990; 67~230-234.

MacKinnon Et, Morgan P. Influence of the thyroid state on the calcium transient in ventricular muscle. mgers Arch. 1986;407: 142- 144.

Marks AR, Tempst P, Chadwick C, Riviere L, Fleischer S, Nadal-Ginard B. Smooth muscle and brain inositol 1,4,5-trisphophate recepton are stmcturally and functionally similar. J Biol Chem. 1990;265: 1-4.

Marks AR, Tempst P, Hwang KS, Taubman MB, Inui M, Chadwick C, Fleischer S, Nadal- Ginard B. Molecular cloning and characterization of the ryanodine receptor/junctional chamel complex cDNA h m skeletal muscle sarcoplasmic reticulum. Proc Natl Acad Sci USA. 1989;86:8683-8687.

Matsui H, MacLennan DH, Alpert NR, Penasamy M. Sarcoplasmic reticulum gene expression in pressure overload-induced cardiac hypertmphy in rabbit. Ani J Physiol. 1 995;268(1 P t 1):C252- 258.

Mayer Y, Czosnek J, Zeelon PE, Nudel U. Expression of the genes coding for the skeletal muscle and cardiac ac tin in the heart . Nucl Acids Res. 1 984; 1 2: 1 087- 1 1 00.

McKee PA, Castelli WP, McNamara PM, et al. The natural history of congestive heart failur: the Framingham Study. NEngl JMed. 1971:285:1441-1446.McNutt XS. Ultrastructure of the myocardial sarcolermna. Circ Res. 1975; 37: 1- 13.

Mercadier J-J, Lompre AM, Duc P, Bohler KR, Frays J-B, Wisnewsky C, Allen PD, Komajda M, Schwartz K. Altered sarcoplasmic reticulum ~ a " - ATPase gene expression in the human ventricle during end-stage heart failure. J C h Invat. 1 99O;85 :3 05-3 09.

Mercadier J-J, Samuel JL, Michel J-B, Zongazo M-A dela Bastie K, Lompre A-M Wisnewsky

123

C, Rappaport L, Levy B, Schwartz K. Atrial natnuretic factor gene expression in rat ventricle during experimental hypertension. Anr Jphysiol. 1 989;257:H979-H987.

Michalak M, Campbell KP, MacLennan DH. Localization of the hi& affmity calcium binding protein and an intnnsic glycoprotein in sarcoplasmic reticulum membranes. J Biol Chem. l98O;2S5: 13 17- 1326.

Moe GW, Angus C, Howard RI, Parker TG & Armstrong PW. Evaluation of indices of leR ventricular contractility and relaxation mvolving canine experimental heart failure. Curdiovmc Res. 1992;26:362-366.

Morgan JP, Emy RE, Allen PD, Grossman W, Gwathmey JK. Abnomal intracellular calcium handling, a major cause of systolic and diastolic dysfunction in ventricular myocardium from patients with heart failure. Circulation. l99O;8 1 (suppl III): 111-2 1-111-32.

Morioka S, Honda M, Ishikaqa S, Ishinage Y, Yano S, Tanaka K, Monyama K. Changes in contractile and non-contractile proteins, intracellular ca2' and ultrastructures during the development of right ventricular hypertrophy and failure in rats. Jpn Circ J. 1992156:469-474.

Moschella M and Marks A. Inositol 1,4,5-triphosphate receptor expression in cardiac myocytes. J Cell Biol. 1993; 120: 1 137- 1 146.

Movsesian MA, Bristow MEt, Kra11 J. Calcium uptake by cardiac sarcoplasmic reticulum fiom patients with ideopathic dilated cardiomyopathy. C h Res. 1987;65 : 1 14 1 - 1 144.

Murray MT, White K. Munro JN. Conservation of femtin subunit structure: Implications for the regulation of femtin gene expression. Proc Nad Acad Sci USA. 1987;84:7438-7442.

Nadal-Ginard B, Mahdavi V. Molecular basis of cardiac performance:Plasticity of the myocardium generated through pro tien iso fom switches. J Clin Inve.sf. 1 989; 84: 1 693 - 1 700.

Nagai R, Zarain-Herzberg A, Brand1 DJ, Fujii J, Ta& M, MacLennan DH, Alpert NR, Periasamy M. Regulation of myocardial C ~ " - A T P ~ S ~ and phospholamban mRNA expression in response to pressure overload and thyroid hormone. Proc Nat1 Acad Sci U S A. 1989;86:2966- 2970.

Neyses L & Pelzer T. The biological cascade leading to cardiac hypertrophy. Eur Heurt 1995; 16 [Suppl N):8- 1 1.

Nuss HB, Houser SR. Voltage dependence of contraction and calcium current in severely hypertrophied f e h e ventricular myocytes. J Mol Ce11 Cardiol. 199 1 ;23:7 17-726.

O'Brien PJ, Moe GW, Nowack LM, Grima EA, Armstrong PW. Sarcoplasmic reticulum ~ a - " release channel and ATPase-synthesis activities are early myocardiat markers of heart failure produced by rapid ventricular pacing in dogs. Con J Phosiol Phamcol . 1 994;72(9):999- 1 006.

Olson HM, Young DM, Pneur DJ, LeRoy AF, Reagan RL. Electrolyte and morphological alterations of myocardium in ahiamycin-treated rabbits. Am J Pathol. 1 974;77:439-454.

Opie LH. Intracellular ca22+ fluxes and sarcoplasmic reticulum. In : The heart. Physiology und metabolism (Opie L H . Ed.) Raven Press. New York, 199 1 : 127- 146.

Orenstein TL,, Parker TG, Butany N , Goodman IM, Dawood F, Wen WH, Wee L, Martino T, McLaughlin PR & Liu P. Favorable lefl ventricular remodeIlhg following large myocardial infarction by exercise training: eflect on ventncular morphology and gene expression. J Clin lnvest. 1995;96:858-866.

Otsu K., Willard HF, Khama VK, Zorzato F, GreenN, MacLennan DH. Molecular cloning of cDNA encoding the ca2'-release channel (ryanodine receptor) of rabbit cardiac muscle sarcoplasmic reticulum. J Biol Chem. 1990;265: 13472- 13483.

Pagant ED, Alousi AA, Grant AM, Older TM, Dziuban SW Jr, Allen PD. Changes in myofibrillar content and M$' -ATPase activity in ventncular tissues nom patients with heart failure caused by coronary artery disease, cardiomyopathy, or mitrai valve insuficiency. Circ Ra. 1988;63:380-385.

Parker TG. Molecular biology of cardiac growth and hypertrophy. Herr. 1993; 18:245-255 (Nr.4).

Parker TG, Chow KL, Schwartz RJ & Schneider MD. Dif'ferential regulation of skeletal a-actin transcription in cardiac muscle by two fibroblast growth factors. Proc Nat Acad Sci (Wà.sh). lWO;87:7066.

Parker TG, Chow KL, Schwartz RI & Schneider MD. Positive and negative control of the skeletal a-actin promoter in cardiac muscle. J Bi01 Chem. l992;267:3343.

Parker TG, Schneider MD. Growth factors, proto-oncogenes, and plasticity of' the cardiac genome. Ann Rev Physiol 1 99 1 ;53 : 1 79.

Parker TG, Schneider MD. Peptide growth factors can provoke " fetal" contractile protein gene expression in rat cardiac myocytes. J Clin Invest. 1990;85:507.

Parker TG & Vijan S. Regdation of human Fmyosin heavy chain transcription by tcansforming

growth factor 1 and nuclear proto-oncogenes (abstract). Circulation. I992;86: 1400.

Raff GL, Glantz SA. Volume loading slows left ventricular isovolumic relaxation rate. Circ Res. 1981; 48:813.

Rannou F, Dambnn G, Marty 1, Carre F, Prouve P, Lornpre AM, Charlemagne D. Expression of the cardiac ryanodine receptor in the compensated phase of hypertrophy in rat heart. Cardiovasc Res. I 995;32(2):238-255.

Rappolee DA, Mark D, Banda MJ Werb 2. Science 1988;241:708-7 12.

Reiss K, Capasso JM, Huano HE, Meggs LG, Li P, Aversa P. h g II receptors, c-myc, and c-jun in myocytes afler myocardial infarction and ventricular failure. Am J Physiol. 1 993 ;264 (3 Pt 2):H760-769.

Reiss K, Meggs LG, Li P, Olivette G, Capasso JM, Anversa P. Upregulation of IGF1 -receptor and late growth related genes in ventricular myocytes acutely after infarction in rats. J Cell Physiol. 1994;158(1):160-168.

Riabowol KT, Vosatka RJ, Ziff EB, Lamb NJ, Feramisco IR. Microinjection of fos-specific antibodies blocks DNA synthesis in fibroblast cells. Mol Cell Biol. l988;8: 1 670- 1676.

Rohrer D, Dillmann WH. Thyroid hormone markedly increases the mRNA coding for sarcoplasmic reticulum c~ '+-ATP~s~ in rat heart. J Bi01 Chem. 1988;263:694 1-6944.

Sadoshima J, Xu Y, Slayter HS & Izumo S. A u t o c ~ e release of angiotensin II mediates stretch- induced hypertrophy of cardiac myocytes in vitro. Cell. 1993; 75:977-984.

Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA. Primer- directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988;239:487-49 1.

Sambrook I, Fritsch EF, Maniatis T: Molecular cloning. New York, Cold Spring Harbor Laboratory Press, 1989.

Sapp JL, Howlett SE. Density of ryanodine receptors is increased in sarcoplasmic reticulum from prehypertrophic cardiomy opathic hamster heart . J Mol Cel Cardiol. 1 994;26(3) :325-3 34.

Sasayama S, Nonoogi H, Miyazaki S, et al. Changes in diastolic properties of the regional myocardium during pacing-induced isc hemia in hurnan subjects. J Am Col1 Cardiol. 1 98 5;5:599.

Schiaffino S. Samuel JL, Sassoon D, et al. Uncoordinated accumulation of a-skeletal actin and 126

rnyosin heavy chah mRNAs during early stages of pressure overload-induced cardiac hypertmphy demonstrated b y in situ hybridization. Cire Res. 1 989; 6 W 3 7-948.

Schneider MD & Olson EN. Control of myogenic differentiation by cellular oncogenes. Molec h'eurobiol. l988;2: 1.

Schneider MD & Parker TG. Cardiac myocytes as targets for peptide growth factors. Circulation. 1 9W;8 1 : 1443.

Schwartz K. (1990) Phenoconversion and mechanogenic transduction of the mamalian hem. Medicindscience 6564-673.

Schwartz K, Boheler KR, de la Bastie D,et al. Switches in cardiac muscle gene expression as result of pressure and volume overload. Am J Physiol. 1 994; 262:R364-369.

Schwartz K, Chassagne C, Boheler KR. The rnolecular biology of heart failure (Review). J Am Col1 Curdiol. 1 993;22(suppl A):30A-33 A.

Schwartz K, de la Bastie D, Bouveret P, et al. a-Skeietal actin -As accumulate in hypertrophiecl adult rat hearts. Circ Res. l986;59:5S 1-555.

Schwartz K, Lompre Am, Lacombe G, Bouveret P, Wisnewsky C, Whalen RG, D'Albis A, Swynghedaw W. Cardiac rnyosin isozymic transitions in mammals. In: Alpert NR, ed. Perspectives in CardiovascuIur Reseurch. New York, NY: Raven Press Publishers; 1983;7:345- 358.

Schwrtzkopff B, Uhre B, Ehle B, Losse B, Frenzel H. Variability and reproducibility of morphologie findings in endomyocardial biopsies of patients with hypertrophie obstructive cardiomyopathy. Zeir~chrifi fur kurdiologie. 1987;76:suppl3:26-32.

Schwinger RH, Bohm M, Schmidt U, Karczewski P, Bavendiek U, Flesch M, Krause EG, Erdniann E. Unchanged protein Ievels of SERCA II and phospholamban but reduced CaZC uptake and c~' '-ATP~s~ activity of cardiac sarcoplasmic reticulum from dilated cardiomyopathy patients compared with patients with nonfailing hearts. Circulation. 1995;92(11):3220-3228.

Sen S, Tarazi RC, khairallah PA,Bumpus FM. Cardiac hypertrophy in spontaneously hypertensive rats. Cardiovarc Res. 1974; 35:775-781.

Shen J, Mirsalimi SM, Weiler JE, Julian RJ, O'Brien PJ. Effects of mild cardiac hypertrophy, induced by volume overload in turkeys, on myocardial sarcoplasmic reticulum calcium-pump and calcium-channel activities and on the creatine kinase system. Am J Vet Ra. 1 99 1 ;52: 1527- 1530.

127

Shubeita HE, Martinson E, Van Bilson M, Chien KR, Brown IH. Expression of a constitutively active protein kinase C gene activates the transcription of the ANF and MLC-2 genes in culhired myocardial cells. Proc Nutl Acad Sci USA. 1 W2;89: 1 305- 1 309.

Sin FM, Krueger J, Nordin C, Ming 2, Aronson RS. Depresseci intracellular calcium trmsients and contraction in myocytes fiom hypertrophied and fading guinea pig hearts. Am J Physiol. 1 99 l;26 1 :H5 14-H530.

Skelton CL, Su JY, Pool PE. Influence of hyperthyroidism on glycerol-extracted cardiac muscle h m rabbits. Cardiovasc Res. 1976; 10:380-384.

Sommer IR, Jennings RB. Ultrastructure of cardiac muscle. In: Fovard HA, haber E, Jemings RB, Katz AM, Morgan HE, eds. The Heurt and Cardiovnsnrlm System. 2nd ed. New York, NY: Raven Press Publishers; I 992:3-50.

Suko J. The calcuim pump of cardiac sarcoplasmic reticulum: FMctional alteratsons at different levels of thyroid state in rabbits. J Physiol flond). 1973;228:563-582.

Sutoh K. Identification of myosin-binding sites on the actin sequeme. Biochemirtry. l982;2 1 :3657-366 1.

Takahashi T, Allen PD, 1-0 S. Expression of A-, B-. and C-type natriuretic peptide genes in failing and developing human ventricles:correlation with expression of the c~ ' - -ATP~s~ gene. Circ Res, 1 WZ;7 1 :9- 1 7.

Takahashi T, Allen PD, Lacro RV, Marks AR, Dennis AR, Schoen FJ. Grossman FJ, Grossman W, Marsh JD, Izumo S. Expression of dihyfropyridine receptor (ca2- channel) and calsequeshin genes ni the myocardium of patients with end-stage heart failure. J Clin Invat. 1992;90:927-935.

Takahashi T, Schunkkert H, Isoyarna S, et al . Age-related differences in the expression of proto- oncogenes and contractile proiein genes in response to pressure overload in the rat rnyocardim. J Clin Invest. 1992; 89:936-946-

Tanigawa G, Jarcho JA, Kass S, Solomon SD, Vosberg H-P, Seidman JG, Seidman CE (1990). A molecular basis for familial hypertrophie cardiomyopathy: an C@ cardiac rnyosin heavy chain hybrid gene. Ce11 62:99 1 -998.

Thorburn J, Carlson M, Mansour SJ, Chien KR, Ahn NG & Thorburn A. Inhibition of a signaling pathway in cardiac muscle cells by active mitogenactivated protein kinase kinase. Mol Bi01 Cell. 1 M ; 6 : 147% 1490.

Thorbum A, Thorburn J, Chen SY, et ni. H-Ras dependent pathways can activate morphological and genetic markers of cardiac muscle ce11 hypertrophy. JBiol Chem. 19931 268:2244-2249.

Tomplisin CW, Godin DB, Rabkin S W. Adnarnycin cardiomyopathy: implication of cellular changes in a canine mode1 with mild impairment of le fi ventricular fùnc tion. Biochem Pharmacol. 1985;34:4033-404 1.

Tsoporis JN, Marks A, Kahn KJ, Butany W. Liu PP, O'Hanlon D, Parker TG. S lOOp inhibits a 1 -adrenergic induction of the hypertrophic p henotype in cardiac myoc ytes. J Biol Chem (in press).

Unverferth DV, Lee SW, Wallick ET. Human myocardial adenosine triphosphate activities m health and heart failure. Am Heart J. 1 988; 1 1 5: 1 39- 146.

Van Bilsen M & Chien KR. Growth and hypertrophy of the heart: towards an understanding of cardiac specific and inducible gene expression. Cardiovasc Res. 1 993; 27: 1 140- 1 149.

Vandekerckhove .J Weber K. The complete amho acid sequence of actins from bovine aorta, bovine heart, bovine fast skeletal muscle, and rabbit slow skeletal muscle. Drfferenliatiorz. 1979; l4:123-133.

Wang AM, Doyle MV, Mark DF. Quantitation of rnRNA by the polymerase chain reaction. h o c Nad Acad Sci U SA,. 1989;86:97 17-972 1.

Wallace AG, Skinner NS, Mitchell JH. Hemodynamic detertninants of the maximal rate of rise of le ft ventricular pressure. Am J Physiol. 1963 ; 205:30.

Weber KT, Clark WA, Janicki JS, Shroff SG. Physiologic versus pathologic hypertrophy and the preswe-overload myocardiurn. J Cardiovasc Pham. 1987; 10:S37-S49.

Weber KT, Janicki JS. The heart as a muscle-pump system and the concept of heart failure. Am Heart J. 1979;98:371.

Weber KT, Janicki JS, Pick R, Capasso J, Anversa P. Myocardial fibrosis and pathologic hypertrophy in the rat with renovascular hypertension. Ani J CardioZ. I990;65: 1 G-7G.

Whitmer JT, Kumar P, Solaro TU. Calcium transport properties of cardiac sarcoplasmic reticulum from cardiomyopathie Syrian hamsters (BI0 53 S8 and 14.6): evidence for a quantitative defect in dilated myopathie hearts not evident in hypertrophic hearts. Circ R a . 1 988; 62:8 1-85.

Zarain-Herzberg A, Afzal N, Elimban V, Dhalla NS. Decreased expression of cardiac sarcoplasmic reticulum ~ a ' ' ~ ~ ~ a s e - ~ u m ~ ATPase in congestive heart failure due to myocardial

129

infàrction. Mo2 Ce2 Biochem. 1996; 16% l64:285-290.

Zarain-Herzberg A, MacLennan DH, Periasamy M. Characterization of rabbit cardiac sarco(endo)plasmic reticulum C ~ ~ * A T P ~ S ~ gene. J Biol Chem. 1 990;265:467O-4677.

Zarain-Herzberg A, Y ano K, Elirnban V, DhalIa NS. Cardiac sarcoplasmic reticulum ca2+-~TPase expression in streptozocin-induced diabetic rat heart. Biochem Biophys Res Comm. 1994;203(l): 1 13-1 20.

Zierhut W, Zimmer HG. Significance of myocardial a- and adrenoceptors in catecholamine- induced cardiac hypertrophy. Circ Ra. 1989; 65: 1417-1425.

Zirnpfer M, Vatner SF. Effects of acute increases in left venûicular preload in indices of myocardial Function in conscious, unrestrained and intact, tranquilized baboons. J Clin Invest. 198 1 ; 67:430.

Zorzato F, Fujii J, Otsu K, et al. Molecular cloning of cDNA encoding human and rabbit forms of the ca2' release channel (ryanodine receptor) skeletal muscle sarcoplasmic reticulum. J Biol Chem, 1 !WO;265:2244-2256.