S Khatiwala et al. Nature 462 , 346 - 349 (2009) doi:10.1038/nature08 526

1
S Khatiwala et al. Nature 462, 346-349 (2009) doi:10.1038/nature08526 Anthropogenic carbon uptake rate from 1765 to 2008 (black solid line).

description

Anthropogenic carbon uptake rate from 1765 to 2008 (black solid line). S Khatiwala et al. Nature 462 , 346 - 349 (2009) doi:10.1038/nature08 526. - PowerPoint PPT Presentation

Transcript of S Khatiwala et al. Nature 462 , 346 - 349 (2009) doi:10.1038/nature08 526

Page 1: S Khatiwala et al. Nature 462 , 346 - 349 (2009) doi:10.1038/nature08 526

S Khatiwala et al. Nature 462, 346-349 (2009) doi:10.1038/nature08526

Anthropogenic carbon uptake rate from 1765 to 2008 (black solid line).

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

doi:10.1038/nature05150 LETTERS

doi:10.1038/nature05150 LETTERS

Nature Biotechnology: doi:10.1038/nbt

Nature Biotechnology: doi:10.1038/nbt

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor ...

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor ...

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

GI Motility online (May 2006) | doi:10.1038/gimo46

GI Motility online (May 2006) | doi:10.1038/gimo46

Supplementary information - Nature · © 200 9 Macmillan Publishers Limited. ... 10.1038/nchem.290 Supplementary information 6 ... 10.1038/nchem.290 Supplementary information 7 Preparation

Supplementary information - Nature · © 200 9 Macmillan Publishers Limited. ... 10.1038/nchem.290 Supplementary information 6 ... 10.1038/nchem.290 Supplementary information 7 Preparation

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

DOI: 10.1038/NPHYS3211 Supplementary Information for ...

DOI: 10.1038/NPHYS3211 Supplementary Information for ...

Carbon Changes in the Interior Ocean - uni-kiel.deeprints.uni-kiel.de/12464/1/Tanhua_presentation.pdf · The Anthropogenic Perturbation Khatiwala et al., 2009 The ocean has absorbed

Carbon Changes in the Interior Ocean - uni-kiel.deeprints.uni-kiel.de/12464/1/Tanhua_presentation.pdf · The Anthropogenic Perturbation Khatiwala et al., 2009 The ocean has absorbed

JB Kim et al. Nature 461 , 649 - 653 (2009) doi:10.1038/nature08 436

JB Kim et al. Nature 461 , 649 - 653 (2009) doi:10.1038/nature08 436

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Hexahydroquinolines are antimalarial candidates with ...10.1038... · ARTICLES DOI: 10.1038/s41564-017-0007-4 © 2017 Macmillan Publishers Limited, part of Springer Nature. All rights

Hexahydroquinolines are antimalarial candidates with ...10.1038... · ARTICLES DOI: 10.1038/s41564-017-0007-4 © 2017 Macmillan Publishers Limited, part of Springer Nature. All rights

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×− ...

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×− ...

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

Macroporous nanowire nanoelectronic scaffolds …cmliris.harvard.edu/assets/10.1038-nmat3404.pdfARTICLES PUBLISHED ONLINE: 26 AUGUST 2012 |DOI:10.1038/NMAT3404 Macroporous nanowire

Macroporous nanowire nanoelectronic scaffolds …cmliris.harvard.edu/assets/10.1038-nmat3404.pdfARTICLES PUBLISHED ONLINE: 26 AUGUST 2012 |DOI:10.1038/NMAT3404 Macroporous nanowire

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015