Salmon Arm Shuswap Real Estate

16
WEEKLY WEEKLY SHUSWAP May 30 & June 1, 2012 Our professionals will help you nd the right home Printed in partnership with Shuswap Zone - Okanagan Mainline Real Estate Board A publication of the

description

Your guide to homes for sale in the Salmon Arm and Shuswap area.

Transcript of Salmon Arm Shuswap Real Estate

Page 1: Salmon Arm Shuswap Real Estate

W E E K L YW E E K L Y

S H U S W A P May 30 & June 1, 2012

Our professionalswill help you fi nd the right home

Printed in partnership with Shuswap Zone - Okanagan Mainline Real Estate Board

A publication of the

Page 2: Salmon Arm Shuswap Real Estate

C2 www.saobserver.net Wed. & Fri., May 30 & June 1, 2012 Salmon Arm Observer & Shuswap Market News

WEST HARBOUR VILLAGEWEST HARBOUR VILLAGE

MLS® 10032199 $189,900

5 - 601 BEATTY AVENUE NWWell kept 2 bdrm, 2 bath home in adult community - West Harbour Village. Appliances, central air, large deck and great views. This bright and clean home is on a fl at site in a central location with walking trails, shopping and recreation nearby. The private yard is beautifully landscaped and has underground irrigation.

MLS® 10015971 $279,900

8 - 601 BEATTY AVENUE NWBright, clean and spacious level entry 3 bdrm, 2 bath home in adult community by waterfront. Double garage, patio, and landscaped yard with underground sprinklers. Great location, close to walking trails, shopping and amenities. Lake and mountain views.

MLS® 10032062 $299,000

6 - 601 BEATTY AVENUE NWGreat alternative to condo living. Large 3 bdrm, 2 bath lakeview home in Salmon Arm’s waterfront area. Very open fl oor plan, with kitchen nook plus dining room. Double garage, covered backyard patio and attractive veranda area in the front. Fully landscaped, private yard with underground sprinklers, and a small garden area. Located in an adult community close to downtown, shopping and amenities.

MLS® 10012012 $349,900

32 - 601 BEATTY AVENUE NWFabulous level entry 3 bdrm, 2 bath home in adult community by waterfront. Double garage, landscaping and underground sprinklers. Lake and mountain views. Close to walking trails, shopping and amenities.

250.833.2062

shuswapINDEPENDENTLY OWNED AND OPERATED.

®

MARG KENTEL

Contact Tammy at 250 832-2131 to advertise in this section

For the week of May 30-June 5, 2012Open H sesou

349 Sumac Road,Sunnybrae, BCElegant lakeview home in Sunnybrae. Level entry, 4-5 bedrooms, 2 baths, hardwood fl oors, central vac, attached double car ga-rage, southern exposure, walking distance to the beach, and the list goes on and on!

$$374,900,,Sat.,

June 212 noon

Contact Tammy at

250 832-2131 to advertise in this sectionEmail: [email protected]

Charles Fitt250 517-9850

One PercentRealty

MLS® 10043769

250 832-7871 250 675-4931 • 1-800-890-9166

[email protected] 833-2088

66HIGHER

STANDARDS

One of the fi nest 55+ parks on Shuswap Lake! This fully landscaped and updated home comes with carport, 2 beds, 2 baths, workshop in B/smt, fruit tree, enjoy all the park has to offer. Beach, boat launch, dock, clubhouse, RV parking & park.

#28 Sorrento Place

$59,900MLS® 10035982

Private 0.42 acre lot really short distance to marina and beach. Level entry with walk-out basement, 5 bdrms, 2 1/2 baths, jetted tub, hot tub and large deck for all your entertaining. Must be seen to be appreciated. Oversized garage.

2828 Marine Drive

MLS®10026867 $419,000

Blind Bay luxury living walking distancet o championship golf course on Shuswap Lake Estates. Huge 5 bdrm, 4 bthrm home is “like new!” Landscaped, covered deck, island kitch., ensuite & includes golf membership, cul-de-sac, private & quiet.

2753 Sunnydale Drive

MLS® 10041412 $479,900

New Rancher with unfi nished B/smt, 1229 sq ft, Open concept great room, 2 bedroom, 2 bathroom, Extra parking, Rustic Birch Cabinets, 45+, HST and kitchen appliances included. Comes with 2-5-10 new home warranty.

#10-2850 7th Ave. NE

MLS® 10038125 $337,000

Semi-lakeshore only steps to swimming beach, 3 bedroom, 2 full bathrooms, large 27’x12’ deck with glass railings to enjoy the view. Carport, park area behind unit, Garden shed, close to clubhouse and boat launch.

#83 Sorrento Place

MLS® 10041920 $239,000

VIEW, VIEW, VIEW!VIEW, VIEW, VIEW!3 bedroom, 3 bathroom home with nice lake view in Magna Vista Estates. Undivided interest subdivision. Propane forced air heat and wood stove. 1 acre lake view

#25 - 6471 Lindsay Road

$259,000MLS® 10036389

TARA GALLANT

www.shuswaphome.compppppppppppppppp

Cell 250 804.3162

Thinking about buying or selling? Talk to Tara

#4 - 4303 27th Ave., Vernon

RETIRE HERE!• 2 bed, 2 bath, 1080 sq. ft.• Private fenced yard

MLS® 10042951

$$174,900174,900

1341 Foothill Rd. SW

UNIQUE HOME! 0.28 ACRES• Oak hardwood, new furnace• Must be seen to be appreciated

MLS® 10044028

$$279,900279,900

4582 Eagle Bay Rd.

PRIVACY ON 1/2 ACRE• Wired, heated shop• New well, windows & roof

MLS® 10035103

$$209,900209,900

#302 - 330 - 7th St. SE

PANORAMIC VIEWS!• Top fl oor executive condo• 1449 sq. ft. and secure parking

MLS® 10042912

$$269,000269,000

2650 - 5th Ave. SE

• 5 bdrm., 3 full bathroom family home• Central air & vac., RV parking, gas f/p

MLS® 10044433

$$364,900364,900

Lot 19 Duncan RoadMLS® 9198237

$$69,00069,0000.61 acre lot

53 Hopes WayMLS® 10010737

$$98,00098,0000.44 Lakeview Lot

Page 3: Salmon Arm Shuswap Real Estate

Salmon Arm Observer & Shuswap Market News Wed. & Fri., May 30 & June 1, 2012 www.saobserver.net C3

250.833.2062

shuswapINDEPENDENTLY OWNED AND OPERATED.

®

MARG KENTEL

This home is currently known as Turner Creek Bed & Breakfast. Centrally located on a .34 acre lot bordering Turner Creek Trail and amenities. Major renovations downstairs include two rental units each with bdrm, bath and LR. Separate walkout entrance to private yard with waterscape and fruit trees. Main fl oor features a third rental unit with bdrm, bath and LR and a fourth rental unit has brm, bath, sunroom and kitchen. Main fl oor could be used as a 2 bdrm, 2 bath residence. Zoned R4 and has all approvals from the City.

631 21ST SREET NE

MLS® 10048052 $399,000 MLS® 10030312 $259,900

110 - 870 10TH STREET SWBright and immaculate, 3 bdrm., 3 bath corner unit townhome across from Piccadilly Mall. Newly painted and upgrades throughout. Spacious kitchen, den with natural gas fi replace, main fl oor laundry, central air and lots of storage. Single car garage, extra parking stall and private patio. In a fl at area, within walking distance to malls and park.

MLS® 10044847 $309,900

3280 1ST AVENUE NEExcellent family home with lake view in a prime area. The upper level of this home features 2 bdrms and 1 bath plus a large laundry/storage room. The lower level features a 1 bdrm, 1 bath in-law suite with separate entrance. Private, landscaped yard and lots of parking.

MLS® 10040929 $429,900

1090 14TH AVENUE SEThis gorgeous lake view home will appeal to all. Nearly new, with an open fl oor plan, beautiful kitchen with island, 4 bedrooms, 3 full baths, large family room, offi ce and loads of storage. Two gas fi replaces, attached, double, heated garage, and a beautifully landscaped yard. The lower level of this home can easily be converted into a suite as it has a separate entrance and is plumbed for a kitchen.

Family home with 5 bdrms. and 3 baths on private, no thru road. Huge kitchen, formal dining, sunken living room, wood fi replace, and beautiful views. Main fl oor laundry. Above main features a large master suite with luxurious ensuite, and the lower level of this home is fully fi nished and features a suite with separate entrance. Private, fully landscaped yard, double attached garage and additional parking.MLS® 10045181 $474,900

1471 17TH AVENUE SE

Substantially renovated home with an unobstructed view of the Shuswap Lake. This 4 bdrm., 2 bath home offers a bright, open fl oor plan, beautiful kitchen with lots of cabinets, fi replace, built-in vacuum, central air, and a fully fi nished lower level with separate entrance. Large, enclosed balcony, and a fully landscaped, fenced yard. Single, attached garage, additional and RV parking. In a great location, with schools, recreation and shopping nearby.

MLS® 10041519 $339,000

2670 LAKESHORE ROAD NE

250-832-7871

Cory Bagg

& [email protected]

shuswapBC.com

HomeLife Salmon Arm Realty

SOLDSOLD SOLD

• Open fl oor plan with vaulted ceiling in livingroom

• Patio doors to a large wrap around deck to enjoy the view

• Rustic reclaimed wood & slate fl ooring upstairs

• Walk thru closet in master bdrm with ensuite bath roughed in

• 1 bdrm suite on lower level - all redone - new lino & engineered hardwood, separate laundry.

$319,900

Great Lake & Mountain Views

MLS® 10047970

• A little bit of paradise...1.5 acres on nicest part of Shuswap Lake

• Deeded, reasonably fl at with over 240 feet of water frontage

• Solid well built log cabin with 2 lofts, view balcony, small guest cabin/tool shed

• Newer dock to relax, tie up the boat and take in the Shuswap fun, 2 buoys.

MLS® 10044382 $569,900

Secluded Waterfront

• Townhome offers over 2000 sq. ft.• 3 bdrm., 3 full bath and w/i closet• Gas f/p, updated fl ooring on main• Covered deck and family room• Freshly painted.

$249,900

Great Value, 3 bdrms, 3 baths

MLS® 10029679

• 77 feet of private pebble beach with deck, private wharf, buoy and lakeside entertainment deck

• Immaculate 3 bedroom, 2 1/2 bath Canadiana home• Fully landscaped with professional rock walls &

stamped cement drive• Large double garage & attached carport, serviced

R.V. site.

MLS® 10045271 $999,900

Lakeshore Retreat

New!• Vaulted ceilings, 3 bdrms., 3 baths• Large family room, great family home• Brick f/p & wood stove, updated fl ooring• Large terraced deck with hot tub, landscaped

yard• Lake & mountain views, garage & carport,

room for RVMLS® 10044757 $339,900

Private 1/4 Acre Lot

H Lif S lMLS® 10044688 $995,000

Waterfront – Spectacular Home• Custom cabinets, granite counters, walk in pantry• 2900 sq.ft., 4 bdrms, 3 baths, hardwood, granite &

cork fl ooring• Large recreation room, wet bar & walk-out basement• Professionally landscaped 1/2 acre property• Large covered deck, heat pump, BI Vac• Boat launch, huge dock, 2 buoys, 3 RV sites

A R lt

• Nearly 1200 sq. ft. on your own lot (no pad fee)

• New furnace, roof, fl ooring and paint• Large mud room, detached storage shed• Good location close to the beach• Ready to move in. Great value!

MLS® 10042607 $174,900

Totally Updated 5 bdrm. Home

Page 4: Salmon Arm Shuswap Real Estate

C4 www.saobserver.net Wed. & Fri., May 30 & June 1, 2012 Salmon Arm Observer & Shuswap Market News

250 832-7871 250 675-4931 • 1-800-890-9166

[email protected]

HIGHERSTANDARDS

Cell 833-2088

66

Fridays & Saturdays1:00-3:00 p.m.

& S t d

ONLY 2ONLY 2HOMES LEFT!HOMES LEFT!

MLS® 10038125

#10 - 2850 7th Avenue NE

$337,000

New rancher with unfi nished basement. 1229 sq. ft., open concept great room, 2 bedroom, 2 bathroom, extra parking. Rustic Birch Cabinets, 45+, HST and kitchen appliances included. 2-5-10 new home warranty.

Independently Owned and Operated, ® TM, trademarks of Century 21 Real Estate LLC, used uner license. The intent of this communication is for informational purposes only and is not intended to be a solicitation to anyone under contract with another real estate brokerage organization.

Paige GregsonToll Free: 1-877-227-4073 email: [email protected]

www.PaigeGregson.com

Looking for country living but with the perks of a city? This 23.75 acre property is just a couple of minutes from Enderby, is on municipal water and has incredible views of Enderby Cliffs. There is a 3 bedroom, 2 bathroom 1,983 sf home with a 22’x36’ shop/barn. Current zoning allows for a second residence to be built without having to subdivide, although subdivision is also possible. You could build your dream home and rent out the current home! Gas hot water tank: gas furnace & wood stove; replaced roof & more!

Located across from DeMilles, there is plenty of room for RV and ATV parking! The at-tached double carport (20’9”x25’6”) can be used as a shop & the new 22’x20’ deck comes with the hot tub. There’s a garden and fruit trees + a shed. The 2,390 sf home has 3 bedrooms down & 2 bedrooms up with a main fl oor laundry: 2 bathrooms & is heated by wood and/or natural gas. The roof & the hot water tank have been replaced. Whether you have a home-based business & would like lots of space & easy access or just need room for your shop and toys & family, this may be the spot for you!

10 Valcairn Road, Enderby23.75 Acres with a House, Shop/Barn$459,000

MLS® 10029386

3551-10 Ave SW, Salmon Arm0.5 Acres with a 5

Bedroom Home$295,000

MLS® 10047026

250-308-2928ROYAL LEPAGE WESTWIN REALTY

RICK WATERSTOLL FREE: 1-866-374-1461

2749 Golf Course Drive, Blind Bay MLS 10043338 • $437,500

Best bang for your bucks! Mint 10 year old 3+2 bedroom rancher with walk out basement has approx. 1850 sq. ft. main & 3450 fi nished. Has oak fl oors through living, formal dining & main fl oor family room with gas fi replace. Big open oak kitchen with granite topped island eating bar, stainless steel appliances, tile fl oor & eating area. Large master bedroom has his & her closets & jet soaker tub with separate shower. Basement is fully fi nished including easy inlaw suite if needed. Also has main fl oor laundry, large tile foyer, heat pump, central air, HE furnace, built in vac, security system, yard shed, 16x12 deck with natural gas BBQ hook up & more. Enjoy your treed in private yard & only minutes to lake. Located in Shuswap Lake Estates golf subdivision with gated RV parking & only 15 minutes to Salmon Arm.

Call for all your Real Estate Needs!Email: [email protected] Website: www.shirleybarker.ca

SHIRLEYBARKER

250-833-7869

Level entry lake view home in Cedar Heights, immaculate inside with hardwood fl oors, many up-grades, new fi xtures, paved drive, manicured yard, walk-out bsmt.

MLS® 10042755 $429,500

WHAT THE SELLERS LIKE ABOUT THER HOME? IT IS ...

This lot has a spectacular LAKE VIEW! Cleared and ready for your new home. Easy walk to Rec centre, college and schools.MLS® 10039042 $129,000

LAKE VIEW

A great offering to a fi rst time buyer, 2 bdrms up, 2 bdrms. up, 2 bdrms dwn, family room dwn, all appliances, central a/c, circle driveway. 0.34 acre lot.

MLS® 10048005 $333,300

NEW LISTING!

5.58 Acres 5 min. from town, zoning allows for secondary suite, dble RV carport, guest cabin/studio fully contained, 16x30 shop, wired, outbuildings. Loaded with potential!MLS® 10047560 $479,000

NEW LISTING!

Thhhhhhhhiiiihihhhiihiiss lotot ot ototototototoototototototototttt hashashashashashashashashashashashasashashashashasasasasas aaa a ssppppppppeppspppppppp ccccccccctctctctaccccccccc culculculcuuuuuuucucucuucuu ar ar LAKLAKLAKLAKLAKLAKLAKLAKLAKLAKAKLAKLAKLAKKLAKLAKLAKE VE VE VE VE VE VIEWIEWIEWIEWIEWEEEEEWIEWIEWIEWIEWIEWIEWIEWIEWEIEWIEW! Cleeeeeeeeeeeeeeeeeeearearearearararaaaaaaaaaaa d ad andndndnd nd nd d dddddd d nd ndd reareareareaaaaaareaaaaadydydydydydydydydy dydydy dy dy dy dy dy dy dydy y forforforrrrrrrrrrrrrr y y y y y y yy y yyyoo yy yyo yyyy ur newewewewewewwww hohohoho ho hohoohohohohoho hooommemememememememememe.meme.me.me.me.meme.meme.measasasasasassssassssssssssssy wy wy wy wy wy wy wy wwwwwwy wwy wwy wwy wy walalalkaaaaaaaaaaaaaaaaaa tttotototototototototototoooooooo RRReReReRe R R R R RR R R R R R c cc ccccccceenenenenenenenenenentententententntenentenenen re,re,rererereeeeeeeeeeeereeee cccccoococococococococolllllllllllllellllellellellellegchchhhhhhhhhhhhhhhhhhhoolooloolooloolooloolooooooooooooo ss.s.s.s.sss.s.s.s...sSOLD Levevvvvvvvvevvvvvvvvvvveel eee ententententnttttttryryryryyyyyyryryryryyry lalalalalalalalalalalalaklaklaklaklalalalalakla e vvvvvvvvvvvvvvvvvvviewiewiewiewiewiewwwwwwiewiewwwwwwwww hoooooooooooooooooommmmmmmmmmmmme mmmmm in inininnnnininnninnnnnn CCCCCCCeCeCeCeCeCeCeCedCedCeCeCeCedCCe ar HeiHeiHeieieiieiiggghghghghghghghghghghtghtghghghghghghghgh s

mmmmmmmmmmmmmmacuacuacuacuacucuacuacuacuacuacuacuacuacuacuacuacuacuacuaculatlalalalalalalallalalalallaa e iiiiiiiinnnnsnsnsinnsnsnnnsnnnn de dedeeeeeeeeeeeeeee wwwwwwitwitwitwwwww hhh h h hh hh hh hh hhh hh hh hh hh hh h hh h hh hhardardardardardardardarda dwoowoowoowoowoowoowoowoowoowoowoowoowoooowoowoooowoowooooood fld fld fld fld fld fld fld fld fld fld fld fld fld fld fld fldd fld fld fld oooooooooooooooooooooooooorrrsrsrsrsaaaannnnnnaannnannnnnnany uy uuuuuuuuppppppp-p-p-p-p-gp-gppppp- rarararararaadadadadadadadadraaadadraaades,es,es,es,es,es,es,eses,esesesessses,es,es,eses,es, nenenenenenenene nenene ne ne nene ne ne ne newwwwwwwww fiw fiw fiw fiw fiwwwwww fiww xtxtxttttttuuureannnnnnnnnnnnicuicuicuicuicuicuicuicuicuicuicuicuicuicuicuicucuicuicuicuicuredredredredredredredredredredredredredredredredredredreddd yyyyyardSOLD

The Canadian dream...

homeownershipLocal REALTORS® are here to make it happen.

Talk to them today to discuss your needs and get your search started. They look forward to

working with you!555 DREAM STREETThis saltbox is just what the doctor ordered. An open floor plan, skylights throughout and a recently remodeled kitchen are just some of the features you’ll appreciate in this charmer. Come and see it this Sunday. You won’t be disappointed.$000,000

777 DREAM STREETThis executrive home is just what the doctor ordered.

An open floor plan, skylights throughout and a recently remodeled kitchen are just some of the features you’ll

appreciate in this charmer. Come and see it this Sunday. You won’t be disappointed.

$000,000

A publication of the

W E E K L YW E E K L Y

S H U S W A P

Page 5: Salmon Arm Shuswap Real Estate

Salmon Arm Observer & Shuswap Market News Wed. & Fri., May 30 & June 1, 2012 www.saobserver.net C5

$1,900,000

428 ft of waterfront in Sunnybrae, only 20 minutes from Salmon Arm. Original architectural design home refl ects a contemporary fl air enhanced by natural surroundings. Floor to ceiling rock fi replace & windows, unique European doors, guest/den suite with full bath.

MLS®10044079

428’ ofWaterfront

Call Shirley

$375,000North Broadview huge lot

Indoor swimming pool, 3 bedroom 2 bath basement home, detached garage shop, view, garden area and fruit trees.

Call Lisa

MLS®new

$569,000Golfers a must see

Custom built home backing on 3rd fairway, open fl oor plan, 13 ft ceilings, amazing kitchen, basement walks out to patio

MLS® 10044312

Call Gary

$339,000New Price

Be pleasantly surprised when you enter this home. 2300 sq ft fi nished on 3 levels, impressive fl oor to ceiling windows, hardwood fl oors rich shaker style cabinets & island, extra spacious family room plumbed & wired for suite, loft master bedroom + 3 more bedrooms. 3 full baths

Call Shirley

MLS®10043083

$349,000

$309,000

Park Ridge Townhome

Beach priviledges!

Open concept, quality fi nishing through-out. 9’ ceilings, skylights, gas fi replaces & central air.

Shuswap Beach Estates community offers beach & boat privilege’s. Completely renovated house, heated garage, fenced yard.

MLS® 10042264

Call Tara

Call Tara

$379,900White Lake

Lakeview & southern exposure on this 4 bdrm, 2 bath, 1 acre residence. 2 n/g f/p, oak kitchen, fully furnished. Nice.

MLS®10016022

Call Steve

$269,900Panoramic Views

Bring your plans in Upper Raven to this large, private .9 acre lot with spectacular lake and mountain views.

MLS® 10042472

Call Jeremy

$415,000Motgage Helper

3 bedroom level entry family home with a bonus rec room down and a 2 bedroom suite. Open layout, large deck with spectacular views, a/c, double garage, quiet street and a yard for kids ro playMLS®10044960

Call Jeremy

$279,900First Time Buyer Alert!

2 bdrm., 1 bath home. Flat 0.5 acres offer plenty of elbow room, right in town, fruit trees, 23x15 garage and 21x13 insulated shed with 220V – room for all the boy toys. Big enclosed balcony – perfect for entertainment.

MLS® 10047222

Call Susanne

$599,000Gardom Lake Area

Beautifully appointed grounds compliment spacious 3 bdrm, 2.5 bath rancher. 5+ acres, groomed trails for toys. Your home retreat.MLS® 10047987

Call Steve

$99,000Quiet rural location!

2 bdrm., 2 full bthrm., quiet family park. Private yard, garden/green hse. & shed/shop.

MLS® 10047715

Call Tara

$137,000View lot

Rare R8 zoned “VIEW” lot allows for secondary suite. Corner site suitable for required tenant parking or for RV parking. Orchard Ridge lets you walk to town.

MLS® 10047985

Call Shirley

$799,90020 Acres on Salmon River

Set up for horses, updated 4 bdrm 2 bath home, 2 wells, water rights, level acreage, 56x60 barn (12 box stalls & oversized foaling stall), 100x200 riding ring, 26x70 hay storage

Call Lisa

MLS® 10046844

NEW PRICE!!NEW PRICE!!

250-832-9997

Helping youyou is what we do™

Toll Free: 1-877-604-9007www.royallepageaccess.caemail:[email protected] Alexander Street NE, Salmon Arm

$245,000Lakeview property

Property listed for land value. House needs extensive reno’s. Vendor motivated. Bring offers. Property is .83 acres.

MLS® 10029538

Call Gary

NEW LISTINGNEW LISTING

SOLDSOLD

$369,900Affordable Waterfront

on Little White Lake. Cozy 4 bdrm., 2 bath home with private setting and 700 sq. ft. deck, great for entertaining all your friends and family. Enjoy breathtaking view, peace and quiet. Plenty of room to build a garage or shop.

MLS® 10047233

Call Susanne

$246,900Move in ready

This location makes it even better! Broadview Villas townhome in the centre of everything offering an updated 2 beds plus den, 2 bath, spacious master, patio and garage parking. Your whole world only a walk away!

MLS®10037829

Call Jeremy

Page 6: Salmon Arm Shuswap Real Estate

C6 www.saobserver.net Wed. & Fri., May 30 & June 1, 2012 Salmon Arm Observer & Shuswap Market News

Bob Cliffe

ShuswapShuShuswap

®

[email protected] (250) 803-8600

Your Real EstateConsultants for Life.

Team Shuswap

(250) 804-3043

Dee Crinion

Linda Cliffe, Unlicensed Assistant

250-832-7051 • 1111 Lakeshore Dr. SW, Salmon Arm, B.C. • www.teamshuswap.com • [email protected]

MLS® 10046993 $515,000

®

5142 Eagle Ridge Rd., EB• Incredible custom built log home• Intoxicating lake view• Balcony off master suite• Meticulous inside and out• Spacious deck• Detached garage & separate tool shed• Nicely landscaped U/G sprinklers

MLS® 10035288 $369,000

991 Garroway Rd., Sorrento• 2 bedrooms, 2 baths• Workshop• Own a share of the beach• Walk community lakefront

lot• Spacious deck for summer

enjoyment• Fenced back yard

MLS® 10047901$899,000

543 Lakeshore Drive, Chase • Lakeshore, 90’ Sandy Beach• Spacious master bedroom with private patio• 4 piece ensuite• Covered deck facing lake• Private hot tub area• Immaculate• Manicured parklike back yard• Convience of city living

MLS® 10045586 $53,800

33-1885 Tappen Notch Hill Rd• 55+ Mobile Home Park• Pleasant valley views• One bedroom, one

bathroom• Immaculate!• Nice large deck

MLS® 10045479 $400,000

3701 20th Avenue, Salmon Arm, SE• 10 Acres• Flat useable acreage• Re-zoning potential• Terrifi c holding

property• In town, close to the

airport

MLS® 10043743 $234,900

6 - 1215Notch Hill Road• 2 bedrooms, 2 bathrooms• A roomy loft• Spacious living room w/

gas fi replace• Large covered patio,

lakeview• Walk to town• Double detached garage

MLS® 10036443 $153,500

61-1885 Tappen Notch Hill Road• 3 bedrooms, 2 baths• Spacious open design• Doublewide in 55+ MH

park• Large covered deck• Intoxicating valley view!• Carport with storage area

MLS® 10040286 $154,900

7-1885 Tappen Notch Hill Rd.• 3 bedrooms, 2

bathrooms• Central air

conditioning• Spacious open design• Private patio• 55+ mobile home park

NEWLISTING

each offi ce is independently owned and operated

www.century21lakeside.com

Merry AndersonMANAGING BROKER

[email protected]

$399,900

SUMMER’S COMING!Life at the lake creates family memories lasting a lifetime. Just steps to the lake & boat launch.Enjoying the lakeview from the huge sundeck. 3 bedroom 2 1/2 bath, Open fl oor plan in the main living area,Master bedroom complete with ensuite and private balcony.The bright cheery guest suite above the garage is perfect for your guests.

Kevin Campbell REALTOR®

[email protected] www.kevincampbellrealestate.com

$499,000

2 homes on 1 lot in prestigious Shuswap Lake Estates subdivision. Great lake view from every room in both homes. Main house has 2 bedrooms, 1 1/2 baths, updated kitchen & fl ooring 3 years ago, patios & covered deck. Unique design, one of a kind. 2nd house is a Panabode style self contained 2 bedrm, 1 bath home on 2 fl oors with it’s own driveway and parking, rented for $750/mo has new metal roof 2 years ago, new carpet, electric baseboard heating, separate meter, deck, patio and great lakeview.

MLS® 10039629

2531 Waverly Dr., Blind Bay

Bev Burk REALTOR®

[email protected]

$479,000

The perfect home for entertaining. 2700 sq/ft fi nished main fl r w/ full unfi nished bsmnt on level .4 acre lot backing onto the golf course. The entrance will astound your guests. Formal dining rm,huge living rm,full ensuite for guest bedrm & the master bdrm has a luxurious 5 pc ensuite and a must see walk in closet. Listed $200,000 below tax assessment it’s priced to move. MLS #10045626

2716 Golf Course Dr.

688 Viel Road, Sorrento

South Shuswap Offi ce

10-1240 Trans Canada Hwy. Sorrento, BC10-1240 Trans Canada Hwy. Sorrento, BC

250-675-2317 • 1-877-272-3063250-675-2317 • 1-877-272-3063

28Years ofService

Lakeside Realty Ltd. The Local Experts!

MLS #10031235

Wanted:more

Find it in the Shuswap Real Estate

guide printed each week in the

Salmon Arm Observer and Shuswap

Market News.OPENSUNDAY 1–3AddressThis two-stor

square footagesquare footage

$459,800

&171 Shuswap Street, Salmon Arm

250.832.2131

Page 7: Salmon Arm Shuswap Real Estate

Salmon Arm Observer & Shuswap Market News Wed. & Fri., May 30 & June 1, 2012 www.saobserver.net C7

T he only thing better than visiting the Shuswap ... is living here!

Cell: 250-253-5303Website: www.erinleek.comEmail: [email protected]

Ranchero Heights Phase II(Small Acreages just outside of Salmon Arm city limits)

Lot 6 - Phase I 2.74 acres MLS®10001100 $149,900Lot 11 - Phase II 2.50 acres MLS®10015175 $174,500Lot 13 - Phase II 2.50 acres MLS®10015177 $174,500Lot 14 - Phase II 2.47 acres MLS®10015178 $174,500Lot 15 - Phase II 2.59 acres MLS®10015179 $174,500Lot 16 - Phase II 2.64 acres MLS®10015180 $174,500Lot 17 - Phase II 2.64 acres MLS®10015181 $174,500Lot 18 - Phase II 2.72 acres MLS®10015182 $174,500

2.5 acre lots to build your dream home on! • Private treed settings • Fully serviced development • Gas, Hydro, drilled well • New paved road, easy access • Minutes from Salmon Arm • Low property taxes

Lot 11Lot 11$$174,500174,500

Lot 13Lot 13$$174,500174,500

Lot 14Lot 14$$174,500174,500

Lot 6Lot 6$$149,900149,900

Last Last

lot of lot of

Phase 1Phase 1

Lot 15Lot 15$$174,500174,500

Lot 16Lot 16$$174,500174,500

Lot 17Lot 17$$174,500174,500 Lot 18Lot 18

$$174,500174,500

SOLDSOLD

Lot 12Lot 12

MLS® 10041712

Full details at… www.erinleek.comwww.erinleek.com

#201 611 Shuswap St. SW, Salmon Arm• $294,900

• Live in elegance & style• 2006 condo 50+• Lakeview 9 ft. ceilings

Group TourGroup Tour

Saturday,Saturday,

June 2 at 2 pmJune 2 at 2 pm

MLS® 10037608

Full details at… www.erinleek.comwww.erinleek.com

#103 - 831 2nd St. SE, Salmon ArmWhy Rent When You Can Own? • $145,000• Country Gate 2 bdrm. lower townhome• Cozy patio & large storage• New fl ooring throughout, A/C

MLS® 10043915

Full details at… www.erinleek.comwww.erinleek.com

7834 Black Rd., Salmon ArmYour Own Private Acreage • $299,900

• 3 bdrm, 2 bath on 2.8 acres• Private treed setting & low taxes• Located in Ranchero area close to town

MLS® 10033120

Full details at… www.erinleek.comwww.erinleek.com

718 Stanley Avenue, EnderbyEnjoy Exceptional Value! • $320,000• 1987 3 bdrm., 2 bath home in Enderby• Lots of valuable updates• Beautifully landscaped, fenced yard!

MLS® 10029083

Full details at… www.erinleek.comwww.erinleek.com

34 Gardom Lake Rd., Enderby1 Acre Hobby Farm! • $325,900

• Minutes from Salmon Arm• 3 bdrm., 2 bath fully fi nished bsmt.• Close to Gardom Lake & recreation

#53 - 2592 Alpen Paradies, Blind BayNew Listing • $599,999

• Custom layout and 4000 sq. ft. of unique touches• Huge workshop and room for all toys• Stunning entertainment deck

Full details at… www.erinleek.comwww.erinleek.com

MLS® 10043889

MLS® 10036904, 10036867

Full details at… www.erinleek.comwww.erinleek.com

3075 Brockman Rd., Salmon ArmBeautiful Homes on 80 Acres! • $679,900• 3264 sq. ft. house 1557 awaits fi nishing• Features 4 outbuildings (huge shop)• Too many features to list call for info. pkg.

MLS® 10030324

Full details at… www.erinleek.comwww.erinleek.com

3932 Parri Road, SorrentoBig White Lk. Waterfront • $1,550,000• 328 ft. of lakeshore on 1.45 acres• Custom built 2002 home, 4200 sq. ft.• Outstanding list of highlights, call for info.

MLS® 10041712

Full details at… www.erinleek.comwww.erinleek.com

1840 27th Ave. NE, Salmon ArmLakeview Home in Appleyard• $349,900• 3 bedrooms, 2 bathrooms• Lots of updates• Delight to show!

MLS® 10048083

Full details at… www.erinleek.comwww.erinleek.com

681 17th Street SELakeview Location & Privacy • $549,900• Lakeview, location & privacy• 2 bedroom legal suite• 4100 sq. ft., 6 bdrms, 4 baths, 12

appliances

LakeviewLakeviewLots!Lots!

MLS® 9210486 .32 acre Anglemont $24,900MLS® 10014341 .30 acre Anglemont $49,900MLS® 9214446 .29 acre Anglemont $85,000MLS® 9223470 .36 acre Anglemont $99,900MLS® 10034709 .28 acre Blind Bay $115,900MLS® 10041959 .30 acre Blind Bay $139,900MLS® 10004379 1.05 acre Blind Bay $299,000MLS® 10019927 .99 acre 980 16th St. NE, Salmon Arm $390,000

MLS® 10035290

Full details at… www.erinleek.comwww.erinleek.com

#73 - 2500 97B Hwy. SE, Salmon ArmTruly One of a Kind! • $189,900

• 2007 doublewide in Countryside MHP• 4 bdrm., 2 bath, 1652 sq. ft. w/huge deck• Vaulted ceilings, superb layout

#3 - 2500 97B Hwy. SE, Salmon ArmCute as a button • $79,900

MLS® 10037719

• Countryside MHP 900 sq. ft.• New windows, doors & siding• Landscaped w/shed & 2 apple treesFull details at… www.erinleek.comwww.erinleek.com

NewNewListingListing

NewNewListingListingNewNew

PricePrice

Salmon Arm Realty.com

DARREN ERICCSANAlways in Action

Email: [email protected]: 804-8333 • Toll Free 1-800-890-9166Bus: 250-832-7871 • Fax: 250-832-7573

Welcome to #1435 Taylor Road

Fully Serviced Mostly Level 1 Acre Lot in Notch Hill.• Drilled Well, Septic System in! Phone & Hydro at Lot.• Private & Quiet. Building Spot(s) Cleared among Tall Trees.• Close to Amenities. Bonus: Mobile Homes Permitted!!•

$120,000Call Darren 250-804-8333 to view.MLS® 10046728

Look at this Awesome Lakeview of Blind Bay!

.27 Acre Quality Building Lot in Prestigious “Highlands”• Overlooks Shuswap lake Estates Golfcourse & Copper Island.• Beach, Marina, Pub, Shopping, Golf Club & Sorrento Nearby.• Only 15 minutes to Salmon Arm. Inquire on Free Golf Membership!• Bring your Dreams, Builder, Golf Clubs & Offer to Enjoy the • Shuswap!

$129,500Call Darren 250-804-8333 to view.MLS® 10041952

Welcome to #905 Chapman Crescent in Sicamous

Modern Open Concept 5 Bedroom, 3 Full bath Home.• Located in Upscale area, Walk to Beach & Amenities.• On City Water & Sewer! Inlaw Suite in Basement!• Features: Attached 2 Car Garage with 10 ft. Door.• Alarm, B.I. Vac, R.V. Parking & A/C on .23 Acre Lot.•

$348,500Call Darren 250-804-8333 to view.MLS® 10042837

Shuswap Waterfront Park gives Lifetime Memories

1/2 acre Unique Circular Lot and Cabin at Queest Village.• New Quality Docks & Boat Slip Prepaid by Owner (Gotta See!).• On Community Water System (Septic in) Very Low Strata Fees.• Room for your Water Toys in Summer and Snow Toys in Winter.• Access by Boat or Logging Road. Priced to Sell!!•

$209,500Call Darren 250-804-8333 to view.MLS® 10040884

Welcome to #14 Evergreen MHP

4 Bedroom, 2 Bath (Brand New 2 Piece Ensuite).• Major Updates Include: Roof, Windows, Siding,• Gutters, Laminate Flooring, Paint. Covered Rear Deck.• Landscaped & Fenced Yard makes Safe for Kids.• Walk to Schools, Shopping, Recreation & Amenities.•

$58,500Call Darren 250-804-8333 to view.MLS® 10045978

Panoramic Lakeview in Sunset Ridge

An area of quality homes centrally located in Salmon Arm.• 3 bedroom + Den, 3 full baths, w/deep double garage• Boasts 2 decks to enjoy sweeping lake & mountainviews• Recent new: windows, roof, furnace, heat pump, central A/C• Your kids will love the safe fenced yard, play house/centre.•

$349,500Call Darren 250-804-8333 to view.MLS® 10048097

New

New

WonderingWhere to Begin?

We have just the place…

Retire to Luxury.You’ve worked hard your whole life, and now it’s your turn to relax and enjoy retirement with maintenance-free living in an active adult community that truly has it all.

Luxury Townhomesfor adults 55 and better

from the low $200s• 2 to 3 bedrooms • 2 to 3.5 baths • Master whirlpool suites• Gourmet kitchens • 2-car garages • Community clubhouse• Pool & exercise facility • Lake & walking paths

See your local Shuswap

REALTOR® for all your needs

W E E K L YW E E K L Y

S H U S W A P

Page 8: Salmon Arm Shuswap Real Estate

C8 www.saobserver.net Wed. & Fri., May 30 & June 1, 2012 Salmon Arm Observer & Shuswap Market News

Jim Grievejimgrievesalesteam.com

Cell 250-833-6312 TOLL FREE 1-800-890-9166

[email protected]

• 2875 fi nished sq ft• Immaculate 1 owner home• Large view windows• 2 fi replaces & central A/C• Oversized double garage• Landscaped .32 acre lot

• 1740 fi nished sq ft• 3 bedrooms and offi ce• Beautiful hardwood fl ooring• Stainless steel appliances• New home warranty• Quality throughout

MLS® 10046604 MLS® 10044741$479,000 $384,9002600 Grandview Place 420 24th Street NE

STUNNING LAKE VIEW

READY TO MOVE IN

$412,900

CONTEMPORARY

391 10th Street SE

• 1800 sq. ft w/ 3 bdrms• Tigerwood hardwood fl oors• Custom gourmet kitchen• Quality design throughout

MLS® 10047520

$326,000

HILLCREST AREA

1581 14th Street SE

• 2050 fi nished sq ft• 4 bedroom, 3 bathroom• Vaulted ceilings, fi replace• .18 acre, fenced yard

MLS® 10036175

$619,000

RURAL ESTATE

4891 Foothill Road SW

• Renovated 3600 sq ft• Stunning inside and out• 7 bdrms plus 1 bdrm suite• Landscaped .72 acres

MLS® 10042742

$1,295,000

DEVELOPMENT PROPERTY

250 5th Avenue SW

• 2.01 Level Acres• Level & fully serviced• Prime corner location• R5 Zoning up to 80 units

MLS® 10039265

$439,000

LOTS OF ROOM

2580 21st Street NE

• 2400 fi nished sq ft• 3 bedrooms, 2 bathrooms• Oversized heated garage• .5 acres with fruit trees

MLS® 10036413

$369,000

CLOSE TO SCHOOLS

1691 13th Avenue SE

• 2100 fi nished sq ft• 4 bedrooms plus den• Private .66 acre lot• Wonderful lake view

MLS® 10045516

$325,000

GREAT VALUE

3398 McBride Road

• 3,500 fi nished sq ft• 3 bedroom, 3 bathroom• Lovely lake view• Landscaped, fruit trees

MLS® 10047047

$305,000

LAKEVIEW

#303 - 1391 10th Ave. NE

• Immaculate 1540 sq. ft.• 2 bedrooms plus den• Bright open fl oor plan• Heated/secure UG parking

MLS® 10040798

$249,000

GREAT STARTER HOME

640 7th Street SE

• 1,000 fi nished sq. ft.• 3 bedrooms, 2 bathrooms• Lots of recent upgrades• Fully fenced back yard

MLS® 10046512

$150,000

DEVELOPMENT LOT

4951 Auto Road

• Level .50 acre• Located in Industrial Park• M1 Industrial Zoning• High visibility lot

MLS® 10039675

• 46 detached homes• 3 bedrooms/2 bathrooms• 1,320-1,664 square feet• Hardwood fl oors, vaulted ceilings

• Full appliance package• Geothermal, Hardi Siding• RV Parking• New Home Warranty

MLS® 10045872/80$199,000 5211 Trans Canada Highway

OPEN HOUSE: TUESDAY TO SATURDAY 1 PM - 5 PM

Starting at...

BEACH GROVE PROPERTIES

Page 9: Salmon Arm Shuswap Real Estate

Salmon Arm Observer & Shuswap Market News Wed. & Fri., May 30 & June 1, 2012 www.saobserver.net C9

The Name Friends Recommend…

REALTOR®/Co-ownerREALTOR®/Co-ownerjayagassiz.com

250.833.8284

Full details at...

Scan QR Code to shop homes

from your mobile phone!

Now:Supernatural Setting!

$384,900

MLS® 10

039568

No Ordinary Home!$379,900

MLS® 10

041521

A Real Suite Deal!$359,900

MLS® 10

045205

Now:

Visually Stunning!$397,000

MLS® 10

046991

New:

You Own the Land!$239,900

MLS® 100

46493

New!

A Roomy Rancher!$369,900

MLS® 10

038607

JUST JUST

SOLD!SOLD!

Affordable Start!$94,900

MLS® 10

041559

Country Charmer!$294,900

MLS® 100

42855

Bright and Roomy$324,900

MLS® 10

039129

2 Homes - 79 Acres!!$795,000

MLS® 10

044315

2 Bed, 2 Bath Rancher!$155,000

MLS® 10

045169

Willing to Trade!$189,900

MLS® 10

039502

5+ Acres Near Beach!$214,900

MLS® 10

024073

Bye Bye Landlord!$219,900

MLS® 10

021169

The di erence is clear:Your Shuswap REALTOR® gives you personalized attention for buyers and sellers 24/7.

W E E K L YW E E K L Y

S H U S W A P

Page 10: Salmon Arm Shuswap Real Estate

C10 www.saobserver.net Wed. & Fri., May 30 & June 1, 2012 Salmon Arm Observer & Shuswap Market News

Free Real Estate Evaluations

Call: 250-832-0111OPEN 7 DAYS A WEEK

Visit Assist-2-Sell online at www.4ShuswapHomes.com Doug Hubscher

Serving the South Shuswap

since 2008

Buying or SellingEveryone calls Assist-2-Sell

EXCEPTIONALLY WELL MAINTAINED

$67,500MLS® 10046478

• 2 bdrms., 1 bathroom, central air conditioning

• Covered deck, sundeck, carport

• 12’x16’ wired and insulated workshop

• Upgrades: Roof, furnace, H/W tank, fl ooring, electrical & plumbing

~ Countryside Mobile Manor ~~ Countryside Mobile Manor ~

BUILD ORINVEST

$137,900MLS® 10026564

• 7.97 acres naturally wooded• Minutes to Shuswap Lake &

boating• On no thru road - seasonal

creek• Near fi re hall, store, and

driving range

~ Eagle Bay ~~ Eagle Bay ~

PRECIOUS MEMORIES BEGIN

HERE

$299,900MLS® 10043343

• 5 bdrm, 3 bathrm patio & hot tub

• 2 decks, fenced yard, garage• Private guest bedroom, sitting

room & bathroom• Corner lot, fi replace, sauna• Near beach, boating, golf and

elementary school

~ Canoe ~~ Canoe ~

LAKEVIEW TERRACE

$399,900MLS® 10033975

• Level entry with walkout basement

• Patio, 2 decks, gorgeous lake views

• 2 bdrm, 2 bath spacious design

• 2 car garage, A/C, near downtown core

~ NE Salmon Arm ~~ NE Salmon Arm ~

~ NE Salmon Arm ~~ NE Salmon Arm ~

$529,900MLS® 10048017

• Carefully designed and Custom built

• 5 bdrm, 3 bathroom on 0.44 acre lot

• Quality thoughout, hardwood and tile fl oors

• Maple kitchen with breakfast bar

• Fireplace, garage, workshop, sundecks

CANDID LAKEVIEW OF COPPER ISLAND

FROM MCARTHUR HEIGHTS

FEATURE

OPEN MOUNTAIN VIEW

$400,000MLS® 10033933

• Level entry with walkout basement

• Patio, 2 decks, gorgeous lake views

• 2 bdrm, 2 bath spacious design

• 2 car garage, A/C, near downtown core

~ Sorrento ~~ Sorrento ~

SORRENTO HEIGHTS MOBILE HOME PARK

$80,000MLS® 10039112

• Marvelous panoramic lake view

• 3 bdrms, 2 bath, 1993 single wide

• Paved driveway, 10x47 wood deck

• No neighbors on either side• Quick possession

~ Sorrento ~~ Sorrento ~

CUTE, COZY &AFFORDABLE

$199,000MLS® 10046337

• 2 bdrms., 1 bathrm on 0.11 acre lot

• 14’x22’ Garage/Workshop• Veg. garden and Fire Pit• By Community Hall, Seniors

Hall, Corner Store, Beach, Boating, Golf, Firehall & Elementary School

~ Canoe ~~ Canoe ~

THREE-IN-ONEINVESTMENT

$305,000MLS® 10044786

• Main fl oor, 4 bedrooms, 1 1/2 baths

• Plus 2 identical 1 bdrm, 1 bath in-law suites

• 0.21 acre lot in town• 30’x30’ garage• Near all amenities

~ Salmon Arm ~~ Salmon Arm ~

SKILLFULLYRENOVATED

$394,900MLS® 10040304

• 0.75 acre, 5 bedrooms, 2 1/2 bathrooms

• 26’x28’ insulated shop, barn, shed

• Covered RV storage• Flat yard, easy access• 10 mins. to town, bus

service

~ Salmon Arm SW ~~ Salmon Arm SW ~

NEW

LISTIN

G

for a new home?

Shuswap Real Estate Weeklyshowcases many listings in the Shuswap for sale

You Deserve the Home of Your Dreams

Everyone deserves a beautiful place they can call home.Everyone deserves a beautiful place they can call home. Shuswap Shuswap REALTORSREALTORS®® firmly believe in that and will strive to firmly believe in that and will strive to makemake it happen for you and your family. it happen for you and your family. Check out their ads Check out their ads in our real estate section and call any of them today and in our real estate section and call any of them today and make your dreams come true!

171 Shuswap Street, Salmon Arm250-832-2131

&

Page 11: Salmon Arm Shuswap Real Estate

Salmon Arm Observer & Shuswap Market News Wed. & Fri., May 30 & June 1, 2012 www.saobserver.net C11

250.832.6060

2 bedroom apartments incl. heat/or dishwasher and 2 bathrooms. Quiet, clean buildings.

FOR RENT

Priority Service For All Professional Management Services 24 Hours - 7 Days a Week

LIFESTYLES

F

PP2

Colonial House, Cedar Manor

Cary

$750-$800 per month

$308,900Lisa MLS® 10047894

• Amazing view of City of Salmon Arm& Shuswap Lk.

• Many new improvements: roof, paint, kitchen, fl ooring, lighting

• Medium density, great revenue property, .25 of an acre

661 2nd Avenue NE

$189,000Cori MLS® 10037094

• Priced to sell!• White Lake• 2 bed, 1 bath• Shop and auxiliary building

2844 Schmid Road, Sorrento

$328,800Don & Linda MLS® 10046666

• 3 story townhome• 3 bdrms, master on main fl oor, 2 1/2 baths• A/C, quality cabinets and crown moldings• Full basement

2693 Golf Course Drive # 2

$399,900Barb MLS® 10047258

• Excellent Location!!! Great Price!• 4 bedroom, 2.5 bathrooms• Beautifully lLandscaped• Lake and Mountain Views

4860 14th Street NE, Salmon Arm

$292,900Dave MLS® 10038655

• JUST REDUCED!• 2 bedroom, 2 bath• Huge 16x43’ garage w/14’ tall door• Great location, 2 blks. to boat launch

#5 433 Finlayson St., Sicamous

$119,900Kent MLS® 10041130

• Why rent when you can own?• Time to kiss your landlord goodbye!• $5,995 down and just $486/mo. OAC!• Call Kent Redekop @ 250-318-8120 to view!

#21 - 1070 1st St. SE, Salmon Arm

$389,000BIGRob MLS® 10047025

• New Listing! 4 bedroom, 2 bathroom• Stroll to Swimming Beach & Marina• Gigantic Huge Detached Shop for all the toys• Corner, private landscaped lot on quiet street

2454 Leisure Road, Blind Bay

$689,000BIGRob MLS® 10047597

• New Listing! 3 bdrm, 3 bthrm luxury home• Stunning features include heated pool• His & her golf memberships included• Fully landscaped, impeccable property

2745 Sunnydale Drive, Blind Bay

$1,150,000Kent MLS® 10043071

• Shuswap’s most exquisite home!• Vendor must sell!• 2.5 acre semi-waterfront lot!• Call Kent Redekop at 250-318-8120

2252 Eagle Bay Road, Blind Bay

$289,000Dave MLS® 10047447

• End unit townhome, all one level • 2 Bed 2 Full Bath• Double garage with ample parking• Only one block from the Lake

#116 222 Martin Street, Sicamous

$379,900Keith MLS® 10040052

• Perfect family home in Raven.

• 3 bdrms up, 1 down. 3 full bthrms.

• Lakeview. Sundeck. Finished up and down.

• Beautifully landscaped. Shop. RV parking.

4840 13th Street NE

SALMON ARM250 832-6060364 Ross St. NE

SICAMOUS250 836-2121

301 Main St.

Barb LeRouxCori MaynesKent Redekop Lisa ButlerRob McKibbon Dave Strle Don & Linda PeakerKeith Chancellor Cary LentzProperty Management

RESIDENTIAL STRATA MANAGEMENT

PROPERTY MANAGEMENT COMMERCIAL

Page 12: Salmon Arm Shuswap Real Estate

C12 www.saobserver.net Wed. & Fri., May 30 & June 1, 2012 Salmon Arm Observer & Shuswap Market News

®®

Linda ClarkeRE/MAX Shuswap Realty Ltd. ~ 250-833-6711

www.lindaclarke.ca ~ [email protected] offi ce independently owned and operated • 1-888-676-2435

®

®

$369,900MLS® 10040489

1260 7 Avenue, SE like new and no HST! Enjoy 1790 sq ft all on one level. This gracious home features 3 bdrms, 2 full baths, crawl space for storage, gas f/p, vaulted ceiling, c/air, c/vac, offi ce & low maintenance landscaping. Perfect cul-de-sac location.

$199,900MLS® 10045375

Lot 4 Squilax-Anglemont Hwy.Semi-lakeshore .34 acre lake view lot. Just in time to enjoy summertime fun or year round residence. No need to dream about owning lakeshore with this opportunity for an affordable option to waterfront. Located directly across from Community park with great beach, picnic tables & bathrooms. Driveway is in and water at lot line.

$24,900MLS® 10042255

#5 5080 20th Ave. N.E.Why pay rent? Here's a great opportunity to own your own mobile in a smaller park at a very reasonable price. Home features 3 bdrms., full bath, porch, open livingrm., kitchen concept with lots of windows & fenced yard w/garden shed.

$339,900

$399,900

MLS® 10040419

MLS® 10041142

#3-2751 15 Avenue NE

1250 18th Street NE

NO HST! Immaculate 1678 two storey quality townhome with full unfi nished basement. Home fea-tures beautiful kitchen w/eating bar & pantry, formal dining, living room w/gas fi replace, hardwood, tile, crown moulding, 3 baths, c/air, dble. garage. f/p.

Unbelievable value – lakeview, 1/2 acre, 24x36 shop, 1 bdrm. in-law suite & excellent location near police station. Walk to all schools, pool, skating, restaurants, new Askew's and much more. Home is renovated and move-in ready. MUST VIEW!!!

$399,900MLS® 10047068

#28, 1120 - 12th St., NE.Popular Lakeview Terrace. Enjoy the lake, city & mountain views. Immaculate rancher with fully fi n-ished walkout basement. 2840 sq ft, 3 bdrms, den, 2 gas f/p, huge kitchen, formal dining, 3 baths, family rm, central va, skylight, deck & single garage.

$78,200MLS® 10025694

Lot 1, Justin Road, Eagle BayExcellent investment, Shuswap retreat, summer get-away or permanent residential. This 2.13 treed acres is split by the road. Fairly level area to build your retirement dream home or summer get-away. Walking distance to Shuswap Lake.

$335,000MLS® 10042682

1780 16th Street NELAKEVIEW, PRIVACY & LOCATION. Lovely reno-vated 3 bdrm., 2.5 bath home with full walkout basement. Private .38 acre lot backing onto park. Home would lend itself to an in-law suite. Huge covered deck. Seconds to lake & walking trails.

OPEN HOUSEOPEN HOUSESSat., June 2at., June 2 ~ 1-3 ~ 1-3 pmpm

$479,000MLS® 10035068

670 25th Street SELEGAL SUITE!! Enjoy 3200 sq.ft. of quality living. Upstairs features 2 bdrms plus den, hardwood, granite, dble garage & the list goes on. Full walk-out bsmt offers beautiful 2 bdrm suite w/covered parking. Perfect 2 family home - MUST VIEW!

NewPrice!

NewPrice!

$299,000MLS® 10034141

#301 - 571 6 Street NERare offering! Gorgeous lake & mountain views. This 55 plus condo features 1 bdrm. plus den, 1265 sq. ft., large oak kitchen, 2 full baths, gas f/p, heated fl oors, c/air, 2 u/ground parking stalls, elevator, secured entry.

MLS® 9218674MLS® 9218674$327,000MLS® 10024424

630 - 9th Street SESpacious and private 2172 sq.ft. home featur-ing 3 bdrms up, 1 down, 3 baths, gas & wood f/p, vaulted ceiling, eat-in kitchen plus formal dining. Home would lend itself to an in-law suite. Location & scenic views. Newer roof.

$139,000MLS® 10023448

4331 Trans Canada Hwy NW, Tappen1.2 acres of highway exposure. This newly subdi-vided property fronts the Trans Canada Highway. Complete with septic perk test done, license on creek for water, power & gas. Build the home of your dreams or excellent investment.

Sold

MLS® 9218674MLS® 9218674$299,900MLS® 10043103

#2 111 Harbourfront Dr. NWLakeview townhome in popular Heron View. Top fl oor unit with large windows to enjoy all the views. 1400+ sq. ft., 2 bedrooms, spacious kitchen with tons of cupboards, 2 baths, formal dining, 2 decks, double garage, living rm. w/gas f/p. 55+.

B AY F I E L DMORTGAGE

#201 – 121 Hudson Ave. NE, Salmon Arm, BC

www.shuswapmortgage.com

Vic HamiltonSR. BROKER, A.M.P.

[email protected]

Sharon WalkerBROKER

[email protected]

Ray MillsBROKER

[email protected]

Lowest Rates in Canada!

5 year closed

5 year variable

5 year quick close 3.29%

2.60%3.34%

1.866.252.4526

3.09%3.99%2.80%

5 year closed

7 year quick close

Variable

[email protected] [email protected] [email protected]

for a new home?

Shuswap Real Estate Weeklyshowcases many listings in the Shuswap for sale

Page 13: Salmon Arm Shuswap Real Estate

Salmon Arm Observer & Shuswap Market News Wed. & Fri., May 30 & June 1, 2012 www.saobserver.net C13

Proud Sponsors ofEach offi ce is independently owned & operated

®

SHUSWAP1111 Lakeshore Drive, Salmon Arm, BC

“I’m Just a Call Away”“I’m Just a Call Away”

Tracey Thompson...bringing your dreams home

Cell: 250-833-6611E-mail: [email protected]

WWW.TRACEYTHOMPSON.CACell: 250-253-3000 • Cell: 250-253-3000 • [email protected]@remax.net

WWW.TAMMYC.CA

FIRE YOUR LANDLORD!First time homebuyers seminar

Next Session:May 31st.

Exclusive LAKEVIEW acreage w/ 180 degrees of breathtaking views. 30 years of heart & soul have created the “Monet”of acreages. Over 6000 shrubs, fl owers & trees have been carefully manicured into terraced gardens, & stunning building sites.

MLS® 10047112$$699,000699,000

2030 Canoe Beach Drive2030 Canoe Beach DrivePrime location for this 5 bedroom family home near schools, new shopping plaza, restaurants & more on a quiet street in NE Salmon Arm. 1 bedroom suite offers help with the mortgage. Back deck & yard offer a wooded retreat.

MLS® 10045360$$320,000320,000

NEW LIS

TING

NEW LIS

TING 2760 25th Avenue NE, Salmon Arm2760 25th Avenue NE, Salmon Arm

Immaculate WATERFRONT 5 bdrm home offers 224’ of beautiful pebbled beach minutes off of Hwy. 1 in Blind Bay. Gorgeous custom built home offers a large gourmet kitchen, hardwood fl oors, 2 master bedrooms, spacious open fl oor plan & great views.

MLS® 10043735$$1,499,9991,499,999

2331 Blind Bay Road2331 Blind Bay Road

LAKESHORE

LAKESHORE

LAKEVIEW, private remote & treed 9.77 acres. One of a kind property w/ Tourist Com. zoning, formerly campground. Add boat & mini-storage or lots of room to build. Subdividable not in ALR. Plenty of water. Close to lake & public park.

MLS® 10040359$$499,000499,000

6288 Eagle Bay Road6288 Eagle Bay RoadExtraordinary RV lot in a WATERFRONT park on desirable Shuswap Lake offering a boatslip, boat launch, clubhouse and on site security. The manicured RV lot is within steps to the waterfront. The lot is affordable – the memories priceless!

MLS® 10043160$$129,000129,000

E t di RV l t i

#7, 667 Waverly Park Frontage Rd#7, 667 Waverly Park Frontage Rd

Over 1100 sq foot end unit rancher with vaulted ceilings, large master bedroom with en-suite, second bedroom and large garage. It backs on to treed park space with a patio for your BBQ and maintained grass space. Shuswap Lane a quite adult community in the heart of Sicamous.

MLS® 10043199$$195,500195,500

#20 221 Temple Street, Sicamous#20 221 Temple Street, Sicamous26.56 ACRES EAGLE RIVER FRONTAGE - With incredible mountain & river views - Flat usable land with a few pole barns - 13 Minutes from Sicamous and 20 Minutes from Revelstoke - Close to Sledding and Mara Lake / Shuswap Lake system

MLS® 10037149$$489,000489,000

26 56 ACRES EAGLE RIVER

4936 Ward Road, Malakwa4936 Ward Road, Malakwa

Fully landscaped 1600+ sq. ft. rancher features lg. master w/ensuite, pantry, fi replace, island, RV parking/plug, 2 sheds and 2 car garage. NEWER kitchen & appliances, roof, high effi ciency furnace and hot water tank. Close to all amenities and recreation.

MLS® 10044715$$323,800323,800

426 Cottonwood Ave., Sicamous426 Cottonwood Ave., SicamousWaterfront building lot. This .26 of an acre recreational retreat awaits your new dream home or option to put your RV there for most of the season. Tihs complex offers 700 feet of beach with boat launch, boat storage & dock. Low Strata Fees also.MLS® 10044620

$$254,900254,900

W t f t b ildi l t Thi

#SL 12 8758 Holding Rd., Adams Lk.#SL 12 8758 Holding Rd., Adams Lk.

Full Duplex, One block from Sicamous Channel, 1924 total sf per fl oor up and down. Both unit are rented and have the same layout w/ 3 bedroom with lg rec room,plenty of storage rooms, with washer/ Dryer hook ups. RV parking & Fenced Yards.

MLS® 10043835$$219,900219,900

211 Kappel Street Sicamous211 Kappel Street Sicamous“THE ROCK” Newer town home complex with loads of square footage, beautiful valley views, 2 vehicle garage. This 3 bedroom & 3 bathroom spacious end unit town home features upgraded fl ooring & appliances. In show home condition! Close to schools, shopping, dog park & restaurants.MLS® 10043740

ng, dog park & $$318,800318,800

“THE ROCK” N t

#401 4900 Heritage Drive#401 4900 Heritage Drive

Scan and see all my listings:

Full Duplex, One Sicamous Channtotal sf per fl oor udown. Both unit aand have the samw/ 3 bedroom wiroom,plenty of strooms, with washhook ups RV par

SOLDSOLD

Your Real Estate Professional

ale

Y

ochelle

SHUSWAP®

1111 Lakeshore Drive SW, Salmon Arm 250-832-7051cell: 250-804-9327 • www.rochelledale.comEach offi ce independently owned and operated

McArthur Heights ~ The Summit

$189,000-$242,000

Available Summer 2012This new 10 lot subdivision is the fi nal phase of MacArthur Heights in Blind Bay, breathtaking lake views, natural gas, water, hydro and telephone available. Quiet parklike setting in an area of prestigious homes. Lot sizes vary from 2.5 to 5+ acres.

810 11th Street SE

611 8th Avenue NE

$359,900

$1,550,000

Best Deal Out There

Investment Opportunity

• 1560 sq. ft., 3 bdr, 2 bath rancher• Full unfi nished basement• Main fl oor laundry. Heat pump, hardwood fl oors• 24 x 21 garage. New home warranty.• HST incl. in price, rebate

back to the Builder

• 15-unit apartment building across from McGuire lake in downtown Salmon Arm. Total reno in 2010

• 6 2-bdrm. apartments and 9 1-bdrm. apartments• Each unit has separate storage, easy access & parking• Coin laundry located on main level• Long term tenants,

0% vacancy rate

mls® 10035861

mls® 10019435

6230 Park Hill Road NE

mls®10025207

$549,900

North Broadview• Almost 4000 sq.ft. rancher

with basement• 6 bdrms, 4 baths• Nestled on 1.94 acres in

North Broadview• Spacious country kitchen,

hardwood fl oors, main fl oor laundry

• View of lake and mountains

#62 - 667 Waverly Park Frontage Rd.

mls® 10041323

$114,900

Shuswap Lake Park• This lot is ready for your

RV or Park Model• Secured gated community• Clubhouse, boat launch and

private beach• Boat slip and storage shed/

bunkhouse included• Hop, skip and jump from

Sorrento

mls® 10007201mlsmlsmlsmls® 1010 10007007007201201201®

7141 49th Street NE Charming Heritage Home

mls® 10046746$319,900

Renovated 1930’s home • has been tastefully updated. 2 large bedrooms, • 2 baths, renovated kitchen with custom oak cabinets. ..17 acre fenced lot•

#10 350 Hudson Street NW

mls® 10041063

$279,000

Park & Waters Edge

• 55+ retirement community

• 2 bedroom, 2 bath 1460 sq. ft. rancher

• 3 sided fi replace, A/C• Spacious fl oor plan

with vaulted ceilings

mls® 10007201mlsmlsmls® 1010 10007007007201201201®

1231 23rd Ave. SWPopular Ridge Subdivision

mls® 10044444$499,900

• Over 3100 sq.ft. executive rancher

• Fully fi nished daylight basement, 4 bdrs, 3 full baths

• Kitchen has large island with eating bar, hardwood fl oors, all appliances

• 2 n/g fi replaces, covered deck to enjoy lake view.

mls® 10007201mlsmlsmls® 1010 10007007007201201201®

1050 70th Street SESouth Canoe Acreage

mls® 10042820$459,000

• Well kept 2 bd, 2 bath home with 4.88 acres bordering onto mountain biking & horse trails

• 24 x40 shop with 220 power and high ceilings

• Large fenced garden area• Nicely landscaped with

outbuildings for storage• Great location

2558 Highlands Drive

mls® 10027719

$569,900

Executive Rancher• By Simon Builders,

currently being fi nished• Incredible lake & golf

course views• 1790 sq. ft. on the main

fl oor with fully fi nished walk-out basement

• 4 bdrms., 3 baths• Superior qualtity• Covered deck, triple garage,

hardwood fl oors, granite countertops

782 Abbington Lane

mls® 10045717

$449,900

Acreage with 2 Homes

• 2 homes on this fenced 2.89 acres

• Main house has 4 bdrms., 2 baths in just over 2,000 sq. ft.

• Second home is a 2003 modular home with 3 bdrms. & 2 baths

• Perfect setup for extended family

Page 14: Salmon Arm Shuswap Real Estate

C14 www.saobserver.net Wed. & Fri., May 30 & June 1, 2012 Salmon Arm Observer & Shuswap Market News

RE/MAX ShuswapCell: (250) 804-6765Offi ce: (250) 832-7051www.tinacosman.com ~ [email protected]

TTina Cosmanina CosmanWorking for you!Working for you!

Each of ce Independently owned and operated

MLS® 10046023 $249,900

3 bed/2 bath home. Vaulted ceilings, concrete crawl space. Appliances incl. Private fenced patio area, 10x12 shed. New roof. Lots of parking. Walk to beach, school, corner store.

SPOTLESS & AFFORDABLE

MLS® 10040385

Spacious lake view home on 1/2 acre private lot. Nicely updated, large deck, fi replace, paved driveway with carport. Plenty of room for RV & parking.

5 BEDROOMS

$359,900

MLS® 10040926

Large renovated fam-ily home, guest house, workshop, large deck, walkout bsmt., private 0.54 acres steps from the beach, dock, buoy. Great B&B potential.

INCREDIBLE PROPERTY

$864,000

MLS® 10032415

Bright and open 2 bed. Level entry rancher, walk-in closet, large bathroom, walk to shopping.

Make an offer!

LINDEN COURT

$299,900

MLS® 10039742 $639,900

Newly renovated lake view home on 5 acres in North Broadview. 4 bed/2 bath. Large open kitchen, hardwood. Certifi ed Organic property.

ORGANICFARM

MLS® 9227837 $599,900

Hobby Farm. Non-zoned, non-ALR. 3 bedroom home plus 2 rental cabins & heated workshop. Located between Salmon Arm and Revelstoke.

PRIVATE 40 ACRES

MLS® 10011087 $459,900

Salmon Arm waterfront. Over 1600 sq.ft. on main level. Rancher with unfi nished basement. Great year round or vacation property.

WATERFRONT HOME

MLS® 10035019 $247,500

Great 2 bed/2 bath unit. Clean with newer fridge, stove. All appliances included. Walking distance to downtown. Next to wharf & waterfront area. Enjoy worry-free living.

DESIRABLEHERON VIEW

MLS® 10041942

Well maintained 3 bedroom home. Large lot. Detached double garage. Very well maintained with newer furnace, vinyl windows, 50 year metal roof, updated electrical, covered back patio, fenced, partially fenced. Quiet area.

GREAT STARTER OR RETIREMENT

$249,900MLS® 10043474

Cute 2 or 3 bedroom. Fully renovated. Ready to move in. Private lot with shed, deck & pond. Fenced & close to downtown.

GREAT YARD & LOCATION

$239,900

MLS® 10029698 $124,900

This 1584 sq. ft. home has 3 bdrms., 2 baths, huge new kitchen with island, living rm., family rm., fenced yard backing onto school property. Newer furnace, HWT, roof, fl oor-ing, etc. Great park.

COMPLETELY RENOVATED

MLS® 10038588

$99,300

Featuring island/breakfast bar. Built-ins throughout. 1100 sq.ft. Newer furnace, windows/doors, fl oors, drywall, fi replace, kitchen, deck. Tasteful decor. Deck with seating, shed, carport.

INCREDIBLEKITCHEN

MLS® 10040859 $289,900

5 bed/2 bath home.Bsmt. mostly fi nished. NEW ROOF, newer appliances, master with ensuite & walk-in. Nicely landscaped & fenced yard, quiet area, close to beach.

GREAT FAMILY HOME

MLS® 10011500

$179,900

New roof, .23 acre lot. 3 bed starter or retirement home. Fenced & land-scaped. Newer deck & hot water tank. Garage/workshop. Close to beach, parks & schools. Quick possession!

UNBELIEVABLEPRICE

MLS® 10038947 $429,900

Beautiful lake view 2008 home in Shuswap Lake Estates. Hardwood, tile and granite. Open concept kitchen/dining/living area with 3 sided fi replace. Huge deck. Finished basement, 4 beds/3 baths.

LAKE VIEW

MLS® 10039450

Lake view 4 bed/3 bath close to downtown. 1998 home features large kitchen with island, beautiful brazilian redwood fl oors, gas FP, huge family room, central vac, deck, dble garage, workshop, lane access.

LAKE VIEW!

$397,000

LOTS

24.22 acres MLS® 10043688 ..... $489,00017.77 acres MLS® 10043690 .... $289,0006.52 acres MLS® 10043689 .... $249,000.29 acre lake view lot on Woodland Drive in Shuswap Lake Estates, Blind Bay

MLS® 10038942 ............................ $75,0002 semi-waterfront lots listed in Eagle Bay,over 1 acre ea. ... $239,900 & $249,900

MLS® 10045302, MLS® 10045303

MLS® 10036519 $339,900

Great family home. 5 bed/3 bath home. Large open kitchen/dining area, master with walk-in ensuite, double garage, RV parking, deck off the kitchen, no through road, close to schools & parks. Quick possession.

GREATLOCATION

$29,900

Amazing value. Nicely updated mobile. Over 1020 sq. ft. Fenced yard, large deck, carport, newer fl oor-ing and paint. Easy access to town/highway. Quick possession.

AMAZING VALUE!

MLS® 10040688

MLS® 10045291

$684,900

Spectacular 2007 custom lake view home in McArthur Heights on 1.64 acres. Backing onto crown land.

McARTHUR HEIGHTS

MLS® 10042913

.64 acre lot in Hillcrest. Totally private lot on cul-de-sac. Bright home with 4 bed-rooms/2 baths, upgraded windows, new deck, reno-vated basement, bathrooms, newer HWT & appliances. RV & boat storage.

PARK LIKE

$369,900

MLS® 10045307

$699,000

Share the waterfront at Shimmering Waters on Shuswap Lake. Timber frame 3 plus bed/3 bath home. Brazilian cherry fl oors, vaulted ceilings, large deck area and additional log cabin for extra guests.

SHIMMERING WATERS

MLS® 10044594

$549,900

Beautiful custom level entry home in The Ridge. 3 plus bed/3 bath home features open concept & spacious design, hardwood, tile, granite, heated bathrm fl oor, 2 fi replaces, covered deck, lake view & much more.

THERIDGE

Nicely updated & deco-rated. 3 bedroom town-home close to downtown, shopping mall and park. Features newer fl ooring, window coverings, fresh paint, private yard area.

WESTHAVEN BY PICCADILLY

$229,900MLS® 10041963

$39,900

Sunnybrae. Immaculate home in perfect move in condition. Many updates. Private yard, shed, newer deck, carport.

LAKEVIEW ESTATES MHP

MLS® 10043488

MLS® 10045744

$124,900

Originally 20x40 mobile with 1540 addition located just before Silver Creek store. TL required. Large lot – .86 acres.

HANDYMAN SPECIAL

$72,500MLS® 10001859

2 bedroom mobile between Enderby and Salmon Arm. Carport, covered deck and large yard backing onto creek.

FOREST GROVE MHP

REDUCED

$349,900MLS® 10047333

Gorgeous 4 bed/4 bath townhome in Turner Creek Estates. Offers space & privacy backing onto green space. Open con-cept design close to schools, rec centre. Huge lower deck.

MUST BE SEEN!

MLS® 10044693 $499,900

4 bed/3 bath rancher with a full basement in SE area. Hardwood fl oors, beautiful kitchen, large .29 acre lot, great lake view, oversized garage, RV parking.

CUSTOMBUILT

NEWLISTING

Originally 20x4with 1540 addlocated just beSilver Creek strequired. Largeacres

SOLD!SOLD!

Page 15: Salmon Arm Shuswap Real Estate

Salmon Arm Observer & Shuswap Market News Wed. & Fri., May 30 & June 1, 2012 www.saobserver.net C15

Serving the Shuswap since 1982 • Each offi ce independently owned & operated

Shuswap®TeamLindaR.com

Dorismills.com 250-833-2155

bringing buyers and sel lers together1-888-676-2435

Linda RohlfsLinda RohlfsPersonal Real Estate CorporationPersonal Real Estate Corporation

Associate Broker/Associate Broker/REALTORREALTOR®®

p

Doris MillsDoris MillsAssociate BrokerAssociate Broker

REALTORREALTOR®®

5521 10th Avenue NW

$759,000 MLS® #10047190

• 5.81 private acres minutes to downtown• 2007 built rancher on full basement• Features include: custom kitchen, high end

s/s appliances, open fl oor plan, oak fl oors, 9 ft. ceilings, crown moldings, fi replace & large mudroom

• Detached 24 x 24 garageCall Linda or Doris

490 Shuswap Street

$199,000 MLS® #10043972

• Duplex (non-conforming), downtown location within walking distance to schools, parks, shopping, and churches

• Two bedroom 869 sq. ft. on each fl oor• Long term tenants in place• Great investment opportunity

Call Linda or Doris

25 Pollock Road

$895,000 MLS® #10044307

• Private Country Estate (farm) on 16 very private rolling acres with valley/mountain view

• 5 bedroom 4 bathrooms on 2667 sq. ft. one level• Heat pump, elect. driveway gates, double garage

heated, 50 x 42 shop• Three overhead doors heated, 22 x 40 machine

shop.

Call Linda or Doris

2953 Birch Lane

$369,900 MLS® #10042355

• Mint condition lake view home complete with in-law suite on quiet cul-de-sac at Cedar Heights

• Many upgrades. Beautiful hardwood fl oors, high coved ceilings, 2 cosy fi replaces, offi ce off garage

• Walk to beach, RV parking. Move in ready.

Call Linda or Doris

#10 151 8th Avenue SW

$235,000 MLS® #10042441

• Upgraded 2 bedroom 2 bath bungalow in retirement complex at Florence Grove

• Roomy kitchen with appliances. New paint & new fl oors

• Spacious south facing patio. Large garage• Move in ready for quick possession. Great location

Call Linda or Doris

682 Park Road

$269,000 MLS® #10034379

• One treed acre of solace across from Gardom Lake access

• Spacious 3 bedroom, 2 bath like new modular displays bright open kitchen/living area

• Enjoy the goldfi sh in the pond from your spacious deck

Call Linda or Doris

6551 40th Street NW

$545,000 MLS® #10043824

• Lakeview acreage with beautifully renovated home

• Large, bright kitchen with 8 foot island with granite counter top, lots of drawers & a pantry

• Spacious living room with huge windows & a gas fi replace

• New fl ooring & windows throughoutCall Linda or Doris

3258 Berke Road

$795,000 MLS® #10036725

• Panoramic lake view acres with executive rancher on full walkout basement, in ground pool & hot tub

• Over 4500 sq. ft. of luxury living. Dream kitchen, butler pantry, numerous built-ins with all the extras

• Large attached garage & shopCall Linda or Doris

270 1st Street SE

$159,900 MLS® #10037499

• Upgraded cosy 2 bedroom house, lane access, within walking distance to most everything downtown

• Electrical upgraded to 100 amp service• Upgraded pipes are copper and plastic• Great investment or starter home. Carport 50 x

100 ft. lotCall Linda or Doris

3710 Sunnybrae Canoe Pt. Rd.

$1,280,000 MLS® #10044906

• About 656’ of natural lakeshore providing peace & privacy

• Spectacular timber framed house offers high ceilings, open fl oor plan

• Unparalleled lake & mountain views plus a self contained guest house ideal for visitors

• All on approx 2.3 acres

Call Linda or Doris

4552 20th Avenue NE

$699,900 MLS® #10031598

• Fantastic 31 acres with new home in a great area close to schools, recreation & shopping

• Open fl oor plan with soaring windows. Geothermal heat system

• 2 bedrooms with room for another and 4 bathrooms• Two creeks run thru this property

Call Linda or Doris

#102 351 Hudson Avenue

$59,000 MLS® #10041335

• Oishii Express Japanese Restaurant in Downtown Salmon Arm

• Modern, bright, new and clean, this restaurant has a loyal clientele and is in a fabulous location

• Owners want it SOLD

Call Linda or Doris

802 Yew Avenue

$369,000 MLS® #10045888

• Rancher, private treed setting on .23 acres• Open fl oor plan, high vaulted wood beamed ceiling

in LR., kitchen & dining area• Large brick wood burning fi replace• Oversize Master bedroom, w/in closet. Over 2200

sq. ft. of spacious living

Call Linda or Doris

2261 73 Ave. N.E.

$549,000 MLS® #10046065

• Lakeshore cabin on Shuswap Lake• Enjoy the clear water, private setting on

city sewer and option to hook up to city water

• Only minutes to Salmon Arm

Call Linda or Doris

#51 - 2801 10 Avenue NE

$14/sq. ft. MLS® #10046080

• Leasing 1500 sq. ft. w. bath facing the TCH• Neighbours include Esso Service Station, Home

Restaurant, Holiday Inn, Uptown Askews & Shaw Centre

• Lots of parking & high traffi c exposure• Storefront level entry, plus overhead door from lane

Call Linda or Doris

700 Christison Road

$724,900 MLS® #10047221

• 1.07 private acres. Contemporary, bright, open design featuring soaring 14 ft. ceilings in LR allowing the outside in.

• Views of the valley & Mt. Ida. Natural gas fi replace. 20’ x 32’ heated studio/shop

• Separate 2 car garage. Creek on property.

Call Linda or Doris

NEW

LIST

ING

NEW

LIST

ING

NEW

PRICE

Page 16: Salmon Arm Shuswap Real Estate

C16 www.saobserver.net Wed. & Fri., May 30 & June 1, 2012 Salmon Arm Observer & Shuswap Market News

Heather Paulsen

12 - 469 Main Street

MLS® 10042542 $59,900

Newer, move-in ready 2 bed, 1 bath modular in downtown Sicamous. Updated in 2011 w/new fl oors, appliances, hot water tank, light fi xtures, deck & more. Located on a treed yard in quiet 55+ park. Close to public beach, shopping & amenities.

80 4 Street SE

MLS® 10043079 $290,000

Updated 5 bed 2 bath home w/ in-law suite in a central location. 3 beds on main fl oor w/ 2 bed bsmnt suite. New furnace w/ A/C, new windows on main fl oor & recent fl ooring, lighting & paint. Flat, fenced yard, large deck, plenty of parking.

1328 Vella Road

MLS® 10046111 $359,900

Excellent hobby farm on 2.91 usable acres. Set up for animals, fenced & cross-fenced, corrals w/water supply, barn, various outbuildings & drilled well. Great views of Tappen Valley, bright family home w/oak kitchen, 3 bed, lrg family room.

65 - 6421 Eagle Bay Rd.

MLS® 10046653 $385,000

4 bed, 3 bath home in waterfront community. Lrg open concept living area, walk-in pantry & kitchen island. Master bedroom on main. Nicely landscaped lot w/great outdoor space including a lake view deck. Private boat launch and common beach.

NEWNEWPRICEPRICE

1034 Deep Creek Road

MLS® 10042658 $184,900

Bright 2 bedroom home on 1 acre of peace and tranquility within 15 minutes to Salmon Arm and Enderby. Partially fenced, large garden area with great southern exposure. Beautiful views of the surrounding farmland. Lots of potential here.

1464 Vella Road

MLS® 10047831 $199,900

2 acres w/ valley views. Well kept 3 bed home, pellet stove, sundeck, updated bath & kitchen. Outbuildings incl 20x24 garage & 1500 sq. ft. foundation in place at rear of property. Great opportunity for affordable home & acreage on quiet country road.

3785 Malakwa road

MLS® 10047857 $319,900

5.5 riverfront acres with TCHwy exposure & lots of options. Renovate current 18 unit motel & take advantage of the proximity to snowmobiling, skiing and Shuswap & Mara lakes. Potential for hobby farm w/ enough room for all your friends and family.

2592 Blind Bay Road

MLS® 10047935 $449,900

Semi-lakeshore 3 bed 2 bath home on 0.46 acres w/ gas f/p, central vac, 2 lrg decks, Shuswap Lake views & upgraded counter tops, stucco & roof. Detached 26x28 garage w/ 3 pc bath, carport, RV sani dump, u/g sprinklers, 135 ft dock & 2 buoys.

5 - 202 Highway 97A

MLS® 10048140 $469,000

Affordable Shuswap waterfront. 2 bed cabin, open fl oor plan, cozy f/pl, large deck & great lake views. 440’ of sandy beach, swimming area and fi re pit. Tennis, badminton, boat launch, laundry facilities, dock w/boat slips & full time caretaker.

1649 Blind Bay Road

MLS® 10047999 $989,000

2.92 acres (split by road) w/ 100 ft lakeshore. Detached shop w/ serviced RV parking, boat launch, dbl attached garage, & large deck. Custom built 4 bed 4 bath home w/ hardwood fl oors, 3 gas f/pls, & full unfi nished bsmnt & great views.

#204 - 541 6 Street NE

MLS® 10046237 $199,900

Wonderful 2 bed 2 bath apartment in downtown location. Open fl oor plan, gas f/pl, A/C, lrg covered deck overlooking McGuire Lake, storage locker & parking stall. Upgrades incl. new laminate & tile fl oors, countertops, paint & window coverings.

2 - 2924 Eagle Bay Road

MLS® 10033737 $199,000

Large 1 bed, 2 bath apartment across the street from Shuswap Lake with approx. 1076 sq.ft., open kitchen/living/dining area, patio, master bed w/ensuite. Secure parking & storage, beautiful grounds & short walk to the beach.

302 - 101 20 Street NE

MLS® 10024930 $259,900

Rare fi nd. Large 3 bed, 3 bath townhome with approx 2174 sq.ft. of living space. Master bed w/walk-in closet + ensuite, main fl oor laundry, open plan w/large living area & gas f/pl, large bedrooms, lots of storage & 2 parking stalls.

7601 Hudson Road

MLS® 10043375 $298,500

Large, landscaped .77 acre lot w/updated home & shop. 1,205 sq. ft. 3 bed, 2 bath home w/newer roof, windows, doors, and more. 30’ x 48’ heated shop w/16’ ceiling & enclosed storage area. Corner lot w/lg garden area. 10 min drive to Salmon Arm.

726 Abbington Lane

MLS® 10025844 $429,900

Custom 5 bed 3 bath home on 3.7 acs. Private & peaceful w/water rights to nearby creek & post/rail fencing. Features hardwood & tile fl oors, rustic timbers, bright kitchen & unique dome living room w/gas f/pl. Basement is in-law suite ready.

2261 4 Avenue SE

MLS® 10041318 $589,000

Amazing location and spectacular lakeviews from this wonderful home. Level entry w/fully fi nished walkout basement. Bright and cheery w/skylights, vaulted and 9’ ceilings throughout. Awesome master suite, open living area, main fl oor laundry and more.

NEW

NEW

NEW NEW NEW