1

M3:13491

April 30, 2004

ppGpp-dependent stationary phase induction of genes on Salmonella pathogenicity

island 1 (SPI1)

Miryoung Song,1,2 Hyun-Ju Kim, 1,2 Eun Young Kim, 1,2 Minsang Shin, 1,2 Hyun

Chul Lee, 1,2 Yeongjin Hong, 1,2 Joon Haeng Rhee, 1,2 Sangryeol Ryu, 3 Sangyong

Lim, 3 Hyon E. Choy1,2,4

1 Genome Research Center for Enteropathogenic Bacteria and Research Institute of

Vibrio Infection

2Department of Microbiology, Chonnam National University Medical College,

Kwangju 501-746, South Korea

3 Department of Food Science and Technology, School of Agricultural Biotechnology,

Center for Agricultural Biomaterials, Seoul National University, Seoul, 151-742, South

Korea

4 Corresponding author

Hyon E. Choy

Department of Microbiology,

Chonnam National University Medical College,

Kwangju 501-746, South Korea

Tel) +82 62 220 4137

Fax) +82 62 228 7294

e.mail) hyonchoy@chonnam.ac.kr

JBC Papers in Press. Published on May 25, 2004 as Manuscript M313491200

Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

2

We have examined expression of the genes on Salmonella pathogenicity island 1 (SPI1)

during growth under the physiologically well-defined standard growth condition of LB

medium with aeration. We found that the central regulator hilA and the genes under its

control are expressed at the onset of stationary phase. Interestingly, two-component

regulatory genes, hilC/hilD, sirA/barA ,and ompR, known to modulate expression from

the hilA promoter (hilAp) under so-called ‘inducing conditions (LB medium containing

0.3 M NaCl without aeration)’ acted under standard conditions at the stationary phase

induction level. The induction of hilAp depended not on RpoS, the stationary phase

sigma factor, but on the stringent signal molecule, ppGpp. In the ppGpp null mutant

background, hilAp showed absolutely no activity. The stationary phase induction of

hilAp required spoT but not relA. Consistent with this requirement, hilAp was also

induced by carbon source deprivation, which is known to transiently elevate ppGpp

mediated by spoT function. The observation that amino acid starvation elicited by

addition of serine hydroxamate did not induce hilAp in a RelA+ SpoT+ strain suggested

that in addition to ppGpp some other alteration accompanying entry into stationary

phase might be necessary for induction. It is speculated that during the course of

infection, Salmonella encounters various stressful environments that are sensed and

translated to the intracellular signal, ppGpp, that allows expression of Salmoenella

virulence genes including SPI1 genes.

[key words: Stringent response, ppGpp, Transcription regulation, Salmonella

pathogenicity island 1 genes]

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

3

Infection with Salmonella enterica serovar Typhimurium can cause a systemic,

typhoid-like disease in mice. Following ingestion, bacteria can colonize the intestinal

tract, penetrate the intestinal epithelium, and access systemic sites such as the spleen and

liver through lymphatic and blood circulation (1). Passage of the bacteria through the

intestinal lining is initiated by bacterial invasion into enterocytes and M cells (1, 2, 3, 4).

The invasion is mediated by a bacterial type III secretion system (TTSS) encoded by

genes on Salmonella pathogenicity island 1 (SPI1) (5). The TTSS translocates

bacterial effector proteins, also encoded on SPI, into the host cell cytosol to reorganize

the cytoskeleton, resulting in membrane ruffling and eventual bacterial uptake (6).

Expression of the SPI1 secretion system and of its secreted effectors is coordinately

regulated by HilA encoded on SPI1, a member of the OmpR/ToxR family of

transcriptional regulators (7). The genes on SPI1 regulated by HilA include invF and

sicA (8, 9, 10). InvF, a member of the AraC/XylS family of transcriptional regulators,

in conjunction with SicA, a TTSS chaperone, take part in the coordinated regulation of

SPI1 encoded genes.

Regulation of hilA expression has been studied extensively because of its

central role in invasion gene activation. Environmental signals, like oxygen

concentration and osmolarity, and the growth state of bacteria, have been shown to

influence the expression of hilA and the secretion of invasion-associated proteins (11,

12). Thus, most studies have been carried out using bacteria grown under so called

inducing conditions, namely high osmolarity and low oxygen conditions (LB containing

0.3 M NaCl without aeration). Studies of bacteria grown under these conditions have

so far revealed that hilA expression is regulated by a complex array of regulatory

systems including hilC/sirC/sprA (13, 14, 15), hilD (15), sirA/barA (16, 17), fis (18, 19),

csrAB (16, 20), envZ/ompR (21), phoB, fadD, and fliZ (7), hha (22), and H-NS and HU

(19). Two of these genes, hilC and hilD, encode AraC-like transcriptional activators

that activate hilA transcription by binding upstream of the hilA promoter DNA (15, 23,

24). Members of the phosphorylated response regulator superfamily involved in hilA

expression include sirA/barA, envZ/ompR, phoR/phoB, and phoP/phoQ (7, 17, 21, 12).

However, none of these regulatory systems has been shown to directly relay

environmental signals to hilA expression.

Enteric bacteria elicit stringent control of ribosome production during the

transition from exponential growth to stationary phase (25, 26). The effector molecule

of the stringent control modulation is the alarmone guanosine tetraphosphate, ppGpp

(27, 28). The ppGpp is synthesized by two synthetases, PSI and PSII, encoded by relA

and spoT genes, respectively. These two enzymes respond differently to

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

4

environmental conditions. PSI is activated during amino acid starvation but is largely

inactive during exponential growth; in contrast, PSII is mostly inactive during amino

acid starvation, but is active during exponential growth to determine basal levels and to

response to certain environmental stress including deprivation of carbon or energy (29,

30, 31, 32, 33, 34). Accumulation of ppGpp during the exponential phase of growth

results in the reduction of stable RNA synthesis and the activation of certain mRNA

synthesis.

In this study, we examined expression of SPI1 genes including hilA under

physiologically well defined standard growth conditions (LB with vigorous aeration)

and observed that these genes were induced at the onset of the stationary phase. This

stationary phase induction was, however, not dependent on stationary phase specific ,38, but on the stringent signal molecule ppGpp. Most interestingly we found the

stationary phase hilAp induction depended not on RelA but on SpoT function. This

suggests an unusual inducing role of the SpoT protein distinct from its ability to

produce the stringent signal molecule ppGpp. We conclude that Salmonella virulence

genes, including SPI1 genes, are expressed under stressed conditions in a ppGpp-

dependent manner.

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

5

Materials and Methods

Strains and plasmids

The Salmonella strains, derived from 14028s, and plasmids used in this study are listed

in Table 1. All bacterial strains were constructed by P22HT int transduction as

described previously (35). The hilC::kan strain was constructed following the method

developed by Datsenko and Wanner (36). The hilC carrying kan in the place of its

ORF was generated by PCR amplification using a pair of 60-nt primers that included

40-nt homology extensions and 20-nt priming sequences with pKD13 as a template: 5’

primer

(TTCAATGAATAAATCAGTTGAGGCCATTAGCAATAATCACGTGTAGGCTGGA

GCTGCTTC) and 3’ primer

(CTAATCCATTTATTAATGGAAATTTGTTCGGCTGTTGAAGATTCCGGGGATCC

GTCGACC) (hilC sequences are underlined).

The 1.4-kbp PCR products were purified and transformed into bacteria carrying a Red

helper plasmid (pKD46) by electroporation. The electrocompetent cells were grown in

LB broth with ampicillin and L-arabinose (1 mM) at 30 C to an OD600 of 0.5. The

mutants were confirmed by PCR using original and common test primers: k1

(CAGTCATAGCCGAATAGCCT) and kt (CGGCCACAGTCGATGAATCC) for kan.

Growth conditions

Except when indicated otherwise, cultures were grown in LB medium (Difco

Laboratories) containing 1% NaCl with vigorous aeration at 37℃. For solid support

medium, 1.5% granulated agar (Difco Laboratories) was included. MacConkey

lactose, Nutrient Broth and Brain Heart Infusion (BHI) media were purchased from

Difco Laboratories. Antibiotics were from Sigma Chemical. When present,

antibiotics were added at the following concentrations: ampicillin, 50 g/ml;

chloramphenicol, 15 g/ml; tetracycline, 15 g/ml. X-gal (Sigma) was used at 20

g/ml. The carbon source starvation experiment was carried out in LB+0.1% glucose

with alpha-methyl glucoside ( -MG, Sigma). Amino acid starvation experiment was

carried out as described in Shand et al. (37) using DL-serine hydroxamate (Sigma) in

NB supplemented with serine (0.75 mM).

Analysis of culture supernatant

Cultures were grown overnight in 5 ml of LB broth with antibiotics and vigorous

aeration, and then harvested. Bacteria were pelleted at 8,000 g for 15 min, and

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

6

supernatants were immediately transferred to clean tubes. The supernatants were

filtered through a 0.45 m pore size syringe filter (Sartorius), and proteins were

precipitated with cold trichloroacetic acid (TCA) at a final concentration of 10%. The

proteins were collected by centrifugation at 8,000 g at 4 C and resuspended in 1 ml

cold acetone. These mixtures were centrifuged for 10 min at 8,000 rpm at 4 C, and

pellets were resuspended in 20 l of 1 PBS. The protein sample buffer containing -

mercaptoethanol was added to the samples, the samples were boiled for 5 min, and

proteins were separated by SDS-polyacrylamide gel electrophoresis (PAGE) (7.5%).

Proteins were visualized with silver stain (38).

-galactosidase assays

-galactosidase assays were performed as described by Miller (39), using cells

permeabilized with Koch’s lysis solution (40). -galactosidase specific activity was

expressed as Miller units (A420/min/A600/ml x1000). To measure -galactosidase levels

in bacteria at different stages of growth, fresh overnight cultures were diluted 1:50 into

LB or the media condition described in the text and grown at 37℃ until the cultures

reached the stationary phase. Samples were taken for enzyme assay at regular time

intervals. Each strain was assayed in triplicate and average enzyme activities were

plotted as a function of time.

Primer extension analysis

Total RNA was isolated from Salmonella grown statically using Trizol reagent (Life

Technologies, Inc). To study hilA and hisG transcriptions, the primers with 5’-

TAATAATATTGTTATAACTAACTGTGATTA -3’, complementary to +134 to -+114 of

the transcripton start site of hilA, and 5’-

ACTGGAAGATCTGAATGTCTTCCAGCACAC-3’, complementary to +124 to +95 of

the transcription start site of hisG, were used. 32P-labeled primers (50,000 cpm) were

co-precipitated with 30 µg of total RNA. Primer extension reactions were performed

as described by Shin et al. (41).

Invasion assay

The assays were performed essentially as previously described (42). Monolayers for

bacterial invasion were prepared by seeding 5X105 HEp-2 cells into each well of 24-

well plates. The HEp-2 cells were grown in DMEM (GibcoBRL) +10% fetal bovine

serum (GibcoBRL) at 37℃ with 5% CO2. Salmonellae prepared as described in the

text were added to HEp-2 cells at a ratio of 10:1, and the mixture was incubated at 37℃

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

7

under 5% CO2 for 30 min. Infected cells were washed three times with phosphate-

buffered saline (PBS, PH 7.4) and DMEM containing gentamicin (5 mg/ml, Sigma) was

added, and the mixture was incubated for an additional 60 min. Intracellular bacteria

were harvested by extraction with lysis buffer (0.05% triton X-100 in PBS, PH 7.4), and

replica plated for colony counting on BHI agar plates.

Results

Growth phase-dependent invasiveness of bacteria grown under standard conditions

The ability of Salmonellae to invade cultured nonphagocytic cells has been correlated

with the expression of SPI1 encoded genes (43). In an attempt to investigate the

regulation of invasion genes under a physiologically well-defined standard growth

conditions, we determined the invasiveness of bacteria grown under standard conditions

(LB with aeration). In this experiment, overnight culture of bacteria grown in LB was

diluted 40-fold in the same media or a high salt media (LB+0.3 M NaCl) and grown

with or without aeration, respectively. The high salt media without aeration was

considered the ‘inducing condition’ for the expression of SPI1 genes (11, 12). Fig. 1A

shows Salmonellae growth under the two conditions. Under the standard condition,

bacteria grew rapidly and reached the stationary phase in about 4 hrs. Under the

inducing condition, the culture entered into the stationary phase at a much lower A600,

<1 A600. Bacteria were sampled from the middle of the exponential phase (~2 hrs) and

the early (~4 hrs) and late (~12 hrs) stationary phases grown under the two conditions,

and the invasiveness of each growth phase culture was determined using HEp-2 cells.

In this experiment, the number of bacteria from various growth phases was adjusted to

MOI=10: bacteria (5x106) and host cells (5x105). Fig. 1B shows the actual number of

intracellular bacteria that survived gentamicin treatment (10 g/ml), recovered from the

host cells following an 1 hr incubation of bacteria and host cells. When grown under

the standard condition (filled bars), the early stationary phase bacteria were found to be

about 10~20-fold more invasive than the exponential phase and the late stationary phase

bacteria. By contrast, the invasiveness of bacteria grown under the inducing condition

showed a different pattern; the early stationary phase culture was about 3-fold more

invasive than the exponential phase culture, but slightly less invasive than the late

stationary culture (open bars). The maximum invasion was obtained with the early

stationary culture grown under the standard condition. It was thought that the loss of

invasiveness with the late stationary culture grown under standard condition was due to

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

8

destruction of TTSS by continuous agitation of the culture. Thus, although the

inducing condition might closely represent the intestinal milieu (11, 12), bacteria grown

under the standard condition were used in the subsequent experiments to identify the

factor(s) conferring the maximum invasiveness at the early stationary phase.

Next, we determined the presence of secreted effector proteins encoded within

SPI1 (38) in the cultures at different time grown under the standard condition (see Fig.

1C). Total supernatants of cultures at different phases were collected, precipitated with

TCA, and analyzed on 7.5% SDS-PAGE gel (Fig. 1C). The volume of supernatant

was proportionally adjusted to the number of bacteria at each growth phase. The

secreted effector proteins, namely SipA (89 Kd), SipB (67 Kd), SigD (62 Kd), and SipC

(42 Kd), were detected only in the supernatant of cultures entering the stationary phase

(4 hrs) and thereafter (6 hrs). Thus, Salmonellae at the entry of the stationary phase

were most invasive because SPI1 encoded genes, including those constituting the TTSS

apparatus and effector proteins, were expressed exclusively at this growth phase under

the standard condition (see below).

Growth phase-dependent expression from the promoters in SPI1

We analyzed the activity of the promoters driving expression of the genes involved in

Salmonella invasion of host cells encoded on SPI1, namely hilA, invF and sicA

promoters (hilAp, invFp and sicAp in short), during growth under the standard condition.

To determine activity of these promoters, S. typhimurium strains carrying lacZY genes

transcriptionally fused to individual promoters on the chromosome (SMR2063, Fig. 2A)

or on a plasmid in 14028s strain background (Fig. 3) were used. Bacteria were taken

at regular time intervals and -galactosidase activity representing activity of each

promoter during the course of growth was determined. Fig. 2 shows the hilAp activity

determined under the standard and inducing growth conditions. Under the inducing

condition, hilAp activity was about the same throughout the exponential and stationary

phases. By contrast, hilAp activity under the standard growth condition was induced

~30-fold when the culture entered the stationary phase. hilAp activity under the

standard condition was ~10-fold less during the exponential phase but ~3.5-fold more at

the entry of the stationary phase compared with the activities under the inducing

condition. This result, thus, accounts for the different invasiveness of the cultures

grown under the two conditions; the central regulator hilAp is selectively expressed at

the onset of the stationary phase under the standard condition but is maintained at more

or less the same level irrespective of the growth phase under the inducing condition.

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

9

To further verify the hilAp induction under the standard growth condition, the hilAp

specific transcript was monitored during the course of growth by the primer extension

assay (Fig. 2B). The hilAp specific RNA was detected at 3 hrs as culture entered the

stationary phase, peaked at 5 hrs, and disappeared at 7 hrs.

Subsequently, invF and sicA as well as hilA promoters on the pRS415 plasmid

(44) were determined during growth under the standard condition (Fig. 3). The

episomal hilAp activity (3A) showed a similar pattern of induction at the onset of the

stationary phase but the magnitude of induction was significantly reduced to ~4-fold.

The reduction was ascribed to the huge increase in the basal level activity at the

exponential phase, as if a repressor acting at the exponential phase was titrated out by

the episomal hilAp DNA. The invFp and sicAp activities were determined using the

strain carrying the individual promoters fused to lacZYA on the pRS415. Both invFp

(3C) and sicAp (3B) were increased more than 50-fold as the culture entered the

stationary phase. The extension in the activation of downstream activators, invF and

sicA, as compared with the upstream activator, hilA, might represent a magnification of

physiological response in cascade regulation. Taken together, these results clearly

establish that the early stationary phase bacteria grown under the standard condition are

most invasive due to the selective expression of the central activator, hilA, presumably

thereby downstream activators invF and sicA under its control, and thereby those

encoding TTSS and the effectors.

Regulation of stationary phase induction of hilA expression

We then set out to establish the molecular mechanism underlying the stationary phase

induction of hilA under the standard growth condition. Stationary phase induction of

gene expression in enteric bacteria is due at least partly to the stationary phase sigma

factor 38, the rpoS gene product (45). The heat shock sigma factor ( 24), the rpoE

product, has also recently been shown to be strongly induced upon entry of Salmonella

into the stationary phase (46, 47). We determined the chromosomal hilAp activity in

the RpoS- mutant background and found the stationary phase activation pattern was

even greater than in the wild type (WT) (Fig. 4). In the RpoE- mutant background, no

difference was observed. Thus, the stationary phase induction of hilAp is apparently

independent of rpoS or rpoE.

Subsequently, we examined the regulation of hilA by those two-component

regulatory systems known to activate hilA under the inducing condition, namely

hilC/hilD, sirA/barA, and envZ/ompR (7, 48) (Fig. 5). Under the standard growth

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

10

condition, hilAp activity in the HilC- mutant in the exponential phase was equivalent to

that in the WT but was not induced at the entry of the stationary phase. On the other

hand, hilAp activity in the HilD- mutant in the exponential phase was ~10-fold lower

than that in the WT, and the activity remained reduced throughout the course of growth.

The hilAp activity in either the SirA- or BarA- mutant in the exponential phase was not

much different than that in the WT but was only partially induced at the entry of the

stationary phase. The hilAp activity was virtually undetected in the OmpR- mutant

throughout the growth period. However, in the EnvZ- mutant strain, hilAp was

induced at the entry of the stationary phase, although ~2.5-fold less than in the WT.

The differences in hilAp induction in OmpR- and EnvZ- suggest that OmpR could be

phosphorylated by a protein(s) other than EnvZ (49), if phosphorylated OmpR induces

hilAp activity. Nevertheless, defect in the two-component regulatory systems resulted

in a failure to induce hilAp at the entry of the stationary phase under the standard

condition. It is speculated that these activators might respond to a certain signal at the

entry of the stationary phase.

ppGpp-dependent induction of hilA and SPI1 genes

In an attempt to identify the global regulatory system responsible for the stationary

phase induction of hilAp, we examined hilAp activity in a strain lacking ppGpp, the

effector molecule of the stringent response (28). ppGpp is produced and maintained

by PSI and PSII, the respective relA and spoT gene products. We examined the hilAp

activity in the relA or relA spoT strain, which lack PSI or both PSI and PSII,

respectively (Fig. 6). Growth of the mutants did not differ much from the WT strain

under the standard growth condition in LB. We observed that in the relA mutant

strain, hilAp activity was indistinguishable from that in the WT strain. However, hilAp

activity was completely silent throughout the growth phase in the relA spoT mutant

strain lacking ppGpp. These observations suggest that hilAp induction at the entry of

the stationary phase is mediated by ppGpp, which is synthesized primarily by SpoT

activity. To further verify the route of ppGpp synthesis leading to hilAp induction,

hilAp activity was determined during carbon source starvation, which is known to

elevate ppGpp in a SpoT-dependent manner (50, 51, 52, 34). Carbon starvation was

elicited by the addition of 2.5% -methyl glucoside ( -MG), a competitive inhibitor of

glucose uptake, into LB containing 0.1% glucose (Fig. 7). The addition of -MG only

slightly reduced the growth rate: generation time shifted from ~30 min to ~40 min for

all three WT, relA, and relA spoT strains. Fig. 7A shows a representative growth

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

11

curve for all three strains. The basal hilAp activity levels prior to -MG addition in the

strains fell within a 2-fold range: WT > relA > relA spoT in order (Fig. 7B). Upon

addition of -MG, hilAp activity increased drastically in the WT and relA strains but

not in the relA spoT strain. We also examined the hilAp activity during amino acid

starvation that elevates ppGpp levels in a RelA-dependent manner (37) (Fig. 8). The

condition of amino acid starvation was elicited by the addition of 2 mM serine

hydroxamate (SerHX) to a culture grown in Nutrient Broth supplemented with 0.75 mM

serine. Both WT and relA spoT strains grew with more or less the same generation

time (~30 min) prior to the addition of SerHX (Fig. 8A). The addition of SerHX in the

middle of exponential phase of growth immediately reduced the growth rate for WT

strain (top panel). By contrast, the cell mass (A600) of relA spoT (bottom panel)

increased at the same rate for some period (~ 1 hr) as prior to the addition of SerHX and

then ceased (data not shown). It has been shown under this growth condition, the

addition of SerHX drastically increased the ppGpp level in RelA-dependent manner,

~10-fold (37). Under this condition, we first determined an amino acid histidine

biosynthesis operon promoter (hisGp), a classical promoter known to respond in parallel

with the change in ppGpp level (62, 37, 63). The promoter activity was determined by

measuring the transcripts. The addition of SerHX increased hisGp activity in WT

(~30-fold) within 5 min but not in relA spoT mutant strain (Fig. 8B, top). Under the

same condition, hilAp activity remained unchanged by the addition of SerHX in either

WT or relA spoT strain (Fig. 8B, bottom). These results confirm that induction of

hilAp, and thereby those genes under its control at the entry of the stationary phase,

results from the elevation of ppGpp levels but in a SpoT-dependent manner.

Lastly, we evaluated the WT and relA spoT strains for their abilities to invade

HEp-2 cells to access the in vivo role of ppGpp in Salmonella virulence (Table 2). The

early stationary phase bacteria were used in this assay. The analysis revealed that

invasion by the relA spoT strain was less than 1% of the level of invasion by the WT

bacteria. Thus, the lack of hilA expression in the relA spoT strain, and thereby the

lack of expression of those genes under its control, including SPI1 encoded TTSS and

effector proteins, caused an apparent reduction in invasiveness.

Discussion

Stationary phase induction of hilA under the standard growth condition

In this study, we reported that hilA and therefore those genes under its control are

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

12

expressed under the standard growth condition at the onset of the stationary phase based

on the following observations: 1) invasiveness culminated at the early stationary phase

culture (Fig. 1); 2) some representative secreted proteins encoded in SPI1 were detected

in the supernatant from early stationary phase cultures but not in supernatant from

exponential phase cultures (Fig. 1); 3) hilAp and those promoters under its control,

sicAp and invFp, were induced at the onset of the stationary phase (Fig. 2 and 3).

Similarly, early stationary phase bacteria grown under the standard condition are

reportedly most cytotoxic to cultured mammalian cells (53). The primer extension

analysis revealed that hilAp was transitionally expressed during transition from the

exponential phase to the stationary phase, demonstrating a pattern of growth phase-

dependent expression. The induction of hilA was, however, independent of the

stationary phase or the heat shock , 24, which have been implicated in

Salmonella pathogenesis in animals and are induced at the entry of the stationary phase

(45, 46, 47) (Fig 4). Therefore, hilAp seems be induced in response to an unidentified

environmental signal built up as culture enters the stationary phase.

We have observed that hilAp induction on a multicopy plasmid was lower than

that on the chromosome (~4-fold vs ~30-fold), largely due to a huge increase in hilAp

activity at the exponential phase (~1000-fold). Therefore, the stationary phase

induction of hilAp activity could be, at least in part, ascribed to removal of repressor

acting during the exponential phase. In this case, the hypothetical repressor might be

titrated out by episomal hilAp DNA, resulting in the elevation of hilA activity during the

exponential phase. Since a plethora of regulatory systems has been proposed to

regulate hilAp (7), the titratable factors should include an activator(s) as well as a

repressor(s).

Interestingly, it was noted that the two-component regulatory systems known to

activate hilAp under the inducing condition acted at the level of its induction at the entry

of the stationary phase under the standard growth condition (Fig. 5). Amongst the

regulatory components, hilC/hilD has been shown to exert its regulatory effect by

directly binding to a site upstream of hilAp (15, 23, 54). We observed under the

standard growth condition that hilAp activity remained at the basal level in the HilC- or

HilD- mutant background, although the defect was more severe in the HilD- mutant.

In fact, hilAp activity was reduced ~10-fold in the HilD- mutant background even

during the exponential phase. This result suggests that the mechanism of hilAp

activation by hilC/hilD might be different depending on whether the cells are in the

exponential growth phase or at the entry into the stationary phase. We obtained similar

results with the strains lacking the two-component regulatory systems reported to up-

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

13

regulate hilAp activity under the inducing condition, barA/sirA and envZ/ompR (55, 16,

20, 48). Under the standard growth condition, hilAp in the BarA- or SirA- mutant was

defective at the level of its induction in stationary phase but not in exponential phase.

The hilAp activity in the OmpR- mutant was virtually undetected while that in the

EnvZ- was almost normally induced, although the peak activity was ~2.5-fold less than

that in the WT. It is well established that EnvZ phosphorylates OmpR upon sensing an

increase in osmolarity in the environment (49). Under the standard condition, if the

phosphorylated OmpR was responsible for hilAp induction, the phosphorylation must

occur through a route(s) other than EnvZ. In fact, an EnvZ-independent mechanism of

OmpR phosphorylation has been postulated (56, 57). OmpR might take part in hilAp

induction at the onset of the stationary phase by sensing an unknown environmental

signal through a currently unknown sensor. In this case, OmpR is unlikely to be

responding to a change in media osmolarity since we did not detect any noticeable

change in the media osmolarity as the culture entered stationary phase (data not shown).

Further study is required to elucidate the underlying mechanism of hilA induction and

its regulation by two-component regulatory systems under the standard growth

condition.

Implication of ppGpp in hilAp induction

Since establishing hilAp induction at the entry of the stationary phase under the

standard growth condition, we searched for the global regulatory signal responsible for

the induction and found ppGpp. hilAp activity remained at the basal level in

relA spoT strain while normally induced in relA strain (Fig. 6). SPI1 encoded sicA

and invF promoters also remained at their basal levels in the relA spoT mutant strain

(data not shown). Consistently, the relA spoT strain showed reduced invasiveness

by more than 100-fold, as determined in vitro assay using HEp-2 cells (Table 2). RelA

is known to sense an imbalance or lack of amino acid supply and to synthesize ppGpp,

resulting in the reduction of stable RNA synthesis, the phenomenon known as “stringent

response” (29, 26, 28). Alternatively, the basal level of ppGpp during balanced growth

is regulated by spoT, which carries both ppGpp synthetase (PSII) and hydrolase (58, 34).

Therefore, the basal level of ppGpp depends on the balance of two activities. Some

conditions, including carbon and energy starvation have been shown to result in

accumulation of ppGpp in a SpoT-dependent manner (59, 60, 34). Under the standard

laboratory growth conditions, the transition from the exponential phase to the stationary

phase presumably represents a stressed condition. It has been reported recently that

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

14

changes in the proteome pattern of E. coli entering the stationary phase were

significantly different between WT and relA1 spoT mutant, which had a proteome

pattern that appeared to be locked in the exponential growth mode (61). We speculate

that the transitional stress at the entry of stationary phase must be sensed and translated

to ppGpp synthesis primarily by SpoT function.

Most interestingly, it was observed that hilAp was induced during exponential

phase of growth by the carbon source starvation known to elevate ppGpp level in a

SpoT-dependent manner (50, 51, 52, 34) but not by the amino acid starvation known to

elevate ppGpp level in a RelA-dependent manner (37) (Fig. 7 and 8). Whereas, the

amino acid histidine biosynthesis operon promoter (hisGp), a classical promoter

positively regulated by ppGpp (62, 37, 63), responded in parallel with the RelA-

dependent increase in ppGpp level in this study (Fig 8). It has been reported that the

amino acid starvation elicited by the addition of SerHX causes an immediate increase in

ppGpp level in RelA-dependent manner: 28.7 pmol/A650 to 1,042 pmol/A650 (37).

The carbon source deprivation could also increase ppGpp concentration up to ~500

pmol/A650 in WT bacteria (51). However, it must be noted that hilAp was induced

normally in relA strain following the carbon source starvation in which ppGpp pool

was measured to be increased only a few-fold, a little more than 100 pmol/A650 (34).

Thus, regulation of gene expression following carbon source starvation and amino acid

starvation seem to be mechanistically different. Likewise, gene induction at the entry

of the stationary phase and that observed during the classical stringent response

following amino acid deprivation must also be different. In addition to ppGpp, some

other alteration accompanying entry into the stationary phase may be necessary for gene

induction, including hilAp activation. The physiological consequence of the two

routes of ppGpp elevation, the RelA- and SpoT-dependent mechanisms, remains

unknown.

During the course of animal infection, Salmonella bacteria encounter diverse

environments in the intestinal lumen and inside various host cells. Thus, it is

imperative that Salmonellae must be able to sense and respond to changing

environments in order to survive (64). We speculate that environmental stress is

sensed and translated to the intracellular signal ppGpp that enables expression of

various Salmonella virulence genes including those encoded on SPI1 that are required

for the invasion of host cells and induction of macrophage apoptosis (1, 65).

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

15

Acknowledgement

This work was supported by Korea Health 21 R & D (01-PJ10-PG6-01GM02-002) by

the Ministry of Health and Welfare, Republic of Korea. We thank C. Lee (Boston) and

K. Tedin (Berlin) for providing important Salmonella strains.

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

16

References

1. Carter, P.B. and Collins, F.M. (1974) The route of enteric infection in normal mice. J.

Exp. Med. 139: 1189-1203.

2. Hohmann, A.W., Schmidt, G., and Rowley, D. (1978) Intestinal colonization and

virulence of Salmonella in mice. Infect. Immun. 22: 763-770.

3. Jones, B.D., Ghori, N., and Falkow, S. (1994) Salmonella typhimurium initiates

murine infection by penetrating and destroying the specialized epithelial M cells of

the Peyer's patches. J. Exp. Med. 180: 15-23.

4. Takeuchi, A. (1967) Electron microscope studies of experimental Salmonella

infection. I. Penetration into the intestinal epithelium by Salmonella typhimurium.

Am. J. Pathol. 50: 109-136.

5. Mills, D.M., Bajaj, V., and Lee, C.A. (1995) A 40 kb chromosomal fragment

encoding Salmonella typhimurium invasion genes is absent from the corresponding

region of the Escherichia coli K-12 chromosome. Mol. Microbiol. 15: 749-759.

6. Galan, J.E. (2001) Salmonella interactions with host cells: type III secretion at work.

Annu. Rev. Cell. Dev. Biol. 17: 53-86.

7. Lucas, R.L. and Lee, C.A. (2000) Unravelling the mysteries of virulence gene

regulation in Salmonella typhimurium. Mol. Microbiol. 36: 1024-1033.

8. Darwin, K.H. and Miller, V.L. (1999) InvF is required for expression of genes

encoding proteins secreted by the SPI1 type III secretion apparatus in Salmonella

typhimurium. J. Bacteriol. 181: 4949-4954.

9. Darwin, K.H. and Miller, V.L. (2000) The putative invasion protein chaperone SicA

acts together with InvF to activate the expression of Salmonella typhimurium

virulence genes. Mol. Microbiol. 35: 949-960.

10. Darwin, K.H. and Miller, V.L. (2001) Type III secretion chaperone-dependent

regulation: activation of virulence genes by SicA and InvF in Salmonella

typhimurium. EMBO J. 20: 1850-1862.

11. Lee, C.A. and Falkow, S. (1990) The ability of Salmonella to enter mammalian cells

is affected by bacterial growth state. Proc. Natl. Acad. Sci. 87: 4304-4308.

12. Bajaj, V., Lucas, R.L., Hwang, C., and Lee, C.A. (1996) Co-ordinate regulation of

Salmonella typhimurium invasion genes by environmental and regulatory factors is

mediated by control of hilA expression. Mol. Microbiol. 22: 703-714.

13. Eichelberg, K., Hardt, W.D., and Galan, J.E. (1999) Characterization of SprA, an

AraC-like transcriptional regulator encoded within the Salmonella typhimurium

pathogenicity island 1. Mol. Microbiol. 33: 139-152.

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

17

14. Rakeman, J.L., Bonifield, H.R., and Miller, S.I. (1999) A HilA-independent pathway

to Salmonella typhimurium invasion gene transcription. J Bacteriol 181: 3096-104.

15. Schechter, L.M., Damrauer, S.M., and Lee, C.A. (1999) Two AraC/XylS family

members can independently counteract the effect of repressing sequences upstream

of the hilA promoter. Mol. Microbiol. 32: 629-642.

16. Altier, C., Suyemoto, M., Ruiz, A.I., Burnham, K.D., and Maurer, R. (2000)

Characterization of two novel regulatory genes affecting Salmonella invasion gene

expression. Mol. Microbiol. 35: 635-646.

17. Johnston, C., Pegues, D.A., Hueck, C.J., Lee, A., and Miller, S.I. (1996)

Transcriptional activation of Salmonella typhimurium invasion genes by a member

of the phosphorylated response-regulator superfamily. Mol. Microbiol. 22: 715-727.

18. Wilson, R.L., Libby, S.J., Freet, A.M., Boddicker, J.D., Fahlen, T.F., and Jones, B.D.

(2001) Fis, a DNA nucleoid-associated protein, is involved in Salmonella

typhimurium SPI-1 invasion gene expression. Mol. Microbiol. 39: 79-88.

19. Schechter, L.M., Jain, S., Akbar, S., and Lee, C.A. (2003) The small nucleoid-

binding proteins H-NS, HU, and Fis affect hilA expression in Salmonella enterica

serovar Typhimurium. Infect. Immun. 71: 5432-5435.

20. Altier, C., Suyemoto, M., and Lawhon, S.D. (2000) Regulation of Salmonella

enterica serovar typhimurium invasion genes by csrA. Infect. Immun. 68: 6790-6797.

21. Lindgren, S.W., Stojiljkovic, I., and Heffron, F. (1996) Macrophage killing is an

essential virulence mechanism of Salmonella typhimurium. Proc. Natl. Acad. Sci.

93: 4197-4201.

22. Fahlen, T.F., Wilson, R.L., Boddicker, J.D., and Jones, B.D. (2001) Hha is a

negative modulator of transcription of hilA, the Salmonella enterica serovar

Typhimurium invasion gene transcriptional activator. J. Bacteriol. 183: 6620-6629.

23. Schechter, L.M. and Lee, C.A. (2001) AraC/XylS family members, HilC and HilD,

directly bind and derepress the Salmonella typhimurium hilA promoter. Mol.

Microbiol. 40: 1289-1299.

24. Olekhnovich, I.N. and Kadner, R.J. (2002) DNA-binding activities of the HilC and

HilD virulence regulatory proteins of Salmonella enterica serovar Typhimurium. J.

Bacteriol. 184: 4148-4160.

25. Sands, M.K. and Roberts, R.B. (1952) The effects of a tryptophan-histidine

deficiency in a mutant of Escherichia coli. J. Bacteriol. 63: 505-511.49.

26. Stent, G.S. and Brenner, S. (1961) A genetic locus for the regulation of ribonucleic

acid synthesis. Proc. Natl. Acad. Sci. 47: 2005-2014.

27. Cashel, M. and Gallant, J. (1968) Control of RNA synthesis in Escherichia coli. I.

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

18

Amino acid dependence of the synthesis of the substrates of RNA polymerase. J.

Mol. Biol. 34: 317-330.

28. Cashel, M., Gentry, D.R., Hernandez, V.J., and Vinella, D. (1996) The stringent

response. In Escherichia Coli and Salmonella: Cellular and Molecular Biology, vol.

1 (ed. Neidhardt, F.C. et al.,) pp. 1458-1496. ASM Press, Washington D.C.

29. Cashel, M. (1969) The control of ribonucleic acid synthesis in Escherichia coli. IV.

Relevance of unusual phosphorylated compounds from amino acid-starved stringent

strains. J. Biol. Chem. 244: 3133-3141.

30. Lazzarini, R.A., Cashel, M., and Gallant, J. (1971) On the regulation of guanosine

tetraphosphate levels in stringent and relaxed strains of Escherichia coli. J. Biol.

Chem. 246: 4381-4385.

31. Harshman, R.B. and Yamazaki, H. (1971) Formation of ppGpp in a relaxed and

stringent strain of Escherichia coli during diauxie lag. Biochemistry 10: 3980-3982.

32. Lagosky, P.A. and Chang, F.N. (1980) Influence of amino acid starvation on

guanosine 5'-diphosphate 3'-diphosphate basal-level synthesis in Escherichia coli. J.

Bacteriol. 144: 499-508.

33. Ryals, J., Little, R., and Bremer, H. (1982) Control of RNA synthesis in Escherichia

coli after a shift to higher temperature. J. Bacteriol. 151: 1425-1432.

34. Murray, K.D. and Bremer, H. (1996) Control of spoT-dependent ppGpp synthesis

and degradation in Escherichia coli. J. Mol. Biol. 259: 41-57.

35. Davis, R.W., Botstein, D., and Roth, J.R. (1980) Advanced Bacterial Genetics: A

manual for genetic Engineering. Cold Spring Harbor, NY: Cold Spring Harbor

Laboratory Press.

36. Datsenko, K.A. and Wanner, B.L. (2000) One-step inactivation of chromosomal

genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. 97: 6640-

6645.

37. Shand, R.F., Blum, P.H., Mueller, R.D., Riggs, D.L., and Artz, S.W. (1989)

Correlation between histidine operon expression and guanosine 5'-diphosphate-3'-

diphosphate levels during amino acid downshift in stringent and relaxed strains of

Salmonella typhimurium. J. Bacteriol. 171: 737-743.

38. Hong, K.H. and Miller, V.L. (1998) Identification of a novel Salmonella invasion

locus homologous to Shigella ipgDE. J. Bacteriol. 180: 1793-1802.

39. Miller, J.H. (1972) Experiments in Molecular Genetics. Cold Spring Harbor, NY.

Cold Spring Harbor Laboratory Press.

40. Putnam, S.L. and Koch, A.L. (1975) Complications in the simplest cellular enzyme

assay: lysis of Escherichia coli for the assay of beta-galactosidase. Anal. Biochem.

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

19

63: 350-360.

41. Shin, D., Lim, S., Seok, Y.J., and Ryu, S. (2001) Heat shock RNA polymerase (E

sigma(32)) is involved in the transcription of mlc and crucial for induction of the

Mlc regulon by glucose in Escherichia coli. J. Biol. Chem. 276: 25871-25875.

42. Lee, C.A., Jones, B.D., and Falkow, S. (1992) Identification of a Salmonella

typhimurium invasion locus by selection for hyperinvasive mutants. Proc. Natl.

Acad. Sci. 89: 1847-1851.

43. Hueck, C.J. (1998) Type III protein secretion systems in bacterial pathogens of

animals and plants. Microbiol. Mol. Biol. Rev. 62: 379-433.

44. Simons, R.W., Houman, F., and Kleckner, N. (1987) Improved single and multicopy

lac-based cloning vectors for protein and operon fusions. Gene 53: 85-96.

45. Hengge-Aronis, R. (1996) Back to log phase: sigma S as a global regulator in the

osmotic control of gene expression in Escherichia coli. Mol. Microbiol. 21: 887-893.

46. Humphreys, S., Stevenson, A., Bacon, A., Weinhardt, A.B., and Roberts, M. (1999)

The alternative sigma factor, sigmaE, is critically important for the virulence of

Salmonella typhimurium. Infect. Immun. 67: 1560-1568.

47. Testerman, T.L., Vazquez-Torres, A., Xu, Y., Jones-Carson, J., Libby, S.J., and Fang,

F.C. (2002) The alternative sigma factor sigmaE controls antioxidant defences

required for Salmonella virulence and stationary-phase survival. Mol. Microbiol. 43:

771-782.

48. Lucas, R.L. and Lee, C.A. (2001) Roles of hilC and hilD in regulation of hilA

expression in Salmonella enterica serovar Typhimurium. J. Bacteriol. 183: 2733-

2745.

49. Pratt, L.A. and Silhavy, T.J. (1995) Identification of base pairs important for OmpR-

DNA interaction. Mol. Microbiol. 17: 565-573.

50. Friesen, J.D., Fiil, N.P., and von Meyenburg, K. (1975) Synthesis and turnover of

basal level guanosine tetraphosphate in Escherichia coli. J. Biol. Chem. 250: 304-

309.

51. Hansen, M.T., Pato, M.L., Molin, S., Fill, N.P., and von Meyenburg, K. (1975)

Simple downshift and resulting lack of correlation between ppGpp pool size and

ribonucleic acid accumulation. J. Bacteriol. 122: 585-591.

52. De Boer, H.A., Bakker, A.J., Weyer, W.J., and Gruber, M. (1976) The role of energy-

generating processes in the degradation of guanosine tetrophosphate, ppGpp, in

Escherichia coli. Biochim. Biophys. Acta. 432: 361-368.

53. Lundberg, U., Vinatzer, U., Berdnik, D., von Gabain, A., and Baccarini, M. (1999)

Growth phase-regulated induction of Salmonella-induced macrophage apoptosis

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

20

correlates with transient expression of SPI-1 genes. J. Bacteriol. 181: 3433-3437.

54. Akbar, S., Schechter, L.M., Lostroh, C.P., and Lee, C.A. (2003) AraC/XylS family

members, HilD and HilC, directly activate virulence gene expression independently

of HilA in Salmonella typhimurium. Mol. Microbiol. 47: 715-728.

55. Lawhon, S.D., Frye, J.G., Suyemoto, M., Porwollik, S., McClelland, M., and Altier,

C. (2003) Global regulation by CsrA in Salmonella typhimurium. Mol. Microbiol.

48: 1633-1645.

56. Forst, S., Delgado, J., Rampersaud, A., and Inouye, M. (1990) In vivo

phosphorylation of OmpR, the transcription activator of the ompF and ompC genes

in Escherichia coli. J. Bacteriol. 172: 3473-3477.

57. Heyde, M., Laloi, P., and Portalier, R. (2000) Involvement of carbon source and

acetyl phosphate in the external-pH-dependent expression of porin genes in

Escherichia coli. J. Bacteriol. 182: 198-202.

58. Xiao, H., Kalman, M., Ikehara, K., Zemel, S., Glaser, G., and Cashel, M. (1991)

Residual guanosine 3',5'-bispyrophosphate synthetic activity of relA null mutants

can be eliminated by spoT null mutations. J. Biol. Chem. 266: 5980-5990.

59. Ishiguro, E.E. (1979) Regulation of peptidoglycan biosynthesis in relA+ and relA-

strains of Escherichia coli during diauxic growth on glucose and lactose. Can. J.

Microbiol. 25: 1206-1208.

60. VanBogelen, R.A., Kelley, P.M., and Neidhardt, F.C. (1987) Differential induction

of heat shock, SOS, and oxidation stress regulons and accumulation of nucleotides

in Escherichia coli. J. Bacteriol. 169: 26-32.

61. Magnusson, L.U., Nystrom, T., and Farewell, A. (2003) Underproduction of sigma

70 mimics a stringent response. A proteome approach. J. Biol. Chem. 278: 968-973.

62. Stephens, J.C., Artz, S.W., and Ames, B.N. (1975) Guanosine 5'-diphosphate 3'-

diphosphate (ppGpp): positive effector for histidine operon transcription and general

signal for amino-acid deficiency. Proc. Natl. Acad. Sci. 72: 4389-4393.

63. Da Costa, X.J. and Artz, S.W. (1997) Mutations that render the promoter of the

histidine operon of Salmonella typhimurium insensitive to nutrient-rich medium

repression and amino acid downshift. J. Bacteriol. 179: 5211-5217.

64. Marcus, S.L., Brumell, J.H., Pfeifer, C.G., and Finlay, B.B. (2000) Salmonella

pathogenicity islands: big virulence in small packages. Microbes. Infect. 2: 145-156.

65. Murray, R.A. and Lee, C.A. (2000) Invasion genes are not required for Salmonella

enterica serovar typhimurium to breach the intestinal epithelium: evidence that

salmonella pathogenicity island 1 has alternative functions during infection. Infect.

Immun. 68: 5050-5055.

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

21

66. Bang, I.S., Kim, B.H., Foster, J.W., and Park, Y.K. (2000) OmpR regulates the

stationary-phase acid tolerance response of Salmonella enterica serovar

typhimurium. J. Bacteriol. 182: 2245-2252.

67. Tedin, K. and Norel, F. (2001) Comparison of DeltarelA strains of Escherichia coli

and Salmonella enterica serovar Typhimurium suggests a role for ppGpp in

attenuation regulation of branched-chain amino acid biosynthesis. J. Bacteriol. 183:

6184-6196.

68. Bang, I.S., Audia, J.P., Park, Y.K., and Foster, J.W. (2002) Autoinduction of the

ompR response regulator by acid shock and control of the Salmonella enterica acid

tolerance response. Mol. Microbiol. 44: 1235-1250.

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

22

Figure legends

Fig.1. Host cell (Hep-2) invasion by the bacteria (14028s) grown in the inducing

condition or standard growth condition (A & B) and the expression of representative

secreted TTSS components (C). A. Bacterial growth (A600) under the inducing

condition (open circles) and under the standard condition (closed circles). B. The

actual number of intracellular gentamicin resistant bacteria after incubation of Hep-2

cells and bacterial cultures at different growth phases. Closed bars represent

invasiveness of bacteria grown under the standard condition and open bars represent

invasiveness of bacteria grown under the inducing condition. C. Proteins excreted into

media during Salmonella growth under the standard condition, on 7.5% SDS PAGE gel.

The secreted proteins, SipA (89 Kd), SipB (67 Kd), SigD (62 Kd), and SipC (42 Kd),

were identified by their sizes as described in Hong and Miller (38). Protein markers

(BioRad) are shown in the first lane.

Fig. 2. Expression of hilAp::lacZY during Salmonella growth under the inducing

(triangles) or standard condition (circles) (A). The curves with open symbols represent

growth (A600) and curves with closed symbols represent chromosomal hilAp activity as

determined by -galactosidase assay (Miller units). B. Expression of hilA under the

standard growth condition as determined by primer extension analysis (left panel).

Thirty micrograms of total Salmonella RNA, extracted at each time point during growth,

was co-precipitated and annealed with end-labeled hilA primer. Reactions were

performed as described under "Materials and Methods." The products were resolved

on a 6% sequencing gel. Right panel shows DNA sequencing ladder of the region

around hilA transcription initiation site. Arrow indicates the first nucleotide of the hilA

transcript, T with circle.

Fig. 3. Expression from hilAp (pMS009, A), sicAp (pMS011, B) and invFp (pMS010,

C) on the transcription fusion plasmid pRS415 during Salmonella growth under the

standard growth condition. The curves with open symbols represent growth (A600) and

curves with closed symbols represent the activity of each promoter activity as

determined by the -galactosidase assay (Miller units).

Fig. 4. Chromosomal hilAp activity in the WT (SMR2063, closed circles), RpoS-

(SMR2065, closed triangles), and RpoE- (SMR2090, closed squares) background during

growth under the standard condition. Dotted curve with open circles shows

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

23

representative growth (A600). hilAp::lacZY activity was as determined by the -

galactosidase assay (Miller units).

Fig. 5. Chromosomal hilAp activity in WT (SMR2063, closed circles), SirA-

(SMR2094, open triangles), BarA-(SMR2095, closed triangles), OmpR- (SMR2064,

open squares), EnvZ- (SMR2084, closed squares), HilC- (SMR2106, open reverse

triangles), and HilD- (SMR2099, closed reverse triangles). Dotted curve with open

circles represents growth (A600). hilAp::lacZY activity was as determined by -

galactosidase assay (Miller units). Note that hilAp activity in OmpR- and HilD- was

virtually undetected (open squares and closed reverse triangles overlapped at the

bottom).

Fig. 6. Chromosomal hilAp activity in WT (SMR2063, circles), relA SHJ2070,

triangles and relA spoT (SHJ2057, squares) backgrounds. The curves with open

symbols represent growth (A600) and curves with closed symbols represent hilAp

activity as determined by -galactosidase assay (Miller units).

Fig. 7. Chromosomal hilAp activity in WT (SMR2063, circles),

relA SHJ triangles and relA spoT (SHJ2057, squares) backgrounds during

carbon source deprivation elicited by the addition of -MG during exponential growth.

-MG was added at time = 0 (arrow). A. A representative growth curve (A600) before

and after the addition of -MG. The growth pattern for WT, relA and relA spoT

were indistinguishable. Closed and open circles represent A600 with and without -MG

addition, respectively. B. hilAp activity as determined by -galactosidase assay (Miller

units): closed and open symbols represent the hilAp activities with and without -MG

addition, respectively.

Fig. 8. hilAp and hisGp activities determined by primer extension analysis in WT

(SMR2110)and relA spoT (SMR2112) background during amino acid starvation

elicited by the addition of SerHX into cultures grown in NB supplemented with 0.75

mM serine. SerHX was added at time 0 (arrow) when A600 was 0.15 and 0.3 for WT

and relA spoT, respectively. A. Growth (A600) of WT (top) and relA spoT

(bottom) strains as function of time. Closed and open symbols represent the

measurements with and without SerHX addition, respectively. B. hisGp (top) and

hilAp (bottom) activities determined by primer extension assay in WT and

relA spoT strains.

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

24

Table 1. Strains and plasmids

Strains Description Reference or source

S. typhimurium

14028s Wild type

SCH2006 rpoS::Amp, Ampr This work

SMR2063 hilA080::Tn5lacZY, Tetr This work

SMR2064 ompR43::MudJ, hilA080::Tn5lacZY, Kanr, Tetr This work

SMR2065 rpoS::Ap, hilA080::Tn5lacZY, Ampr, Tetr This work

SMR2084 envZ1005::MudP, hilA080::Tn5lacZY, Camr, Tetr This work

SMR2090 rpoE::cat, hilA080::Tn5lacZY, Camr, Tetr This work

SMR2094 sirA::kan, , hilA080::Tn5lacZY, Kanr, Tetr This work

SMR2095 barA::kan, hilA080::Tn5lacZY, Kanr, Tetr This work

SMR2099 hilD::kan-1, hilA080::Tn5lacZY, Kanr, Tetr This work

SMR2106 hilC::kan, hilA080::Tn5lacZY, Kanr, Tetr This work

SMR2110 hisO1242hisD9953::MudA, Ampr This work

SMR2112 spoT::cat, relA::kan, hisO1242hisD9953::MudA, Ampr, Camr,

Kanr

This work

SHJ2037 spoT::cat, relA::kan, Camr, Kanr This work

SHJ2057 spoT::cat, relA::kan, hilA080::Tn5lacZY, Camr, Kanr, Tetr This work

SHJ2070 relA::kan, hilA080::Tn5lacZY, Kanr, Tetr This work

EE658 SL1344, hilA080::Tn5lacZY, Tetr 12

EE715 SL1344, sirA::kan, Kanr 15

EE731 SL1344, barA::kan, Kanr 15

JF2757 UK1, ompR43::MudJ, Kanr (lacZ-) 66

KT2184 LT2, relA71::kan, Kanr 67

KT2192 LT2, relA71::kan, spoT281::cat, Kanr, Camr 67

LM399 SL1344 , hilD::kan-1, Kanr 15

SF799 LT2, envZ1005:: MudP, Camr 68

TF951 14028s, rpoE::cat, Camr 47

TT11082 LT2, hisO1242hisD9953::MudA, Ampr 37

Plasmids

pRS415 LacZ fusion vector, Ampr 44

pMS009 pRS415 containing –138 to +84 of hilA This work

pMS010 pRS415 containing –300 to +130 of invF This work

pMS011 pRS415 containing –200 to +70 of sicA This work

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

25

Table 2. Invasiveness of WT and relA spoT strains in Hep-2 cells

Strain WT relA spoT

Invasiveness (%) 100 <1

The invasiveness was determined as described in the Materials and Methods.

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Hong, Joon Haeng Rhee, Sangryeol Ryu, Sangyong Lim and Hyon E. ChoyMiryoung Song, Hyun-Ju Kim, Eun Young Kim, Minsang Shin, Hyun Chul Lee, Yeongjin

island 1 (SPI1)ppGpp-dependent stationary phase induction of genes on salmonella pathogenicity

published online May 25, 2004J. Biol. Chem. 

  10.1074/jbc.M313491200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on March 6, 2020

http://ww

w.jbc.org/

Dow

nloaded from