1

Role of the mod(mdg4) common region in homolog segregation

in Drosophila male meiosis

Morvarid Soltani-Bejnood*, Sharon E. Thomas†, Louisa Villeneuve†, Kierstyn Schwartz†,

Chia-sin Hong† and Bruce D. McKee*†

*Genome Science and Technology Program, University of Tennessee and Oak Ridge

National Laboratory. †Department of Biochemistry, Cellular and Molecular Biology,

University of Tennessee, Knoxville.

Genetics: Published Articles Ahead of Print, published on February 4, 2007 as 10.1534/genetics.106.063289

2

Running Title: Meiotic functions of mod(mdg4) Keywords: meiosis, homolog pairing, Drosophila, modifier of mdg4 Address correspondence to: Bruce D. McKee Department of Biochemistry, Cellular and Molecular Biology M407 Walters Life Sciences Building University of Tennessee Knoxville, TN 37996-0840 Phone: 865-974-5148 FAX: 865-974-6306 email: bdmckee@utk.edu

3

ABSTRACT

Homologous chromosomes must pair and establish stable connections during

prophase I of meiosis in order to segregate reliably from each other at anaphase I. In

most organisms the stable connections, called chiasmata, arise from crossovers. In

Drosophila males, homologs pair and segregate without crossing over. Chiasmata are

replaced by a homolog conjunction complex that includes the Stromalin in Meiosis

(SNM) and Modifier of Mdg4 in Meiosis (MNM) proteins. MNM is one of 31 alternative

splice products of mod(mdg4), all of which share a common 402 amino acid N-terminus

and differ at their C-termini. Previous data demonstrated that an MNM-specific exon is

required for homolog conjunction, but did not address whether the N-terminal common

region, which includes a BTB domain that can mediate coalescence of protein-DNA

complexes, is also required. Here we describe a mutation in the common region of

mod(mdg4), Z3-3401, that causes qualitatively similar phenotypes as the MNM-specific

alleles but disrupts X-Y segregation much more drastically than autosomal segregation.

The mutant MNM protein in Z3-3401 is expressed throughout prophase I in

spermatocytes but the protein is confined to the cytoplasm, suggesting that the Z3-3401

mutation disrupts a signal required for nuclear localization or retention. Z3-3401 fails to

complement a large battery of lethal and semi-lethal alleles in the common region for

meiotic nondisjunction, including an allele containing an amino acid substitution at a

conserved residue in the BTB/POZ domain, consistent with a general requirement for

the mod(mdg4) common region in homolog segregation.

4

INTRODUCTION

The segregation of homologous chromosomes at meiosis I is an essential step in

sexual reproduction, and must be accomplished accurately to prevent the generation of

aneuploid gametes. Mis-segregation of homologs is a major cause of spontaneous

abortion and genetic illness in humans (HASSOLD and HUNT 2001).

Segregation of homologs at anaphase I depends upon their prior alignment and

pairing during early prophase I (PAGE and HAWLEY 2003; McKEE 2004). In most

eukaryotes, the initial homologous pairing interactions are quickly followed by the

formation of elaborate homolog linking structures known as synaptonemal complexes

(SCs) and by the onset of meiotic recombination (ROEDER 1997; PAGE and HAWLEY

2003, 2004). The crossovers that occur between homologous chromatids during this

stage are in turn essential for generation of chiasmata, the stable linkers that connect

homologs throughout late prophase I and metaphase I and that enable the homologs to

segregate reliably from one another at anaphase I (HAWLEY 1988; CARPENTER

1994).

Homolog pairing is essential for segregation even in variant forms of meiosis that

do not involve recombination and chiasmata (WOLF, 1994). In Drosophila males,

homologs are intimately paired throughout the first half of meiotic prophase but do not

recombine or form SCs. Pairing is lost in mid-prophase I but homologs remain together

in discrete nuclear territories until the onset of prometaphase I when they condense into

tight “achiasmate” bivalents, which then segregate with exceptional fidelity at anaphase

I (VAZQUEZ et al. 2002). The central role of pairing in this process has been well-

5

documented for the X and Y chromosomes, which pair only within a discrete

heterochromatic region encompassing the rDNA. X heterochromatic deletions that

remove all of the rDNA prevent pairing of the X and Y and lead to their random

assortment at anaphase I (McKEE and LINDSLEY 1987; PARK and YAMAMOTO

1995; McKEE 1996). Moreover, transgenic rDNA insertions on such

heterochromatically deficient X chromosomes substantially restore both pairing and

disjunction of the X-Y pair (McKEE and KARPEN 1990; McKEE 1996).

The means by which achiasmate homologs in Drosophila remain stably

connected until anaphase I despite the absence of synaptonemal complexes and

chiasmata has been an enigma. Recently, however, two proteins, Modifier of Mdg4 in

Meiosis (MNM) and Stromalin in Meiosis (SNM), were shown to be essential for stable

connections between achiasmate homologs. mnm and snm mutations cause high

frequencies of univalents and random segregation of homologs during meiosis I

(THOMAS et al. 2005). Ectopically expressed, GFP-tagged MNM was shown to

suppress the meiotic phenotypes of the two mnm mutations and to localize to meiotic

chromosomes throughout prophase I and metaphase I. MNM-GFP colocalizes with

native SNM protein to nucleoli of prophase I spermatocytes, where the rDNA genes are

sequestered, and to the pairing region of condensed X-Y bivalents during

prometaphase I and metaphase I. Both proteins disappear at the onset of anaphase I,

strongly implying that they play a structural role in maintaining homolog connections.

Mutations in a third gene (teflon (tef)) cause similar phenotypes but affect only the

autosomes (TOMKIEL et al. 2001).

6

Despite these recent advances, several key issues related to the mechanism of

achiasmate homolog segregation remain unresolved. Perhaps the most important is

the molecular basis for homolog conjunction. SNM is a distant homolog of the SCC3

family of cohesin proteins, raising the possibility that achiasmate homologs are

connected by a cohesin complex of some kind. However, MNM and SNM do not visibly

co-localize with the cohesin protein SMC1 on male meiotic chromosomes (THOMAS et

al. 2005).

An alternative mechanism is suggested by the domain structure of MNM. MNM

is encoded by the complex mod(mdg4) locus, which is thought to produce 31 distinct

chromosomal proteins with a common 402 amino-acid N-terminus but different C-

termini encoded by alternatively spliced exons in the variable region (VR) (see Fig. 1A).

The common region (CR) includes an N-terminal BTB/POZ domain and most of the VR

C-termini, including that of MNM, contain a C2H2 motif (DORN and KRAUSS 2003;

LABRADOR and CORCES 2003). BTB/POZ domains are strong protein interaction

domains found in many transcriptional regulatory proteins, where they function in

mediating homo-dimerization and multimerization (BARDWELL and TREISMANN

1994; ZOLLMAN et al. 1994; IGARISHI et al. 1998; MULLER et al. 1999; MELNICK et

al. 2000; GAUSE et al. 2001; STOGIOS et al. 2005). The BTB domain of mod(mdg4)

is most similar to that of Drosophila GAGA factor, an abundant transcription regulator

required for chromatin remodeling of many developmentally regulated promoters and for

pairing-dependent silencing (GRANOK et al. 1995). Indeed the BTB domain of

Mod(mdg4) can substitute for that of GAGA with little loss of function (READ et al.

7

2000). GAGA utilizes a C-terminal C2H2 zinc-finger motif along with its N-terminal BTB

domain to bind cooperatively to DNAs containing multiple GAGAA sequences, forming

large multimeric complexes held together by BTB-BTB interactions (KATSANI et al.

1999; ESPINAS et al. 1999). Mod(mdg4) proteins also form multimers and both MNM

and Mod(mdg4)67.2, which is required in Drosophila somatic cells for the function of

gypsy insulators (GERASIMOVA et al. 1995), form prominent nuclear foci that

presumably arise via coalescence of multiple chromosome sites bound by Mod(mdg4)-

containing complexes (GERASIMOVA and CORCES 1998; GERASIMOVA et al. 2000;

GHOSH et al. 2001; GAUSE et al. 2001; THOMAS et al. 2005). Moreover,

comparisons of polytene chromosome localization patterns of different Mod(mdg4)

proteins indicate that the variable C-termini specify distinct localization patterns

(BUCHNER et al. 2000). Thus, a plausible mechanism for MNM-mediated conjunction

would involve binding to chromosome pairing sites via its C-terminal C2H2 motif and

coalescence of bound sites on homologous chromosomes via BTB-mediated

multimerization.

The first step in this scenario has experimental support. Both of the mnm

mutations disrupt the C2H2 motif of MNM, Z3-5578 truncating MNM upstream of this

motif and Z3-3298 substituting a Y for the upstream H (Fig. 1A,B), and both mutations

abrogate localization of MNM (and its partner, SNM) to meiotic chromosomes

(THOMAS et al. 2005). However, there is no direct evidence as yet for a role of the

mod(mdg4) BTB domain in homolog conjunction. Indeed, since the two mnm mutations

affect only the unique C-terminus of MNM, it is not known whether any part of the 402

8

amino acid N-terminal CR of mod(mdg4) is required for conjunction. Although the

transgene rescue data and localization patterns of MNM-GFP described above are

consistent with the scenario outlined, those data do not prove that the N-terminal

sequences of MNM must be present for the MNM-specific domain to mediate

conjunction, let alone establish whether or not those sequences play a direct role in the

conjunction process.

Here we provide genetic and cytological evidence that the common region of

mod(mdg4) is required for homolog conjunction. We describe a new mod(mdg4) allele

that causes meiotic phenotypes very similar to those of the mnm alleles but maps to the

common region. We also demonstrate that a large number of mutations in the CR

disrupt meiotic homolog segregation, including one that involves substitution of a

conserved residue in the BTB domain. These findings set the stage for mechanistic

studies of the role of the BTB domain and other domains of Mod(mdg4) in meiotic

conjunction.

MATERIALS AND METHODS

Fly stocks, special chromosomes and Drosophila culture methods: The

Zuker-3 collection consists of >6000 EMS-mutagenized third chromosomes balanced

over TM6, Tb e and maintained by C. Zuker (KOUNDAKJIAN et al. 2004). Z3-3401 and

the mnm and snm lines used in this study were identified in a screen of the Zuker-3

collection for mutations that cause paternal loss of chromosome four (WAKIMOTO et

al. 2004) and were kindly provided by B. Wakimoto. mod(mdg4) alleles were obtained

from V. Corces (John Hopkins University, MD), Rainer Dorn (Institute of Genetics,

9

Martin-Luther-University, Halle, Germany), M. Frasch (Mount Sinai School of Medicine,

New York) and the Bloomington Stock Center at the University of Indiana.

The marked Y chromosome (Dp(1;Y)BSYy+ = BSYy+) carries two transposed

segments from the X chromosome with the markers Bs and y+ appended to the ends of

the left and right arms, respectively (FLYBASE). C(1)RM, y2 su(wa) wa , C(4)RM, ci eyR

and C(2)EN, b pr are attached chromosomes consisting of two genetically complete

copies of the chromosome (X, 4 or 2) attached to a single centromere (FLYBASE).

Dp(1;1)scV1 contains a small duplication from the tip of XL carrying the y+ allele

appended to the small heterochromatic right (XR) arm (RASOOLY and ROBBINS

1991). The attached-XY chromosome used in the recombination crosses was YSX.YL

In(1)EN, y B (X^Y, y B) (FLYBASE).

Unless otherwise specified, the males being tested were crossed singly to two or

three females in shell vials. Crosses were incubated at 23◦C on cornmeal-molasses-

yeast-agar medium. Parents were removed from the vial on day 8 and progeny were

counted between day 13 and day 22.

Mapping of Z3-3401: Z3-3401 was mapped to the mod(mdg4) region by its

failure to complement Df(3R)GC14 (93D7; 93E1) (MOHLER and PARDUE 1994) for X-

Y nondisjunction (NDJ). More detailed mapping was carried out by complementation

against a battery of deletions, transposon insertions and EMS mutations described in

Table 1 using the same assay. To aid in this analysis, the breakpoints of several small

deletions in the mod(mdg4) region were molecularly mapped, as described below. Z3-

3401 failed to complement all deletions that encompass part or all of the CR and all

transposon insertions and mutations in the CR of mod(mdg4).

10

Determination of deletion breakpoints: Deletion breakpoints were mapped

relative to polymorphisms between ORiso3 and CSiso3, which are wild-type lines with

isogenic 3rd chromosomes derived from the Oregon R and Canton S stocks. The DNA

sequences of ORiso3 and CSiso3 differ from each other at multiple sites, some of which

have been identified (HOSKINS et al. 2001). ORiso3 and CSiso3 were crossed with

iso-3rd chromosome stocks carrying the mod(mdg4) deficiencies B2, T16, eGP4,

142∆10, 142∆29, 142∆33,142∆49 and Df(3R)GC14. Genomic DNA was prepared from

F1 adult heterozygotes as described above. Fragments of ~500-800 nt. within and

beyond the mod(mdg4) locus were amplified by PCR from these DNAs, purified and

sequenced as described above. Sequences were analyzed for SNPs and double-

peaks. The logic of the assay is that sequence differences between ORiso3 and

CSiso3 that lie within the deleted region will result in different single peaks on the DNA

sequence electropherograms for the ORiso3/Df and CSiso3/Df samples (e.g., G versus

A at a specific nucleotide position), whereas sequence differences outside of the

deleted region will result in a double peak on the electropherogram for at least one of

the two samples (e.g., a G/A double peak in one sample and a G peak in the other).

This method enabled us to map the relevant breakpoint of each deletion (Table 2, Fig.

1A) with respect to 12 SNPs within the mod(mdg4) locus. The molecular coordinates

and associated primers of the flanking SNPs are available upon request.

Molecular identification of mutations in Z3-3401, mod(mdg4)324 and

mod(mdg4)340: To identify the Z3-3401 mutation, genomic DNA was extracted from

adult flies homozygous for Z3-3401 and for the Zuker-3 progenitor chromosome using

the Wizard genomic DNA purification kit (Promega). Known and conceptual exons of

11

mod(mdg4) were amplified from the genomic DNAs using primer pairs complementary

to intronic sequences immediately flanking the exons, and where necessary, exon-

internal primers. The polymerase chain reaction (PCR) parameters were 1 minute at

94oC, 35 cycles of 94oC for 1 minute, 55oC for 1.5 minutes, and 72oC for 2 minutes in a

Perkin-Elmer thermocycler. Reaction mixtures contained 0.2µM of each primer, 50 ng

Drosophila genomic DNA (Zuker-3 or y w), 1.5 mM MgCl2, 0.2 mM dNTP mix and 2.5 U

Taq DNA polymerase (Promega) in a total volume of 50 microliters. The amplicons

were sequenced directly using an ABI 373 sequencer. We identified a single

nucleotide substitution (C to T) in exon 4 of Z3-3401 predicted to result in substitution of

cysteine (C) for arginine (R) at residue 224 (R224C).

To identify the mutations in mod(mdg4)324 and mod(mdg4)340, genomic DNA

from mod(mdg4)324/Zuker-3 and mod(mdg4)340/Zuker-3 flies was extracted and

analyzed as above. Both mutations were identified as double peaks on the resulting

DNA sequence electropherograms. The mod(mdg4)324 mutation is a G to A

substitution predicted to result in replacement of the glycine at residue 92 with aspartic

acid (G92D). The mod(mdg4)340 mutation is a G to T substitution predicted to result in

replacement of the codon for glutamine 177 (Q177) with a nonsense codon. Additional

double peaks were present on the electropherograms of the CR sequences derived

from both of the mod(mdg4)/Zuker-3 DNA samples, but all except the mutations cited

above proved to represent synonymous substitutions.

Measuring X-Y nondisjunction (NDJ): +/BsYy+ males were crossed singly to

two X/X y w (yellow1 white1118) females in shell vials. The X, Y, XY and O sperm

classes yield: + (y w/+) females, w Bs (y w/BSYy+) males, BS (y w/+/BSYy+) females, and

12

y w (y w/O) males, respectively. The nondisjunction frequency (%X-Y NDJ) = 100 x (BS

females + y w males)/N. N = # of progeny scored.

Measuring 4-loss frequencies: Males were crossed singly to two C(4)RM, ci

eyR (4^4/O) females and the progeny scored for the recessive ci (cubitus-interruptus)

and eyR (eyeless) markers. 4^4/O females generate only 4^4 and nullo-4 (O) eggs,

which when fertilized by regular sperm carrying a wild-type 4th chromosome yield only

ci+ ey+ progeny (viable triplo-4 and poorly viable, Minute haplo-4 progeny). Nullo-4 (O)

sperm from paternal NDJ or chromosome 4 loss yield viable disomic 4^4/O, ci ey

progeny. Paternal NDJ generates 44 sperm as well but these yield only ci+ ey+ progeny

that cannot be distinguished from the regular progeny. % 4-loss = 100 x (ci ey)/N.

Measuring 2nd chromosome NDJ: Males were +/BSYy+; bw/+; Z3/(Df or +).

Sibling mutant (Z3/Df) and control (Z3/+) males were crossed either to C(2)EN, b pr

(2^2/O) females or y w (2/2) females with unattached 2nd chromosomes at a ratio of 2

males to 4 females, or 1 male to 2 females, respectively. Males and females were left

together for 6-8 days, then the females were transferred to fresh vials every 3-6 days

and allowed to continue laying eggs until fertilized eggs were exhausted. Males were

transferred to vials with fresh virgin females and the procedure repeated as long as the

males remained fertile. Progeny were counted to completion, and scored for relevant

markers. 2^2/O females generate eggs that are nullosomic (O) or disomic (2^2) for

chromosome 2, so the only viable progeny are the products of paternal chromosome 2

NDJ (22 and O sperm). Overall 2nd chromosome NDJ was estimated from progeny

per male in the 2^2/O and 2/2 crosses (F(2^2/O) and F(2/2)). The formula is (%NDJ) =

100 x (2 x f x F(2^2)/(2 x f x F(2^2) + F(2/2)). F(2^2/O) is doubled in the formula to

13

compensate for the deaths of ½ the nondisjunctional progeny in the 2^2/O cross, due to

fertilization of the wrong eggs (e.g., O sperm fertilizing O eggs). f is a fertility correction

(=1.8 in these data), based on an independent estimate of the relative fertility of 2^2/O

and 2/2 females in crosses to males of like genotype (2^2/O x 2^2/O and 2/2 x 2/2),

again doubling the progeny from the 2^2/O cross to account for loss of 50% of the

aneuploid fertilization products.

The frequency of sister chromatid NDJ relative to homolog NDJ (% sis-2 NDJ) for

the 2nd chromosomes was estimated from the ratio of bw (brown-eyed) progeny to bw+

(red-eyed) progeny. Both bw and bw+ progeny carry two paternal 2nd chromosomes;

(progeny from fertilization of 2^2 eggs by O sperm are b pr (black body, purple eyes)).

Since the paternal genotype is heterozygous bw/bw+, the 22/O progeny can be bw/bw,

bw+/bw+ or bw/bw+, the former two genotypes resulting from sister chromatid NDJ and

the latter from homolog NDJ. The formula for % sis-2 NDJ is 100 x 2 x bw/(bw + bw+).

(The bw progeny are doubled to account for a presumed equal number of bw+ progeny

that are homozygous for the bw+ chromatid.)

Assaying homologous pairing in spermatogonia and spermatocytes:

Pairing was assayed by counting GFP spots in spermatogonia and spermatocytes from

males homozygous for a chromosome 2 transgene carrying a 256mer tandem array of

lacO repeats and heterozygous for a transgene (also on chromosome 2) expressing a

GFP-LacI chimeric protein under control of the hsp83 promoter (ROBINETT et al. 1996;

STRAIGHT et al. 1996; VAZQUEZ et al. 2002; THOMAS et al. 2005). Testes were

dissected from third instar larvae, pupae or young adults in testes buffer (183 mM KCl,

47 mM NaCl, 10 mM Tris-HCl, 1 mM EDTA, 1 mM PMSF) and gently squashed in

14

testes buffer. Spot frequencies were compared between Z3-3401/mod(mdg4)T16 and

sibling control (Z3-3401/+ and mod(mdg4)T16/+) males. The mean distance among the

four GFP spots (spot dispersion) during late prophase I was determined by measuring

and averaging the four shortest pairwise distances using Metamorph. The resulting

values were averaged over the N nuclei scored to obtain the mean spot dispersion.

Transgene rescue crosses: Two insertions of [hs::MNM-GFP] (THOMAS et al.

2005), one each on chromosome 2 and 3, were used in the rescue experiments. For the

chromosome 2 transgene, +/BsYy+; [hs::MNM-GFP]2, bw+/bw; Z3-3401, st/ Z3-3401, st

males and their +/BsYy+; bw/bw; Z3-3401, st/ Z3-3401, st brothers (scarlet versus white

eyes, respectively) were subjected to 0-2 heat shocks (39◦C for 1 hr.) during larval

stages, then crossed as adults to y w females to assay X-Y NDJ, or their testes

dissected and analyzed cytologically. Similar methods were used to test a 3rd

chromosome insertion of [hs::MNM-GFP] and a 2nd chromosome insertion of [CR-7.5] (=

P[w+ 7.5Kb BamHI] (BUCHNER et al. 2000)).

Testis Immunostaining: Testes were dissected from third instar larvae, pupae

or young adults. For anti-α-tubulin/DAPI experiments, testes were fixed according to

CENCI et al. (1994). Before incubation with antibodies, slides were rinsed twice in PBS

and blocked in PBS, 1% BSA for 45 min. Testes preparations were incubated overnight

at 4ºC with FITC conjugated monoclonal anti-α-tubulin (Sigma) diluted 1:150 in PBT

(PBS with 0.1% Triton X-100) containing 1% BSA. Slides were rinsed twice with PBT,

once with PBS, stained with DAPI (1 µg/mL) for 5 min, rinsed twice in PBS, and

mounted with Vectashield mounting medium.

15

For the SNM staining, the procedure of THOMAS et al. (2005) was followed.

Briefly, testes were fixed according to GUNSALUS et al (1995). Before incubation with

antibodies, slides were washed twice in PBT + DOC (PBS with 0.3% Triton X-100 with

0.3% sodium deoxycholate) for 15 min and once in PBT (PBS with 0.1% Triton X-100)

for 10 min, and blocked in TNB (0.1M Tris-HCl, ph 7.5, 0.15M NaCl, 0.5% Blocking

Reagent (PerkinElmer) for 30 min. Testes preparations were incubated overnight at

4ºC with FITC conjugated monoclonal anti-α-tubulin (Sigma) diluted 1:150 with either

undiluted anti-SNM N-terminus antibody or anti-SNM C-terminus diluted 1:250. Slides

were rinsed three times with TNT (0.1M Tris-HCl, ph 7.5, 0.15M NaCl, 0.05% Tween-

20) and then incubated with Alexa Fluor® 647 goat anti-rabbit IgG (H+L) diluted 1:500

in TNB for 30 min. Slides were rinsed three times with TNT, stained with DAPI (1

µg/mL) for 5 min and rinsed two more times with TNT, and mounted with Vectashield

mounting medium. Anti-ModC (BUCHNER et al. 2000; THOMAS et al. 2005) was

diluted 1:4000 in PBS and visualized using Alexa Fluor 546 goat anti-rabbit IgG (H+L)

diluted 1:5000.

Microscopy: All testis preparations were examined with an Axioplan (ZEISS)

microscope equipped with an HBO 100-W mercury lamp for epifluorescence and with a

scientific grade cooled charge-coupled device (CCD; Roper). Grayscale digital images

were collected, pseudocolored and merged using Metamorph Software (Universal

Imaging Corporation).

Measuring recombination and nondisjunction in female meiosis: To

measure sex chromosome NDJ and recombination, Dp(1;1)scV1, y pn cv m f . y+/y

females were crossed with YSX.YL In(1)EN, y B/Y (X^Y, y B/Y) males. The regular

16

progeny are B females and B+ males; X-X NDJ yields B+ females and B males. %NDJ

= 100 x 2 x (B+ females + y B males)/(N + B+ females + y B males). Recombination was

scored in the regular (B+) sons. Since both X chromosomes carry mutant y alleles at

the native y locus, the duplicated y+ allele on the X chromosome right arm in the y pn cv

m f .y+ homolog serves as a centromere marker. pn, which is less than 1 cM from the

XL tip, is the distal-most marker. Recombination on chromosomes 2 and 3 was

measured as described in the legend to Table 6. Map distances were calculated by

standard formulae and expressed in centiMorgans (cM).

Analyzing pigmentation of y2 flies: The body, wing and bristle colors of adult

flies were scored visually at 20X magnification; a minimum of 20 flies of each genotype

were scored.

Analysis of MNM RNAs: Total RNA was isolated using RNAwiz (Ambion) from

the following genotypes: Z3-5578/Z3-3401, Z3-5578/Df(3R)GC14 and Z3-

3401/Df(3R)GC14. For each RNA, Oligo(dT) and gene specific primer reverse

transcription (RT) reactions were performed using SuperScript First-Strand Synthesis

System for RT-PCR (Invitrogen). Primers for gene specific primer RT are as follows:

5’gattgttagatgtcttatgg 3’ and 5’ tgtaagcctatgacgcatcc 3’. The three RT reactions were

combined into a cocktail and were used in PCR. To determine if trans-splicing occurs,

PCR was performed using the RT cocktail from trans-heterozygotes (Z3-5578/Z3-3401).

As a control for template switching, PCR was performed on the combined cocktails of

hemizygotes (Z3-5578/Df(3R)GC14 and Z3-3401/Df(3R)GC14). The primers used in

PCR are as follows: 5’tgaaatggctacatatgtgg 3’ and 5’cggcatctgagtgaacatct 3’. PCR

products were run on an agarose gel, gel purified using QIAquick Gel Extraction Kit

17

(Qiagen) and TA cloned (Invitrogen). Minipreps were performed on individual colonies

and the DNA was sequenced using standard techniques.

The parental (P) and recombinant (R) RNA frequencies in the trans-

heterozygous sample were estimated from the frequencies of the corresponding

parental (P1 + P2) and recombinant (R1 + R2) cDNAs by correcting for the observed

frequency of template switching (0.16) in the control reaction, as follows. The frequency

of template switching for both P and R templates in the trans-heterozygous reaction was

assumed to be the same as for P templates in the control reaction. Therefore, R1 + R2

cDNAs originate from R templates at a frequency of (1 - .16)R and from P templates at

a frequency of .16(P). Since P = 1 - R, R1 + R2 = (1 - .16)R + .16(1 - R) = .16 + .68R.

Plugging in R1 + R2 = .40, we obtain R = (.40 - .16)/.68 = .35. 95% confidence interval

= +/- 1.96(R(1-R)/N)½.

RESULTS

An amino acid substitition in the mod(mdg4) CR that causes elevated X-Y

NDJ: The meiosis-specific mod(mdg4) mutations described previously, Z3-5578 and

Z3-3298 (THOMAS et al. 2005), were recovered in a screen for paternal chromosome

loss mutants among the Zuker-3 (Z3) collection of EMS-mutagenized autosomes

(KOUNDAKJIAN et al. 2004; WAKIMOTO et al. 2004). That screen yielded an

additional viable mutation, Z3-3401, that caused high frequencies of X-Y nondisjunction

(NDJ) in male meiosis (Table 3) but no NDJ of sister X chromatids (data not shown),

similar to the phenotypes of the mnm alleles, Z3-5578 and Z3-3298. Deficiency

complementation (Table 1, analyzed more fully below) and DNA sequence analysis of

18

Z3-3401 led to the identification of a single base-pair substitution in exon 4 of the

mod(mdg4) CR predicted to result in a R224C substitution in all Mod(mdg4) proteins

(Fig. 1B). This mutation lies downstream of the BTB-domain, in a region of the protein

rich in T residues and of unknown function (BUCHNER et al. 2000; DORN and

KRAUSS 2003; BARDWELL and TREISMAN 1994; ZOLLMANN et al. 1994).

Z3-3401 disrupts segregation of sex chromosomes more severely than

autosomes: As shown in Table 3, the X-Y NDJ frequency in Z3-3401/Df males was

similar to the frequencies in Z3-5578/Df and Z3-3298/Df males. However, unlike the

mnm alleles which behave as genetic nulls, the X-Y NDJ frequency in Z3-3401/Z3-3401

males, although substantial (circa 30%), was significantly lower than in Z3-3401/Df

males, suggesting that Z3-3401 may be a hypomorphic allele.

Both mnm and snm mutations disrupt autosomal segregation as strongly as X-Y

segregation. To ascertain if Z3-3401 also disrupts segregation of the autosomes, 4th

chromosome loss (production of nullo-4 sperm) was assayed by crossing Z3-3401

males carrying wild-type 4th chromosomes to females carrying C(4)RM, an attached 4th

chromosome marked with the recessive mutations ci and eyR (Table 4). Z3-3401/Df

males generated ci ey progeny (C(4)RM/0), indicative of nullo-4 sperm, at frequencies

of 5.2% and 7.9% over two different mod(mdg4) deficiencies, frequencies much lower

than those of hemizygous mnm males (22-28%). An even lower 4-loss frequency

(3.3%) was exhibited by Z3-3401 homozygotes, consistent with the above suggestion

that it is a hypomorphic allele. The difference between the 4-loss and X-Y NDJ

frequencies suggests that Z3-3401 affects sex chromosomes more strongly than

autosomes, or, alternatively, large chromosomes more strongly than small ones (the

19

fourth chromosome being approximately 4% the size of the X chromosome and 2% that

of the 2nd or 3rd chromosome).

To assess the effects of Z3-3401 on segregation of a large autosome pair, Z3-

3401/Df males were crossed to females carrying the attached-2nd chromosome,

C(2)EN, b pr (Table 5). Since all eggs in this cross are either diplo-2 or nullo-2, the only

viable progeny result from fertilization by NDJ sperm (diplo-2 or nullo-2), so that

progeny per male is a rough measure of NDJ. Crosses with wild-type males typically

produce fewer than 0.5 progeny per male, whereas snm and mnm males generate 20-

25 progeny each (Table 5; THOMAS et al. 2005). Z3-3401/Df males generated 15

progeny per male, indicative of a significant amount of chromosome 2 NDJ. The

distribution of paternal chromosome 2 markers among the NDJ progeny indicated that

virtually all of the NDJ occurred at meiosis I.

To obtain quantitative estimates of the frequency of chromosome 2 NDJ, parallel

crosses of Z3-3401/Df sibling males to C(2)EN females (2^2/O) and to females with

normal 2nd chromosomes (2/2) were conducted by a procedure designed to

exhaustively sample sperm (see Materials and Methods). Under these conditions, the

numbers of progeny produced per male (F) in the 2^2 and 2/2 crosses are proportional

to the numbers of NDJ and regular sperm, respectively, produced by the tested males.

Using this method, we estimated the 2nd chromosome NDJ frequency for Z3-

3401/Df males at 17%, a moderate frequency more comparable to that of the 4th

chromosome than to the X-Y pair. By comparison, similar crosses for the two mnm

alleles (Table 5) yielded chromosome 2 NDJ frequencies ranging from 43-45%, very

near to random assortment. These values are in excellent agreement with NDJ

20

estimates from cytological assays (data not shown), thus providing a validation for the

parallel cross method. We conclude that Z3-3401 is significantly more disruptive of sex

chromosome than autosomal segregation, unlike mnm and snm mutations which disrupt

segregation of all chromosome pairs to roughly the same degree.

Z3-3401 causes bivalent instability and missegregation of univalents at MI:

To gain further insight into the nature of the meiotic anomaly in Z3-3401 males, we

examined testis squashes stained with DAPI or acetic orcein to visualize DNA (Fig.

2A,C). Inspection of spermatids from Z3-3401 squashes revealed considerable

variability in size of spermatid nuclei in Z3-3401 (Fig. 2A), an indicator of NDJ. The

cause of the high NDJ in Z3-3401 males was evident from inspection of meiosis I

spermatocytes (Fig. 2A,C). In wild-type spermatocytes, meiotic chromosomes are first

clearly resolved shortly before prometaphase I as three large and one small condensing

masses of chromatin, corresponding to the three large bivalents (X-Y, 2nd and 3rd

chromosomes) and the small 4th chromosome pair, arrayed around the nuclear

periphery. The chromosomes subsequently congress to form a single compact clump

of chromatin on the MI spindle (CENCI et al. 1994). In Z3-3401 spermatocytes,

although the chromosomes condensed normally, the homologs were frequently

unpaired at prometaphase I and metaphase I. There was no sign of chromosome

fragmentation or of breakdown of univalents into their constituent chromatids.

Anaphase I was disorganized, with chromosomes migrating to poles asynchronously

(Fig. 2C). Meiosis I poles frequently (54%) exhibited nuclei of unequal sizes, indicative

of meiosis I NDJ (Fig. 2A,B). Although the meiosis I phenotypes of Z3-3401/Df males

were qualitatively similar to those of mnm males, normal metaphase I configurations

21

and equal telophase I poles were observed at considerably higher frequencies in Z3-

3401 males than in Z3-3298/Df males (Fig. 2B), consistent with the genetic evidence

that autosomes segregate more regularly in Z3-3401/Df than in Z3-3298/Df.

No meiotic abnormalities unique to Z3-3401 were observed. As in Z3-5578 and

Z3-3298 spermatocytes, both spindle structure and kinetochore function appeared

normal at both divisions. The second meiotic division appeared to proceed normally,

consistent with the genetic data (Fig. 2A). Pairing of homologous sequences during

early prophase I as well as in premeiotic gonial cells, as revealed by fusion of

fluorescent spots resulting from recruitment of LacI-GFP proteins to transgenic lacO

arrays at homologous sites in autosomal euchromatin (ROBINETT et al. 1996;

STRAIGHT et al. 1996; VAZQUEZ et al. 2002), also appeared completely normal (Fig.

3), consistent with results of similar analyses of pairing in Z3-5578 and Z3-3298 mutants

(THOMAS et al. 2005). Moreover, in Z3-3401/Df males, as previously reported for wild-

type and mnm males, pairing of homologous and sister chromatids is lost

simultaneously during stage S2b, corresponding to mid-prophase I, and four distinct

GFP spots, corresponding to the four chromatids of the chromosome 2 bivalent, are

seen from then until the conclusion of the meiotic divisions. Finally, as described

previously for both mnm and snm alleles, the separate GFP spots are further apart, on

average, in Z3-3401/Df than in wild-type males during late prophase I (Fig. 3B), a

phenotype referred to as “territorial expansion” (THOMAS et al. 2005).

Thus, we find no genetic or cytological evidence that Z3-3401 has any meiotic

phenotypes qualitatitvely different from those previously described for mnm (and snm)

mutants, namely disruption of homologous chromosome territories during late prophase

22

I and premature dissociation of bivalents, leading to random assortment of the resulting

univalents at anaphase I. However, Z3-3401 differs from mnm and snm alleles in that it

affects sex chromosome segregation more strongly than autosomal segregation.

Does ectopically expressed MNM-GFP fully complement the meiotic

phenotypes of Z3-3401?: Previous data showed that ectopic, heat-shock-driven

expression of MNM-GFP fully complements the meiotic phenotypes of both Z3-5578

and Z3-3298, thus verifying that the mutations in the mnm exons of those two alleles

are responsible for their mutant phenotypes (THOMAS et al. 2005). However, the

R224C mutation in Z3-3401 should affect the sequences of all 31 Mod(mdg4) isoforms,

the functions of most of which are unknown. Ectopic expression of transgenic MNM-

GFP would be expected to fully complement the meiotic phenotypes of Z3-3401 only if

those phenotypes are caused by disruption of the MNM isoform alone.

To test for rescue of Z3-3401, +/BSYy+; Z3-3401/Df males carrying a single copy

of the [hs::MNM-GFP] transgene on chromosome 2 or 3 were generated, exposed to

variable numbers of heat shocks during development, and tested for X-Y NDJ. The

results were clearcut; both the chromosome 2 and chromosome 3 insertion suppressed

X-Y NDJ below 1% when two heat shocks were given (Table 6). In fact, the

chromosome 2 transgene afforded full rescue even in the absence of heat shock. In

addition, DAPI-stained spermatocytes from transgenic, heat-shocked males and from

non-transgenic males were compared. Spermatocytes from the heat-shocked,

transgene-bearing males appeared indistinguishable from wild-type spermatocytes with

respect to organization and uniformity of spermatid nuclei, absence of univalents at PMI

23

and MI, and equality of telophase 1 poles, whereas their non-transgene-bearing

brothers exhibited the expected array of meiotic anomalies (Fig. 2D).

These results confirm that the R224C mutation in exon 4 is responsible for the

male meiotic phenotypes seen in Z3-3401 males. More interestingly, however, they

indicate that the male meiotic phenotypes of Z3-3401 are due entirely to effects of the

R224C mutation on functioning of the MNM isoform, even though the mutation should

be present in all of the 31 Mod(mdg4) isoforms. These findings could indicate that

MNM is the only mod(mdg4) isoform involved in homolog conjunction in male meiosis.

However, they do not rule out the possibility of other meiotic isoforms of Mod(mdg4) that

are not functionally disrupted by the R224C substitution.

The Z3-3401 mutation disrupts a nuclear localization or retention signal: To

gain additional insight into how the Z3-3401 mutation affects conjunction, we used

antibodies against SNM and against the CR of Mod(mdg4) (anti-ModC) to examine the

localization of MNM and SNM proteins in primary spermatocytes (THOMAS et al. 2005;

BUCHNER et al. 2000). We previously showed that these antibodies co-localize to

multiple nucleolar foci throughout prophase I and to a prominent dense focus

associated with the X-Y bivalent during prometaphase I and metaphase I in wild-type

spermatocytes and (THOMAS et al. 2005). Although the anti-ModC antibody is not

specific for MNM, the dense anti-ModC signal on the X-Y bivalent reflects MNM-specific

staining since it, (along with the anti-SNM signal), is completely abolished in

spermatocytes from Z3-5578 and Z3-3298 males. Very similar results were observed

in Z3-3401 spermatocytes at prometaphase I and metaphase I (Fig. 4). No detectable

staining of the X-Y bivalent with either anti-SNM or anti-ModC was observed in Z3-

24

3401/Df spermatocytes during prometaphase I or metaphase I, although robust staining

was evident in the Z3-3401/+ sibling controls. Thus, Z3-3401 abolishes staining of the

X-Y pairing structure as thoroughly as do snm and mnm alleles. This finding suggests

that the Mod(mdg4) CR as well as the MNM-specific VR exon might be required for

chromosomal localization of MNM and SNM. It is important to note that the failure to

observe staining of autosomal bivalents at prometaphase I in Z3-3401 spermatocytes

does not imply that MNM and SNM are absent from autosomal bivalents at this stage

(which would be difficult to reconcile with the relatively mild disruption of autosomal

segregation in Z3-3401 males) because neither antibody yields detectable staining of

autosomes at this stage in wild-type spermatocytes either (THOMAS et al. 2005).

The absence of anti-MNM staining on condensed X-Y bivalents in Z3-3401

spermatocytes was unexpected since the mutation in Z3-3401 lies far upstream of the

C-terminal domain we have postulated to be responsible for chromosome binding. To

gain further insight into the basis for the Z3-3401 phenotype, we analyzed anti-ModC

staining patterns throughout prophase I, prior to chromosome condensation.

The anti-ModC staining pattern in wild-type spermatocytes exhibited a complex

temporal pattern (Fig. 5). In very young primary spermatocytes (stage S1 (CENCI et al.,

2004)) strong anti-ModC staining was concentrated at the nuclear periphery although

the chromosomes were distributed generally throughout the nucleus. However, by

stage S3 when the three major bivalents have mostly separated from one another and

throughout the remainder of prophase I, anti-ModC staining was largely confined to the

nucleolus and to the DAPI-stained chromosomes. Within chromosomes, anti-ModC

staining was not uniform but rather enriched in particular regions. The anti-ModC

25

staining pattern in mid and late prophase I is similar to that of MNM-GFP (THOMAS et

al., 2005), albeit somewhat less punctate. Thus, unlike condensed autosomal bivalents

at prometaphase I or metaphase I, uncondensed autosomes stain robustly with the anti-

ModC antibody throughout prophase I.

In Z3-5578 and Z3-3298 spermatocytes, early prophase I staining appeared to

be relatively normal both in intensity and localization, with the bulk of the signal

distributed around the nuclear periphery (Fig. 5A). However, by mid-prophase I (not

shown) and more clearly at late prophase I (Fig. 5B), diffuse anti-ModC staining was

distributed throughout the nucleus. Some of this staining overlapped with the DAPI-

stained chromosome territories and might represent other chromosomal Mod(mdg4)

isoforms present in spermatocytes in addition to MNM; however, the staining failed to

show the prominent enrichment on chromosomes and in nucleoli that we observed in

wild-type. These findings suggest that the mutant MNM proteins encoded by Z3-5578

and Z3-3298 are stable and able to gain entry to the nucleus but are unable to localize

properly either to chromosomes or to the nucleolus.

Z3-3401 spermatocytes exhibited a different pattern from the other two mutants.

Strong anti-ModC staining was apparent throughout prophase I but was restricted

primarily to the cytoplasm at all stages (Fig. 5A, B). This contrasts sharply with the

staining patterns in wild-type and mnm spermatocytes, in which little or no cytoplasmic

anti-ModC staining was detected at any stage. These results suggest that the Z3-3401

mutation might disrupt a nuclear localization or retention signal essential for nuclear

localization of MNM. Late prophase I nuclei from Z3-3401 males did exhibit faint

granular staining in the nucleus (Fig. 5B), consistent with the presence of small amounts

26

of mutant MNM protein or of other, less abundant, Mod(mdg4) isoforms in the nucleus.

We conclude that the mutant MNM proteins encoded by all three Z3 alleles are stable

throughout prophase I but improperly localized, to the nucleoplasm in Z3-5578 and Z3-

3298 mutants and to the cytoplasm in Z3-3401.

Is Z3-3401 specific for male meiosis? Z3-3401 differs from most other

mutations in the CR in that it does not affect viability. This could either be because it is

hypomorphic or because it disrupts a domain that is required only for meiotic homolog

conjunction and not for other functions carried out by other Mod(mdg4) proteins. To

assess the specificity of Z3-3401, we evaluated its effects on two other processes

previously shown to be affected by mod(mdg4) mutations: female fertility and chromatin

insulator function.

Effects on female fertility have been previously described for certain viable and

semi-lethal mod(mdg4) genotypes (BUCHNER et al. 2000). To determine if Z3-3401

affects female fertility, sibling Z3-3401/Df and Z3-3401/+ females were crossed singly to

two wild-type males. For comparison, similar crosses involving Z3-3298 and Z3-5578

were also carried out. The results (Table 7) show that Z3-3401 dramatically reduces

female fertility: Z3-3401/Df females produced, on average, only 2.8 progeny each

whereas their heterozygous siblings produced, on average, 42.1 progeny. This fertility

reduction must reflect effects of Z3-3401 on functioning of other isoforms besides MNM

because females hemizygous for either of the MNM-specific alleles exhibited fertility

levels comparable to those of their heterozygous sisters (Table 7) and because ectopic

expression of MNM-GFP in Z3-3401/Df females failed to signficantly improve their

fertility (data not shown).

27

Since mutations in some genes required for female meiosis cause semi-sterility,

we assayed for effects of hemizygosity for Z3-3401 on several meiotic parameters,

including the frequency of X chromosome NDJ and the frequency of recombination in

large intervals on the X, 2nd and 3rd chromosomes (Table 7). Similar assays were

conducted for Z3-3298/Df, Z3-5578/Df and mod(mdg4)T6/Df females. No significant

effects of any of the four tested mod(mdg4) alleles on chromosome segregation or

recombination were observed. Moreover, the eggs laid by Z3-3401/Df females did not

exhibit the “spindle” phenotype caused by incomplete development of the dorsal-ventral

axis that is exhibited by females carrying mutations that disrupt meiotic double-strand

break repair (data not shown; GHABRIAL and SCHUPBACH 1999). Finally,

synaptonemal complex formation, as assayed by incorporation of the central element

protein C(3)G (PAGE and HAWLEY 2001) into linear structures in pachytene oocytes

was found to be normal in Z3-3401/Df females (data not shown). Thus, the fertility

reduction caused by Z3-3401 does not result from disruption of female meiosis. No

further analysis of the female semi-sterility of Z3-3401 has been carried out as yet and it

is not known which Mod(mdg4) protein(s) is/are required for normal female fertility.

Some mod(mdg4) mutations act as enhancers or suppressors of mutations

caused by insertions of gypsy transposable elements into regulatory DNA of certain loci

such as yellow and cut (GEORGIEV and GERASIMOVA 1989; GEORGIEV and

KOZYCINA 1996; GAUSE et al. 2001). These modifier effects are thought to be due to

disruption of the chromatin insulator protein Mod(mdg4)67.2, which localizes, along with

its partner Suppressor of Hairy Wing (Su(Hw)), to gypsy sequences and blocks

activation of nearby promoters by enhancers on the opposite side of the gypsy insertion

28

(GERASIMOVA et al. 1995; GAUSE et al. 2001). To determine whether Z3-3401

disrupts functioning of the Mod(mdg4)67.2 protein, the effects of Z3-3401 on the

pigmentation pattern of y2 flies was examined. y2 flies have pigmented (black) bristles

but unpigmented (yellow) bodies and wings because of a gypsy insertion in the

upstream regulatory region of the yellow locus, which is required for production of the

major pigment in the integument, wings and bristles of adult flies. The gypsy insertion

lies between the yellow promoter and upstream enhancers specific for the body and

wings and therefore blocks activation of the yellow promoter in the body and wings.

However, the bristle-specific enhancer is located in an intron downstream of both the

yellow promoter and the gypsy insertion in y2 and is therefore not prevented from

activating the promoter (GEYER et al. 1986; GEYER and CORCES 1987). The

mod(mdg4)T6 mutation, a nonsense mutation in the 67.2-specific exon, specifically

disrupts functioning of the Mod(mdg4)67.2 protein, leading to loss of insulator function.

The result is that all of the yellow enhancers are silenced by Su(Hw), resulting in a y-

phenotype (yellow bristles, wings and bodies) (GERASIMOVA et al. 1995;

MONGELARD et al. 2002).

To determine if Z3-3401 modifies the y2 phenotype in a similar fashion, we

examined the colors of wings, abdomens and bristles of y2/Y; Z3-3401/mod(mdg4)T16

flies and compared them to y2/Y; mod(mdg4)T6/mod(mdg4)T16, y2/Y; mod(mdg4)T16/+

and y2; Z3-5578/mod(mdg4)T16 flies, scoring at least 20 flies of each genotype. The

result was that all y2; Z3-3401/mod(mdg4)T16 flies were y- in phenotype and

indistinguishable from y2; mod(mdg4)T6/mod(mdg4)T16 flies, whereas the heterozygous

control mod(mdg4)T16/+ and the y2; Z3-5578/mod(mdg4)T16 flies exhibited the y2

29

pigmentation pattern featuring black bristles (data not shown). We conclude that Z3-

3401 acts as an enhancer of y2, and infer that it disrupts the function of the

Mod(mdg4)67.2 isoform. Taken together with the MNM-independent effect of Z3-3401

on female fertility, these data provide strong evidence that the Z3-3401 mutation

disrupts functioning of other Mod(mdg4) isoforms besides MNM.

Does the mod(mdg4) common region have a general role in male homolog

segregation? Our analyses of Z3-3401 indicate that the Mod(mdg4) CR is required for

an indirect step in meiotic homolog conjunction, stable nuclear localization of MNM. If

the CR plays additional roles in homolog conjunction, then other mutations in the CR

should also disrupt homolog conjunction. Although there are numerous extant

mod(mdg4) alleles (FLYBASE, 2006), the great majority are recessive lethals that

cannot be tested directly for meiotic phenotypes. Moreover, clones homozygous for two

such mutations in the germline of mod(mdg4)/+ males were inviable (B. D. McKee,

unpublished data), precluding analysis of meiosis in such clones.

To address the role of the mod(mdg4) CR in meiotic conjunction, we conducted

complementation tests between Z3-3401 and a collection of pre-existing mod(mdg4)

alleles that included 9 small deletions, 3 transposon insertions and 6 EMS-induced

mutations (Table 1 and Fig. 1A). Except for mod(mdg4)T6, which results from a base

substitution in the C-terminal exon specific for the non-essential Mod(mdg4)67.2 protein

(GERASIMOVA et al. 1995; GAUSE et al. 2001), all of the tested mod(mdg4) mutations

and deletions are recessive lethals or semi-lethals, and nearly all have been mapped to

the CR, either by direct molecular identification of lesions within the CR or by failing to

complement mutations with molecular lesions in the CR (GERASIMOVA et al. 1995;

30

BUCHNER et al. 2000; GAUSE et al. 2001). Five of the lethal alleles carry previously

identified lesions within the mod(mdg4) transcription unit: 142∆15, a 1Kb deletion that

removes the promoter and first exon of mod(mdg4); 142∆32, a deletion that removes

upstream regulatory sequences of mod(mdg4) (AZPIAZU and FRASCH 1993) and the

three transposon insertions (2, 3 and neo129), all of which have been molecularly

mapped to sites within the mod(mdg4) common region (Fig. 1A; BUCHNER et al. 2000).

We used a SNP-mapping technique to map the breakpoints of the remaining 7 small

deletions (Table 2) and found that three of the deletions (T16, 142∆33 and 142∆10) are

deficient for the entire mod(mdg4) locus, two (142∆29 and 142∆49) are deficient for part

or all the common region but not deficient for the variable region, and two (eGP4 and

B2) have fully intact mod(mdg4) common regions but are deficient for most of the

variable exons, including the MNM-specific exon (Fig. 1A). In addition, we sequenced

two of the lethal EMS alleles, mod(mdg4)324 and mod(mdg4)340, and found that both

contain base substitutions within the common region. These mutations are predicted to

result in an amino acid substitution, G92D, within the BTB domain of mod(mdg4)324,

and a nonsense mutation at Q177, a site downstream of the BTB domain, in

mod(mdg4)340 (Fig. 1B).

Z3-3401 fully complemented the lethality of all of the lethal and semi-lethal alleles

but the trans-heterozygous males exhibited a complex complementation pattern with

respect to X-Y NDJ (Table 1). Z3-3401 failed to complement most mod(mdg4) alleles,

yielding NDJ frequencies comparable to those of Z3-3401 hemizygotes. However, it

partially or fully complemented the two deletions, B2 and eGP4, which are confined to

the VR, and fully complemented the viable mod(mdg4)T6 allele. Moreover, as

31

described above, it strongly (but not completely) complemented the mnm alleles Z3-

5578 and Z3-3298, the trans-heterozygotes yielding only about 1% X-Y NDJ (Table 3).

The finding that Z3-3401 and mod(mdg4)T6 complement with respect to X-Y NDJ was

expected as no X-Y or 4th chromosome NDJ was observed in mod(mdg4)T6 hemizygous

males (data not shown), indicating that the Mod(mdg4)67.2 isoform is not required for

chromosome segregation in male meiosis.

Parallel complementation tests between the mnm alleles, Z3-5578 and Z3-3298,

and the mod(mdg4) mutations (Table 1) yielded results that were in many cases

opposite to those of Z3-3401. Both mnm alleles fully complemented the lethality of all

mutations and deletions confined to the CR and partially or fully complemented the

same mutations with respect to X-Y NDJ. However, both mnm alleles failed to

complement all mutations that disrupt the MNM-specific exon, including the two

deletions, eGP4 and B2, that remove most of the VR exons (including the MNM-specific

exon) and the three deletions that encompass the entire mod(mdg4) locus (T16,

142∆10 and 142∆33). In addition, both mnm alleles fully complemented mod(mdg4)T6,

which affects only the Mod(mdg4)67.2-specific exon.

Thus, all of the complementation results are consistent with a pattern in which

mutations or deletions confined to the CR complement (partially or fully) mutations or

deletions confined to the VR. Moreover, mutations in two different variable exons

complement each other. Notably, deletions and point mutations exhibited similar

complementation behavior, thus ruling out the possibility that intragenic

complementation results from formation of functional protein homo-dimers from two

monomers with mutations in different domains.

32

MNM transcripts are generated by trans-splicing: Intragenic

complementation between mutations in the CR and in the C-terminal exon specific for

the Mod(mdg4)67.2 isoform has been previously reported (MONGELARD et al. 2002).

Complementation in that case has been shown to be due trans-splicing between

separate precursor transcripts for the CR and VR components of Mod(mdg4)67.2

expressed from opposite homologs (LABRADOR et al. 2001; MONGELARD et al.

2002). As the common and variable regions of Mod(mdg4)67.2 are encoded on

opposite genomic strands, the mature Mod(mdg4)67.2 transcript can presumably be

generated only by trans-splicing. Since all MNM exons are encoded on the same

strand, generation of MNM transcripts by conventional cis-splicing should be possible

(see Fig. 1A). However, our complementation data suggest that at least some MNM

transcripts are trans-spliced and, moreover, that trans-homolog trans-splicing (THTS)

(Fig. 6) makes a significant contribution to the pool of MNM transcripts.

To test for MNM transcripts derived from THTS, we sequenced a sample of

cloned testis cDNAs from Z3-3401/Z3-5578 (a complementing genotype, Table 2)

prepared by RT-PCR amplification of a segment of MNM that encompasses the sites of

both mutant lesions. If splicing occurs exclusively in the cis mode, all cDNAs from these

males should contain either the Z3-3401 mutation or the Z3-5578 mutation but never

both (Fig. 6B). However, if THTS occurs at a significant frequency, cDNAs that are

wild-type at both sites or mutant at both sites should be recovered. Of 137 cDNAs from

Z3-3401/Z3-5578 males, 55 (40%) were either wild-type at both sites or mutant at both

sites, suggesting that THTS does occur at a substantial frequency (Fig. 6C).

33

A technical complication in experiments of this type is that wild-type and doubly

mutant cDNAs can arise in vitro from singly mutant transcripts by template switching

during the PCR reaction (TASIC et al. 2002). To assess the frequency of such artifacts

under the conditions of our experiments, we carried out a control experiment in which

the RNA templates consisted of an equimolar mixture of singly mutant RNAs prepared

from testes of males hemizygous for Z3-3401 or Z3-5578. In this control, wild-type or

doubly mutant cDNAs can be generated only by template switching during the PCR

reaction. Of 130 control cDNAs, 21 (16%) were either wild-type at both sites or mutant

at both sites (Fig. 6C). Thus, template switching does occur at a significant frequency in

this experiment and we cannot conclude that the wild-type and doubly mutant cDNAs in

the trans-heterozygous sample all resulted from in vivo trans-splicing events. However,

a statistical analysis shows that the difference in frequency of wild-type and doubly

mutant cDNAs between experimental and control samples is highly significant (χ2 =

18.8, 1d.f., p<<.001), thus supporting the THTS hypothesis. Taking into account the

error introduced by template switching in both directions, we estimate that 35% (95%

confidence interval = 27-43%) of MNM mRNAs from Z3-3401/Z3-5578 males are either

wild-type at both sites or doubly mutant at both sites, presumably due to THTS.

As a further test of the trans-splicing hypothesis, we evaluated the ability of a

transgene [CR-7.5], located on chromosome 2, that carries a 7.5kb genomic fragment

encompassing the entire CR of mod(mdg4) but that lacks MNM-specific sequences (see

Fig. 1A), for ability to rescue the meiotic phenotypes of Z3-3401. This transgene

partially rescues the lethality of some mutations in the CR (BUCHNER et al. 2000),

presumably via trans-splicing between precursor transcripts for the CR and VR

34

components of one or more Mod(mdg4) isoforms encoded by the transgene and by the

native mod(mdg4) locus, respectively.

To test for complementation of Z3-3401 by the [CR-7.5] transgene, Z3-3401/Z3-

3401, Z3-3401//mod(mdg4)neo129 or Z3-3401/Df(3R)T16 males (as well as control Z3-

5578/Df males) with and without the transgene were tested for X-Y NDJ. In all three

sets of crosses involving Z3-3401, NDJ frequencies were significantly lower in the

presence of the transgene than in its absence (Table 8), whereas the transgene had no

effect on NDJ frequencies in Z3-5578 males (data not shown). These results indicate

that partial MNM precursor transcripts generated at distant genomic locations can trans-

splice at a high enough frequency in spermatocytes to significantly ameliorate the

phenotype of a strong meiotic mutant. Presumably, the relatively weak rescue afforded

by the transgene reflects decreased efficiency of trans-splicing due to spatial separation

of the coding sequences for the CR and VR portions of the MNM transcript.

DISCUSSION

Z3-3401 is an allele of mod(mdg4) that disrupts X-Y segregation more

severely than autosomal segregation. Our previous results demonstrated that

mutations in a mod(mdg4) exon presumed to be specific for the C-terminus of the MNM

isoform disrupt stable conjunction and regular segregation of all four homolog pairs in

male meiosis I. Here we have shown that a mutation located in the CR of mod(mdg4)

and that, therefore, should be present in all Mod(mdg4) isoforms, causes a similar

spectrum of meiotic defects. Like the mnm-specific mutations, Z3-3401 disrupts the

maintenance of homolog associations from mid-prophase I through M I but has no

35

apparent effect on the initiation of homolog pairing in early meiosis, on the stability of

sister chromatid cohesion or on any aspect of female meiosis.

However, the effects of Z3-3401 on autosomal segregation are much milder than

its effects on autosomal segregaton. In Z3-3401 hemizygous males, X-Y NDJ occurs at

frequencies in the 40-50% range, consistent with nearly random assortment, but 2nd and

4th chromosome NDJ frequencies are in the 10-20% range. This is not because MNM

plays a less critical role in autosomal than in X-Y segregation since both mnm-specific

alleles disrupt X-Y and autosomal segregation equally severely. The basis for this

partial X-Y specificity is not known.

One possible explanation is that the X-Y and autosomal pairs exhibit different

thresholds of sensitivity to reduction in amount of MNM protein in the nucleus, either

because X-Y pairing sites need more MNM protein than autosomal pairing sites to

associate stably, or because MNM is loaded more efficiently on autosomal than X-Y

pairing sites when MNM is present in limiting amounts. Some functional MNM protein

must be present on both autosomes and the X-Y pair in Z3-3401 spermatocytes, as

indicated both by the mild autosomal segregation defect and by the fact that Z3-3401 is

hypomorphic for both autosomal and X-Y segregation. Moreover, late prophase I nuclei

appear to contain small amounts of Mod(mdg4) proteins, some of which may represent

functional, chromosome-associated MNM. The suggestion that MNM might load more

efficiently on autosomes than on the X-Y pair is consistent with our observation that

MNM protein is recruited to the X-Y and autosomal pairs by different mechanisms. Both

autosomal conjunction and autosomal recruitment of MNM-GFP are dependent upon

36

tef+ function, whereas both X-Y conjunction and recruitment of MNM-GFP to the X-Y

bivalent are independent of tef+ (TOMKIEL et al. 2001; THOMAS et al., 2005).

An alternative explanation is suggested by our finding that mutant MNM protein is

present throughout prophase I in Z3-3401 spermatocytes but confined to the cytoplasm

prior to the onset of prometaphase I. Although MNM and SNM are normally present in

the nucleus and associated with the chromosomes and nucleoli from early prophase I

on, we have no direct evidence that their presence is required for stable conjunction

prior to chromosome condensation. Perhaps conjunction of at least the autosomal

homologs is not stably attained until they begin condensing just prior to prometaphase I.

In that case, mutant Z3-3401 protein might be able to gain access to and help conjoin

the condensing chromosomes at the onset of prometaphase I when the nucleus

becomes permeable to cytoplasmic proteins. The differential effect of Z3-3401 on

autosomal versus sex chromosome conjunction could reflect differential timing of the

establishment of autosomal versus X-Y conjunction or differential access of MNM and

SNM to autosomal versus X-Y pairing sites at late stages.

Do other mod(mdg4) isoforms function in meiosis?: We have suggested

that MNM might function in homolog pairing by binding specific chromosomal sites on

homologous chromosomes at its C-terminal C2H2 domain and utilizing its N-terminal

BTB/POZ domain to glue those sites together (THOMAS et al. 2005). mod(mdg4) is

thought to be capable of encoding 30 additional proteins with identical BTB/POZ

domains but different chromosome localization domains. Thus an appealing possibility

is that some of those additional proteins could play similar roles in homolog pairing in

male or female meiosis, or in somatic cells. Moreover, if Mod(mdg4) isoforms can

37

heterodimerize, which seems likely given that their BTB domains are identical, to form

proteins with unique chromosome localization patterns, mod(mdg4) might have the

potential to encode a small army of site-specific pairing proteins.

However, the data presented here provide no support for such a scenario.

Analysis of a mutation in the exon specific for the abundantly expressed

Mod(mdg4)67.2 isoform revealed no meiotic phenotypes in either sex. Moreover, Z3-

3401, which contains an R224C substitution which should be present in all Mod(mdg4)

isoforms, nevertheless exhibited no meiotic phenotypes that could not be accounted for

by effects on MNM. This is not because R224 is part of a domain required only for

MNM function. Z3-3401 flies are functionally mutant for at least two other Mod(mdg4)

isoforms besides MNM: the Mod(mdg4)67.2 insulator protein and at least one

unidentified isoform required for female fertility. Thus, the Z3-3401 mutation failed to

reveal additional meiotic proteins encoded by mod(mdg4). However, Z3-3401 has no

effect on viability whereas most mutations in the common region are recessive lethals,

suggesting that some Mod(mdg4) isoforms may be unaffected by the R224C

substitution. Thus, our findings do not rule out the existence of other meiotic

Mod(mdg4) isoforms that are functionally unaffected by the R224C substitution (e.g., if

the C-terminal exon encodes a nuclear localization sequence (NLS)). Genetic analysis

of mutations specific for other isoforms besides MNM and Mod(mdg4)67.2 will be

needed to test definitively for the existence of other meiotic proteins encoded by

mod(mdg4).

MNM is expressed predominantly by a mechanism involving trans-splicing:

At least some of the mature transcripts for Mod(mdg4) proteins are generated by an

38

unusual mechanism in which the CR and VR exons are separately transcribed and

spliced together in trans (LABRADOR and CORCES 2001; DORN et al. 2001). For

some isoforms, such as Mod(mdg4)67.2, trans-splicing is presumably essential for

expression, as the common and variable regions are encoded on opposite strands.

However, for most isoforms, including MNM, the CR and VR components are encoded

on the same strand and the relative contributions of cis- versus trans-splicing

mechanisms in their expression has been unclear.

Our data indicate that trans-splicing is the predominant mode of expression of

MNM. Complementation analysis demonstrated that mutations of all molecular types,

including deletions, in the CR partially or fully complement mutations in or deletions of

MNM, a pattern difficult to explain except by THTS. Sequence analysis revealed that a

significant fraction, 35% plus or minus 8%, of the mRNAs present in testis extracts from

trans-heterozygous Z3-5578/Z3-3401 males were either wild-type for both mutant sites

or doubly mutant at both sites. We presume that all such RNAs result from THTS.

These data allow a rough estimate of the relative frequency of trans- versus cis-

splicing in generation of MNM-encoding mRNAs. Assuming no bias for or against

splicing between precursor transcripts expressed from opposite homologs versus the

same homolog, an additional 35% of transcripts should result from trans-splicing

between precursors encoded on the same homolog, but would nevertheless be singly

mutant and therefore indistinguishable from cis-spliced transcripts. This leads to a total

estimate of the fraction of trans-spliced MNM transcripts of 70%. This figure could

substantially underestimate the frequency of trans-splicing since any significant spatial

separation between homologs would be expected to create a bias in favor of splicing

39

between precursors encoded on the same homolog. Thus we conclude that a majority

and perhaps all, of the MNM-encoding transcripts synthesized in spermatocytes are

generated by trans-splicing.

Our data provide the first example of the routine use of trans-splicing at the

native mod(mdg4) locus to synthesize an isoform whose exons are all encoded on the

same strand. They also extend the range of Drosophila cell types shown to be

competent for trans-splicing to the male germ line. Previous results have shown that

embryonic and somatic isoforms of the mod(mdg4) and lola genes can be generated by

trans-splicing and that somatic phenotypes controlled by these genes are subject to

intragenic complementation via THTS (DORN et al. 2001; MONGELARD et al. 2002;

HORIUCHI et al. 2003; GABLER et al. 2005). Our data indicate that spermatogonia

and/or young spermatocytes must also be competent to carry out trans-splicing.

It remains unclear how the expression of MNM is regulated. The function of

MNM appears to be limited to male meiosis and MNM protein has thus far been

detected only in primary spermatocytes. Our data demonstrating that MNM is

expressed predominantly by trans-splicing suggest that MNM expression could be

regulated either by testis-specific transcription of the C-terminal MNM exon or by

regulated trans-splicing. However, even when the intronless MNM-GFP transgene is

expressed from the ubiquitous hsp70 promoter under heat-shock conditions, we have

failed to detect significant amounts of MNM-GFP in somatic or gonial cells of the testis

or in larval salivary gland cells (M. SOLTANI-BEJNOOD, S.E. THOMAS and B.D.

MCKEE, unpublished data), suggesting that MNM protein may be unstable in cell types

other than spermatocytes. Moreover, MNM cDNAs have been cloned from embryonic

40

RNA by two different groups (HARVEY et al. 1997; BUCHNER et al. 2000), indicating

that transcription of the MNM-specific exon and splicing between the common region

and MNM precursor transcripts are not exclusive to male germ cells. It will be important

to determine the relative contributions of regulatory mechanisms at the level of

transcription, splicing, translation and protein stability in delimiting expression of MNM to

primary spermatocytes.

The role of the Mod(mdg4) common region in MNM function: We have

previously shown that mutations in a single VR exon of mod(mdg4) disrupt homolog

conjunction in male meiosis. In this study, we sought and obtained evidence that the

Mod(mdg4) CR is also required for homolog conjunction. The Z3-3401 allele, which

contains a missense mutation in the CR, causes meiotic phenotypes very similar to

those of the mnm alleles. Moreover, males trans-heterozygous for Z3-3401 and any of

17 lethal or semi-lethal mod(mdg4) alleles, most of which contain lesions in the CR,

exhibited similar meiotic phenotypes.

What role(s) does the mod(mdg4) CR play in homolog conjunction? We

previously suggested (THOMAS et al. 2005) that the BTB/POZ domain, which has been

shown to mediate dimerization and multimerization (GERASIMOVA and CORCES

1998; GERASIMOVA et al. 2000; GHOSH et al. 2001; GAUSE et al. 2001), might

function to stably connect MNM-containing conjunction complexes localized to allelic

sites on homologous chromosomes. Unexpectedly, immunofluoresence analysis

revealed that both MNM and SMN are undetectable on condensed X-Y bivalents in Z3-

3401 spermatocytes and that, although mutant MNM protein is detectable prior to

chromosome condensation, the great majority of it is restricted to the cytoplasm

41

throughout prophase I. This suggests that the Z3-3401 mutation does not disrupt

conjunction directly but rather disrupts a nuclear localization or nuclear retention signal

required for stable nuclear localization of MNM. Although the sequence surrounding

amino acid 224 in mod(mdg4) does not fully conform to known NLS sequences, R224 is

part of a two-residue cluster of basic amino acids (KR), which are critical components of

classical NLS sequences (MATTAJ and ENGELMEIER 1998). It will be of interest to

learn whether addition of a classical NLS to the Z3-3401 MNM protein restores nuclear

localization, and, if so, whether this alone suffices to restore wild-type function.

The fact that all of the lethal and semi-lethal mod(mdg4) alleles, including five

EMS-induced alleles, fully failed to complement Z3-3401 for meiotic chromosome

segregation suggests that the CR is likely to play additional roles in homolog

conjunction besides nuclear localization. The most interesting allele is mod(mdg4)324,

which is predicted to contain a G92D substitution. G92 lies within the BTB domain and

is conserved among 32 of 44 Drosophila BTB-domain proteins, including GAGA,

Tramtrack, Broad Complex and Bric a Brac (ZOLLMAN et al. 1994; READ et al. 2000).

By homology modeling, G92 is predicted to be important for formation of a β-sheet

crucial for homodimerization (READ et al. 2000). Although we have not established

whether the mutant MNM protein produced by mod(mdg4)324 is stable and/or localized

properly in spermatocytes, a mutant GAGA protein that contains a G to S substitution at

the equivalent residue in the BTB domain (which is highly similar to that of mod(mdg4)),

as well as a second substitution at a conserved residue in the BTB domain, is

expressed at normal levels in Drosophila S2 cells and localizes normally to

chromosomal foci (READ et al. 2000). Thus, the mod(mdg4)324 mutation may provide

42

a very useful tool for analysis of the role of the mod(mdg4) BTB domain in homolog

conjunction.

ACKNOWLEDGEMENTS

We thank C. Zuker, B. Wakimoto, R. Dorn, V. Corces, M. Frasch and the Drosophila

Stock Center at Indiana University, Bloomington for gifts of Drosophila stocks and

antibodies. Support for this work was provided by grant # R01 GM40489 from the

National Institutes of Health to B.D.M.

LITERATURE CITED

AZPIAZU, N., and M. FRASCH, 1993. tinman and bagpipe: two homeobox genes that

determine cell fates in the dorsal mesoderm of Drosophila. Genes Devel. 7:

1325-1340.

BARDWELL, V. J., and R. TREISMAN, 1994. The POZ domain: a conserved protein-

protein interaction motif. Genes Dev. 8: 1664-1677.

BUCHNER, K., P. ROTH, G. SCHOTTA, V. KRAUSS, H. SAUMWEBER, et al., 2000.

Genetic and molecular complexity of the position effect variegation modifier

mod(mdg4) in Drosophila. Genetics 155: 141-157.

CAI, H. N., and M. LEVINE, 1997. The gypsy insulator can function as a promoter-

specific silencer in the Drosophila embryo. EMBO J. 16: 1732-1741.

CARPENTER, A. T., 1994. Chiasma function. Cell 77: 957-962.

CENCI, G., S. BONACCORSI, C. PISANO, F. VERNI and M. GATTI, 1994. Chromatin

and microtubule organization during premeiotic, meiotic and early postmeiotic

43

stages of Drosophila melanogaster spermatogenesis. J. Cell Sci. 107: 3521-

3534.

CHEN, S. and V. G. CORCES, 2001. The gypsy insulator of Drosophila affects

chromatin structure in a directional manner. Genetics 159: 1649-1658.

DORN, R., and V. KRAUSS, 2003. The modifier of mdg4 locus in Drosophila: functional

complexity is resolved by trans splicing. Genetica 117: 165-177.

DORN, R., V. KRAUSS, G. REUTER and H. SAUMWEBER, 1993. The enhancer of

position-effect variegation of Drosophila, E(var)3-93D, codes for a chromatin

protein containing a conserved domain common to several transcriptional

regulators. Proc. Natl. Acad. Sci. USA 90: 11376-11380.

DORN, R., G. REUTER and A. LOEWENDORF, 2001. Transgene analysis proves

mRNA trans-splicing at the complex mod(mdg4) locus in Drosophila. Proc. Natl.

Acad. Sci. USA 98: 9724-9729.

ESPINAS, M. L., E. JIMENEZ-GARCIA, A. VAQUERO, S. CANUDAS, J. BERNUES et

al., 1999. The N-terminal POZ domain of GAGA mediates the formation of

oligomers that bind DNA with high affinity and specificity. J. Biol. Chem. 274:

16461-16469.

FLYBASE. URL: http://flybase.bio.indiana.edu/

GABLER, M., M. VOLKMAR, S. WEINLICH, A. HERBST, P. DOBBERTHIEN et al.,

2005. Trans-splicing of the mod(mdg4) complex locus is conserved between the

distantly related species Drosophila melanogaster and D. virilis. Genetics 169:

723-736.

44

GAUSE, M., P. MORCILLO and D. DORSETT, 2001. Insulation of enhancer-promoter

communication by a gypsy transposon insert in the Drosophila cut gene:

cooperation between Suppressor of Hairy-wing and Modifier of mdg4 proteins.

Mol. Cell. Biol. 21: 4807-4817.

GEORGIEV, P. G. and T. I. GERASIMOVA, 1989. Novel genes influencing the

expression of the yellow locus and mdg4 (gypsy) in Drosophila melanogaster.

Mol. Gen. Genet. 220: 121-126.

GEORGIEV, P. G. and M. KOZYCINA 1996. Interaction between mutations in the

suppressor of Hairy wing and modifier of mdg4 genes of Drosophila

melanogaster affecting the phenotype of gypsy-induced mutations. Genetics

142: 425-436.

GERASIMOVA, T. I., K. BYRD and V. G. CORCES, 2000. A chromatin insulator

determines the nuclear localization of DNA. Mol. Cell 6: 1025-1035.

GERASIMOVA, T. I., and V. G. CORCES, 1998. Polycomb and trithorax group proteins

mediate the function of a chromatin insulator. Cell 92: 511-521.

GERASIMOVA, T. I., D. A. GDULA, D. V. GERASIMOV, O. SIMINOVA and V. G.

CORCES, 1995. A Drosophila protein that imparts directionality on a chromatin

insulator is an enhancer of position-effect variegation. Cell 82: 587-597.

GEYER, P. K., C. SPANA and V. G. CORCES, 1986. On the molecular mechanism of

gypsy-induced mutations at the yellow locus of Drosophila melanogaster. EMBO

J. 5: 2657-2662.

GEYER, P. K. and V. G. CORCES, 1987. Separate regulatory elements are

responsible for the complex pattern of tissue-specific and developmental

45

transcription of the yellow locus in Drosophila melanogaster. Genes Dev. 1: 996-

1004.

GEYER, P. K., and V. G. CORCES, 1992. DNA position-specific repression of

transcription by a Drosophila zinc-finger protein. Genes Devel. 6: 1865-1873.

GHABRIAL, A. and T. SCHUPBACH, 1999. Activation of a meiotic checkpoint

regulates translation of gurken during Drosophila oogenesis. Nature Cell Biol 1:

354-357.

GHOSH, D., T. I. GERASIMOVA and V. G. CORCES, 2001. Interactions between the

Su(Hw) and Mod(mdg4) proteins required for gypsy insulator function. EMBO J.

20: 2518-2527.

GORCZYCA, M., E. POPOVA, X. X. JIA and V. BUDNICK, 1999. The gene mod(mdg4)

affects synapse specificity and structure in Drosophila. J. Neurobiol. 39: 447-

460.

GRANOK, H., B. A. LIEBOVITCH, C. D. SCHAFFER, S. C. R. ELGIN, 1995. Ga-ga

over GAGA factor. Curr. Biol. 5: 238-241.

GUNSALUS, K. C., S. BONACCORSI, E. WILLIAMS, F. VERNI, M. GATTI et al., 1995.

Mutations in twinstar, a Drosophila gene encoding a cofilin/ADF homologue,

result in defects in centrosome migration and cytokinesis. J. Cell Biol. 131: 1243-

1259.

HARVEY, A. J., A. P. BIDWAL and L. K. MILLER, 1997. Doom, a product of the

Drosophila mod(mdg4) gene induces apoptosis and binds to Baculovirus

inhibitor-of-apoptosis proteins. Mol. Cell. Biol. 17: 2835-2843.

46

HASSOLD, T., and P. HUNT, 2001. To err (meiotically) is human: the genesis of human

aneuploidy. Nat. Rev. Genet. 2: 280-291.

HAWLEY, R. S., 1988. Exchange and chromosomal segregation in eucaryotes, pp. 497-

527 in Genetic Recombination, edited by R. Kucherlapati and G. R. Smith.

American Society for Microbiology, Washington, D.C.

HORIUCHI, T., E. GINIGERT and T. AIGAKI, 2003. Alternative trans-splicing of

constant and variable exons of a Drosophila axon guidance gene, lola. Genes

Devel. 17: 2496-2501.

HOSKINS, R. A., A. C. PHAN, M. NAEEMUDDIN, F. A. MAPA, D. A. RUDDY, J. J.

RYAN, L. M. YOUNG, T. WELLS, C. KOPCZYNSKI and M. C. ELLIS, 2001.

Single nucleotide polymorphism markers for genetic mapping in Drosophila

melanogaster. Genome Res. 11: 1100-1113.

IGARISHI, K., H. HOSHINO, A. MUTO, N. SUWABE, S. NISHIKAWA et al., 1998.

Multivalent DNA binding complex generated by Small Maf and Bach1 as a

possible biochemical basis for B-Globin Locus Control Region complex. J. Biol.

Chem. 273: 11783-11790.

KATSANI, K. R., M. A. HAJIBAGHERI and C. P. VERRIJZER, 1999. Co-operative DNA

binding by GAGA transcription factor requires the conserved BTB/POZ domain

and reorganizes promoter topology. EMBO J. 18: 698-708.

KOUNDAKJIAN, E. J., D. M. COWAN, R. W. HARDY and A. H. BECKER, 2004. The

Zuker collection: a resource for the analysis of autosomal gene function in

Drosophila melanogaster. Genetics 167: 203-206.

47

LABRADOR, M., F. MONGELARD, P. PLATA-RENGIFO, E. M. BAXTER, V. G.

CORCES and T. I. GERASIMOVA, 2001. Protein encoding by both strands.

Nature 409: 1000.

LABRADOR, M., and V. G. CORCES, 2003. Extensive exon reshuffling over

evolutionary time coupled to trans-splicing in Drosophila. Genome Res. 13: 2220-

2228.

MATTAJ, I. W., ENGLMEIER, L., 1998. Nucleocytoplasmic transport: the soluble

phase. Annu. Rev. Biochem. 67: 265-306.

McKEE, B. D., 1996. The license to pair: identification of meiotic pairing sites in

Drosophila. Chromosoma 105: 135-141.

McKEE, B. D., 2004. Homologous pairing and chromosome dynamics in meiosis and mitosis.

Biochim. biophys. acta 1677: 165-180.

McKEE, B. D., and G. H. KARPEN, 1990. Drosophila ribosomal RNA genes function as

an X-Y pairing site during male meiosis. Cell 61: 61-72.

McKEE, B. D., and D. L. LINDSLEY, 1987. Inseparability of X-heterochromatic

functions responsible for X:Y pairing, meiotic drive, and male fertility in

Drosophila melanogaster males. Genetics 116: 399-407.

MELNICK, A., K. F. AHMAD, S. ARAI, A. POLINGER, H. BALL et al., 2000. In-depth

mutational analysis of the promyelocytic leukemia zinc finger BTB/POZ Domain

reveals motifs and residues required for biological and transcriptional functions.

Mol. Cell. Biol. 20: 6550-6567.

MOHLER, J., and M. L. PARDUE, 1982. Deficiency mapping of the 93D heat shock

locus in Drosophila melanogaster. Chromosoma 86: 457-467.

48

MOHLER, J., and M. L. PARDUE, 1984. Mutational analysis of the region surrounding

the 93D heat shock locus of Drosophila melanogaster. Genetics 106: 249-265.

MONGELARD, F., M. LABRADOR, E. M. BAXTER, T. I. GERASIMOVA and V. G. CORCES,

2002. Trans-splicing as a novel mechanisms to explain inter-allelic complementation in

Drosophila. Genetics 160: 1481-1487.

MULLER, S. A., T. SASAKI, P. BORK, B. WOLPENSINGER, T. SCHULTHESS et al.,

1999. Domain organization of Mac-2 binding protein and its oligomerization to

linear and ring-like structures. J. Mol. Biol. 291: 801-813.

PAGE, S. L. and R. S. HAWLEY, 2001. c(3)G encodes a Drosophila synaptonemal

complex protein. Genes Dev 15: 3130-3143.

PAGE, S. L, and R. S. HAWLEY, 2003. Chromosome choreography: the meiotic ballet.

Science 301: 785-789.

PAGE, S. L., and R. S. HAWLEY, 2004. The genetics and molecular biology of the

synaptonemal complex. Annu. Rev. Cell. Dev. Biol. 20: 525-558.

PARK, H. S., and M. T. YAMAMOTO, 1995. The centric region of the X chromosome

rDNA functions in male meiotic pairing in Drosophila melanogaster.

Chromosoma 103: 700-707.

RASOOLY, R. S., and L. G. ROBBINS, 1991. Rex and a suppressor of Rex are

repeated neophorphic loci in the Drosophila melanogaster ribosomal DNA.

Genetics 129: 119-132.

READ, D., M. J. BUTTE, A. F. DERNBURG, M. FRASCH and T. B. KORNBERG, 2000.

Functional studies of the BTB domain in the Drosophila GAGA and Mod(mdg4)

proteins. Nucl. Acids Res. 28: 3864-3870.

49

ROBINETT, C. C., A. STRAIGHT, G. LI, C. WILLHELM, G. SUDLOW et al., 1996. In

vivo localization of DNA sequences and visualization of large-scale chromatin

organization using lac operator/repressor recognition. J. Cell Biol. 135: 1685-

1700.

ROEDER, G. S., 1997. Meiotic chromosomes: it takes two to tango. Genes Dev. 11:

2600-2621.

STOGIOS, P. J., G. S. DOWNS, J. J. S. JAUHAL, S. K. NANDRA and G. G. PRIVE, 2005.

Sequence and structural analysis of BTB domain proteins. Genome Biology 6: R82.

STRAIGHT, A. F., A. S. BELMONT, C. C. ROBINETT and A. W. MURRAY, 1996. GFP

tagging of budding yeast chromosomes reveals that protein-protein interactions can

mediate sister chromatid cohesion. Curr. Biol. 6: 1599-1608.

TASIC, B., C. E. NABHOLZ, K. K. BALDWIN, Y. KIM, E. H. RUECKERT, et al., 2002.

Promoter choice determines splice site selection in protocadherin α and γ pre-mRNA

splicing. Mol. Cell 10: 21-33.

THOMAS, S. E., M. SOLTANI-BEJNOOD, P. ROTH, R. DORN, J. M. LOGSDON et al., 2005.

Identification of two proteins required for conjunction and regular segregation of

achiasmate homologs in Drosophila male meiosis. Cell 123: 555-568.

TOMKIEL, J. E., B. T. WAKIMOTO and A. BRISCOE, Jr., 2001. The teflon gene is

required for maintenance of autosomal homolog pairing at meiosis I in male

Drosophila melanogaster. Genetics 157: 273-281.

VAZQUEZ, J., A. S. BELMONT and J. W. SEDAT, 2002. The dynamics of homologous

chromosome pairing during male Drosophila meiosis. Curr. Biol. 12: 1473-1483.

50

WAKIMOTO, B. T., D. L. LINDSLEY and C. HERRERA, 2004. Toward a comprehensive

genetic analysis of male fertility in Drosophila melanogaster. Genetics 167: 207-

216.

WOLF, K. W., 1994. How meiotic cells deal with non-exchange chromosomes.

Bioessays 16: 107-114.

ZOLLMANN, S., D. GODT, G. G. PRIVE, J. L. COUDERC and F. A. LASKI, 1994. The

BTB domain, found primarily in zinc-finger proteins, defines an evolutionarily

conserved family that includes several developmentally regulated genes in

Drosophila. Proc. Natl. Acad. Sci. USA 91: 10717-10721.

51

FIGURE LEGENDS

FIGURE 1. Structure of the mod(mdg4) locus and molecular identification of Z3-3401.

(A) Map of the mod(mdg4) locus, modified from DORN et al. (2001). Rectangles

represent exons (white for untranslated exons, black for translated exons). The

common region (CR) contains four exons common to all Mod(mdg4) transcripts,

transcribed left-to-right and cis-spliced. The variable region (VR) contains C-terminal

exons specific for each isoform on the same strand (below the line) or the opposite

strand (above the line) from the CR. Diagonal lines represent splice sites. Cross-

hatched rectangles represent C-terminal exons of MNM. Mapped mutational lesions are

indicated by triangles (transposon insertions), asterisks (point mutations) or dark lines

below the exons (deletions). Endpoints with diamonds represent deletion breakpoints

mapped within mod(mdg4); endpoints with arrows represent deletion breakpoints

outside mod(mdg4). Dashed line (CR-7.5) depicts the 7.5Kb genomic rescue fragment

used in the experiments in Table 8 (BUCHNER et al. 2000). See Table 5 legend for

references for mod(mdg4) alleles. (B) Sequence of MNM protein, based on conceptual

translation of a cDNA isolated from y w testis RNA (THOMAS et al., 2005). Altered

residues in Z3 mutations and in mod(mdg4)324 and mod(mdg4)340 are indicated by

bold-face with mutant residue above wild-type residue. BTB domain is shaded;

FLYWCH domain is underlined; C2H2 motif is enlarged.

FIGURE 2. Cytological analysis of male meiosis in Z3-3401.

(A) Representative figures from various stages of meiosis in wild-type and Z3-3401/Z3-

3401 males stained with DAPI to visualize the DNA and an anti-tubulin antibody to

52

visualize the spindles. Round spermatid nuclei (rightmost) panel are unequal in size in

Z3-3401, indicative of NDJ. Prometaphase I and metaphase I cells exhibit too many

DNA clumps, suggestive of conjunction failure, and anaphase I cells exhibit unequal

poles, indicative of missegregation of homologs at meiosis I. Meiosis II chromosome

morphology and segregation appear normal.

(B) Quantification of meiosis I abnormalities in Z3-3401 spermatocytes. Data from wild-

type and Z3-3298 spermatocytes (THOMAS et al. 2005) provided for comparison.

(C) Meiosis I chromosomes from wild-type and Z3-3401 homozygous males stained

with acetic orcein to visualize DNA and observed by phase contrast microscopy. There

are four large univalent (unpaired) chromosomes (red arrows) and one bivalent at

prometaphase I and six large univalent chromosomes at metaphase I in Z3-3401

spermatocytes. Note the lagging chromosomes at anaphase I in Z3-3401.

(D) Representative meiotic figures from hemizygous Z3-3401/T16 males with or without

one copy of [hs::MNM-GFP]3. Both groups of males were heat-shocked twice during

larval development. Red arrows point to univalents in late prophase I; unpaired X and Y

chromosomes in upper right.

FIGURE 3. Homologous pairing and territory expansion in Z3-3401. Chromosomal

GFP-LacI foci were imaged in germ cell nuclei from wild-type (Z3-3401/+ or

Df(3R)T16/+) and Z3-3401/mod(mdg4)T16 males homozygous for a single lacO array

on chromosome arm 2R and hemizygous for [hsp83::GFP-LacI](2) (VAZQUEZ et al.

2002). (A) Homologous pairing in spermatogonia (gonia) and early prophase I (PI)

spermatocytes. Nuclei with one spot were scored as paired; nuclei with more than one

53

spot were scored as unpaired. (B) GFP-LacI spot dispersion in late prophase I

spermatocytes. Mean Nuc. Diam. = mean nuclear diameter (in uM) +/- standard

deviation; Mean Disp. = mean spot dispersion (in uM) +/- standard deviation. N =

number of nuclei scored.

FIGURE 4. Localization of MNM and SNM proteins to the X-Y bivalent is disrupted by

the Z3-3401 mutation. Spindles and DNA were stained with anti-tubulin (green) and

DAPI (blue), respectively, in right panels. Both anti-MNM (A) and anti-SNM (B)

antibodies stain a compact structure associated with the X-Y bivalent at prometaphase I

in wild-type spermatocytes (top rows). No staining of condensed meiotic chromosomes

with anti-MNM or anti-SNM is detected in Z3-3401 spermatocytes (bottom rows).

FIGURE 5. Mod(mdg4) proteins in early-mid (A) and late (B) prophase I spermatocytes

in wild-type (WT) and Z3 mod(mdg4) mutants. Dissected testes were stained with anti-

ModC antibody, which reacts against the common region of Mod(mdg4) proteins, anti-

tubulin to stain the spindles and DAPI to stain DNA. Nomenclature for stages follows

Cenci et al. (1994). S1-S2/early prophase I; S3-S4/mid-prophase I; S5-S6/late

prophase I. White arrows indicate nucleoli.

FIGURE 6. Trans-homolog trans-splicing in males trans-heterozygous for Z3-5578 and

Z3-3401. (A) Possible expression patterns for components of MNM. Expression of

common (black) and variable (red) exons of MNM continuously on a single precursor

transcript (above each homolog) or discontinuously on two separate transcripts (below

54

each homolog). m and + signify mutant and wild-type sites. (B) Trans- versus cis-

splicing. Both cis- and trans-splicing can generate parental-type (P) mRNAs. Only

trans-splicing can generate recombinant (R) mRNAs. (C) Estimated fraction of P and

R MNM RNAs in Z3-5578/Z3-3401 spermatocytes. Table gives # and frequency of

each type of MNM cDNA clone from trans-het. (Z3-5578/Z3-3401) male testis RNA and

control (an equimolar mixture of testis RNA from Z3-3401/Df(3R)GC14 and Z3-

5578/Df(3R)GC14 males). Clones were obtained by RT-PCR using an MNM-specific

primer pair. f(P & R) – estimated frequency of P and R RNAs (see Materials and

Methods).

55

TABLE 1

Results of complementation tests between Z3 alleles and mod(mdg4) alleles.

mod(mdg4) Complementation - %X-Y NDJ (N)a

Allele Typeb Locationc Viabilityd Z3-3401e Z3-5578e Z3-3298e

T16h,i Deletion Complete Lethal 39.6 (756) 44.3 (1018) 44.6 (884)

142∆10g Deletion Complete Lethal 49.3 (146) 46 (56) 43.2 (345)

142∆33g Deletion Complete Lethal 49.1 (505) 37.3 (663) 43.5 (726)

eGp4j,k Deletion VR only Semi-let. 2.94 (102) 50.3 (644) 49.0 (251)

B2k Deletion VR only Semi-let. 0 (1772) 37.3 (1311) 40.2 (672)

142∆15g,l Deletion CR only Lethal 42.1 (435) 0.56 (358) 2.34 (1196)

142∆32l,m Deletion CR only Lethal 28.3 (374) 0.95 (420) 1.46 (1096)

142∆29g Deletion CR only Lethal 46 (59) 1.54 (1492) 1.83 (1475)

142∆49g Deletion CR only Lethal 54.9 (304) 0 (371) 0.88 (1248)

Neo129n,o Insert. – P CR-Intron 3 Semi-let. 41.2 (1039) 4.46 (2288) 7.64 (1845)

02n Insert. – gypsy CR-Intron 3 Lethal 32.1 (1361) 1.72 (1918) 2.56 (1599)

03n Insert. – P CR-Exon 1 Lethal 34.9 (417) 0.07 (1438) 0.12 (1709)

20g,p,q NK NK Lethal 45.8 (609) 2.96 (1156) 0.28 (1081)

117g,q NK NK Lethal 47.2 (719) 0.75 (530) 1.55 (1869)

269g,q NK NK Lethal 49.5 (469) 1.44 (139) 2.59 (926)

324g,q Sub. (G92D) CR-BTB Lethal 44.4 (730) 2.84 (2081) 5.06 (1165)

340g,q Sub. (Q177 ) CR-Exon 4 Lethal 54.1 (745) 1.89 (1374) 3.18 (1194)

T6k,q,r Sub. (578 ) 67.2 exon Viable 0 (1113) 0.17 (1736) 0.13 (1492)

Z3-3401 Sub. (R224C) CR-exon 4 Viable 31.2 (724) 1.42 (2113) 1.09 (2848)

56

Z3-5578s Sub. (W449 ) MNM exon Viable 1.42 (2113) 51.2 (633) 45.2 (1836)

Z3-3298s Sub. (H511Y) MNM exon Viable 1.09 (2848) 45.2 (1836) Sterile

a+/BSYy+ males carrying the indicated combination of mod(mdg4) alleles were crossed

with y w females and % X-Y NDJ calculated as described in Materials and Methods. N

= # flies scored. bInsert. – insertion; P – P element; Sub. – base-pair substitution; -

nonsense codon; NK – not known. cCR – common region; VR – variable region; BTB –

BTB/POZ domain; dsemi-let. – semi-lethal. References: eWAKIMOTO et al. 1994;

fMOHLER and PARDUE 1984; gAZPIAZU and FRASCH 1993; hGERASIMOVA and

CORCES 1998; iCHEN and CORCES 2001; jMOHLER and PARDUE 1982;

kGERASIMOVA et al. 1995; lCAI and LEVINE 1997; mFLYBASE; nBUCHNER et al.

2000; oDORN et al. 1993; pGORCZYCA et al. 1999; qGAUSE et al. 2001; rGEYER and

CORCES 1992; sTHOMAS et al. 2005.

57

TABLE 2

Mapping deletion breakpoints in the mod(mdg4) region.

Exon(s) Deletions

Testeda GC14d,e T16f,g 142∆10e 142∆33e 142∆29e 142∆49e B2h eGP4h,i

52.0-56.3b Del. Del. Del. Del. NT NT Del. Del.

59.1 Del. Del. Del. Del. NT NT Del. Del.

59.0, 55.3 Del. Del. Del. Del. NT NT Del. Del.

65.0 Del. Del. Del. Del. NT NT Del. Del.

55.2 NT NT NT NT NT NT NT Not Del.

58.0 NT NT NT NT NT NT Del. Not Del.

Int 58.0/54.7c NT NT NT NT NT NT Del. NT

54.7, 53.6 NT NT NT NT NT NT Not Del. Not Del.

64.2 Del. Del. Del. Del. Not Del. Not Del. Not Del. Not Del.

CR-exon 4 Del. Del. Del. Del. Not Del. Del. Not Del. Not Del.

CR-exon 3 Del. Del. Del. Del. Del. Del. Not Del. Not Del.

aThe indicated mod(mdg4) exons (see DORN and KRAUSS (2003) for nomenclature

and map) were amplified from genomic DNA from deletion/CSiso and deletion/ORiso

flies and sequenced to determine whether the region was present in deletion DNA.

bThis region includes exons 52.0, 53.4, 58.6, 57.4, 59.3, 54.2 and 56.3. cIntron between

exons 58.0 and 54.7. Del. = deleted; NT = not tested. dMOHLER and PARDUE 1984;

eAZPIAZU and FRASCH 1993; fGERASIMOVA and CORCES 1998; gCHEN and

CORCES 2001; hGERASIMOVA et al. 1995; iMOHLER and PARDUE 1982.

58

TABLE 3

Sex chromosome NDJ in Z3-3401 and mnm males.

Sperm Classb

Paternal Genotypesa X Y XY O Nc %NDJd

Z3-3401/+ 418 389 0 2 809 0.25

Z3-3401/Z3-3401 270 228 96 130 724 31.2

Z3-3401/T16 436 352 179 437 1404 43.9

Z3-5578/Z3-5578 149 157 97 227 633 51.2

Z3-5578/T16 337 285 228 343 1193 47.9

Z3-3298/Z3-3298 0 0 0 0 0 Sterile

Z3-3298/T16 106 100 63 104 373 44.8

Z3-3401/Z3-5578 1119 967 10 18 2114 1.32

Z3-3401/Z3-3298 1510 1307 12 19 2848 1.09

Z3-3298/Z3-5578 535 471 372 458 1836 45.2

a+/BSYy+ males with the indicated 3rd chromosomes were crossed to y w females. T16

= Df(3R)T16 (Fig. 1; GERASIMOVA and CORCES 1998) which is deficient for the entire

mod(mdg4) locus. bSee Materials and Methods for procedures for inferring sperm

classes from progeny phenotypes. cN = Total # progeny scored. d%NDJ = 100 x (XY +

O)/N.

59

TABLE 4

4th chromosome loss in Z3-3401 and mnm males

Progenyb

Tested Genotypea ++ ci ey N %4-lossc # ♂♂ Fd

Z3-3401/+ (C) 604 2 606 0.33 8 75.8

Z3-3401/Z3-3401 449 15 461 3.3 20 23.1

Z3-3401/GC14 955 52 1007 5.2 19 53.0

Z3-3401/T16 1140 98 1238 7.9 44 28.1

Z3-5578/+ (C) 492 1 493 0.20 7 70.4

Z3-5578/GC14 550 215 765 28.1 20 38.3

Z3-3298/GC14 442 130 572 22.7 19 30.1

aMales carrying wild-type 4th chromosomes were crossed to C(4)RM ci eyR (4^4/O)

females. GC14 = Df(3R)GC14 (93D7; 93E1). T16 = Df(3R)T16 (93D7; 93D9). Both Dfs

are deleted for the mod(mdg4) locus. C -- control cross. bci ey progeny result from

union of O sperm with reciprocal 4^4-bearing eggs; all other sperm classes yield ++

progeny. c% 4-loss = 100 x (ci ey progeny)/N. dF = Fertility = progeny per male.

60

TABLE 5

Chromosome 2 NDJ in Z3-3401 and mnm males.

Progenyb Fd

Genotypea bw+ bw b pr Nc #♂♂ 2^2/O 2/2 %NDJe %sis-2f

Z3-5578/+ (C) 3 2 7 12 50 0.24 322.4 0.27 80.0

Z3-5578/GC14 572 1 587 1160 48 21.4 101.0 43.3 0.33

Z3-3298/GC14 434 4 591 1029 46 25.2 110.7 45.0 1.82

Z3-3401/GC14 237 1 416 664 44 15.1 267.9 16.9 0.42

a+/BSYy+; bw/+; Z3/(Df(3R)GC14 or +) males were crossed to C(2)EN, b pr (2^2/O) or y

w (2/2) females. C indicates a control cross. bListed progeny are from 2^2/O crosses.

bw+ and bw progeny result from 22 sperm and O eggs; b pr progeny result from O

sperm and 2^2 eggs. cN= # of progeny scored in 2^2 crosses. dF = progeny per male.

eSee Materials and Methods for procedure for estimating %NDJ. f%sis-2 = % sister

chromatid NDJ/total disomic sperm = 100 x 2(bw)/(bw + bw+).

61

TABLE 6

X-Y NDJ in Z3-3401 males with and without P[hs::MNM-GFP]

Z3 Genotypes P[hs::MNM-GFP]a # heat shocksb % X-Y NDJc Nd

Z3-3401/Z3-3401 None 0 41.8 79

Z3-3401/Z3-3401 Chromosome 2 0 0.13 783

Z3-3401/Z3-3401 Chromosome 2 2 0.17 576

Z3-3401/Df(3R)T16 None 0 36.4 335

Z3-3401/Df(3R)T16 Chromosome 3 0 6.88 523

Z3-3401/Df(3R)T16 Chromosome 3 2 0.72 139

aP[hs::MNM-GFP] is a P element transgene containing a full-length MNM cDNA fused at

its C-terminus to EGFP and driven by the hsp70 promoter (THOMAS et al., 2000).

bMales were exposed to 0 or 2 one-hour heat shocks as larvae. c+/BSYy+ males

carrying the indicated autosomes were crossed to y w females and X-Y NDJ measured

as described in Materials and Methods. dN = total progeny scored.

62

TABLE 7

Fertility, X chromosome NDJ, and X, 2nd and 3rd chromosome recombination

frequencies in Z3-3401, mnm and mod(mdg4)T6 hemizygous females.

Fertility, X recombination & NDJa Map Dist. Map Dist.

Genotype #♀♀ Nb Fc %NDJd pn-y+e cn-bw (N)f st-e (N)g

Z3-3401/+ 68 2860 42.1 0 53.8 33.7(409) 24.6(678)

Z3-3401/GC14h,i 117 330 2.8 0 50.5 39.6(191) 23.3(203)

Z3-5578/+ 40 1768 44.2 0.11 57.2 ND 25.5(588)

Z3-5578/GC14h,i 40 1596 39.9 0 58.1 ND 24.6(821)

Z3-3298/+ 40 1638 40.9 0 55.8 34.8(289) 25.1(855)

Z3-3298/GC14h,i 40 1370 34.3 0 53.4 32.9(451) 22.5(672)

mod(mdg4)T6/+ 22 814 37.0 0.49 ND 33.4(511) 26.2(814)

mod(mdg4)T6/GC14h 20 558 27.9 0.72 ND 37.6(388) 30.0(558)

a y/y pn cv m f . y+ females carrying the indicated 3rd chromosomes were crossed with X-

Y, y B/Y males. bN = # progeny scored. cF = Fertility = N/#♀♀. d %NDJ = 100 x 2 x (B+

females + y B males)/(N + B+ females + y B males). eMap length of pn-y+ interval

expressed in cM. fRecombination frequency in the cn-bw interval on chromosome 2

measured in progeny of cn bw/+ females crossed with cn bw males. gRecombination

frequency in the st-e interval of chromosome 3 measured in progeny of Z3i,

st/Df(3R)T16, e females or mod(mdg4)T6 e/Df(3R)GC14, st females crossed with st e

males. hGC14 = Df(3R)GC14. iDf(3R)T16 was used instead of Df(3R)GC14 in the 3rd

chromosome recombination crosses. ND = not done.

63

TABLE 8

X-Y NDJ in Z3-3401 males with and without [CR-7.5].

Z3 Genotypes [CR-7.5]a % X-Y NDJb Nc

Z3-3401/Z3-3401 None 45.5 591

Z3-3401/Z3-3401 Chromosome 2 31.8 1021

Z3-3401/mod(mdg4)neo129 None 42.4 943

Z3-3401/mod(mdg4)neo129 Chromosome 2 33.4 1212

Z3-3401/Df(3R)T16 None 45.8 738

Z3-3401/Df(3R)T16 Chromosome 2 32.5 499

a [CR-7.5] is a P element transgene containing a 7.5Kb genomic DNA fragment

encompassing all of the common region of mod(mdg4) (BUCHNER et al., 2000).

b+/BSYy+ males carrying the indicated autosomes were crossed to y w females and X-Y

NDJ measured as described in Materials and Methods. cN = total progeny scored.

A

Soltani-Bejnood et al., Fig. 1

3’

02neo129

03 Z3-3401

5’

20 117269324340

B2142∆29142∆49

eGp4

Z3-3298

Z3-5578

T6

B T16 ,

CR-7.5

142∆33142∆10,

1 MADDEQFSLC WNNFNTNLSA GFHESLCRGD LVDVSLAAEG QIVKAHRLVL SVCSPFFRKM

61 FTQMPSNTHA IVFLNNVSHS ALKDLIQFMY CGEVNVKQDA LPAFISTAES LQIKGLTDND324 D

121 PAPQPPQESS PPPAAPHVQQ QQIPAQRVQR HEPRASARYK IETVDDGLGD EKQSTTQIVI

181 QTTAAPQATI VQQQQPQQAA QQIQSQQLQT GTTTTATLVS TNKRSAQRSS LTPASSSAGV

340 Stop

Z3-3401 C

241 KRSKTSTSAN VMDPLDSTTE TGATTTAQLV PQQITVQTSV VSAAEAKLHQ QSPQQVRQEE

301 AEYIDLPMEL PTKSEPDYSE DHGDAAGDAE GTYVEDDTYG DMRYDDSYFT ENEDAGNQTA

361 ANTSGGGVTA TTSKAVVKQQ SQNYSESSFV DTSGDQGNTE AQDLGELNPS NLADFGNESF

421 LPKTKGKRPQ NVRCGLAPDQ KCVRTLDDWD RIRYDRTRSG DVLVYDGYRY DRRANYNDIIZ3-5578 Stop

481 YWGCAKKRLS CNVYMITHKN KPTYVAISGV HNHLZ3-3298 Y

142∆15142∆32

Common Region (CR) Variable Region (VR)

GC14

A

B

Pro

met

apha

seI

Ana

phas

e I

Met

apha

se I

Soltani-Bejnood et al., Fig. 2

C

SpermatidsMetaphase I

Z3-

3401

Wild

type

Prometaphase I Anaphase I Anaphase IIMetaphase II

Late

Pro

phas

e I

Ana

phas

e I

Spe

rmat

ids

Z3-3401/T16Z3-3401/T16 + [hs::MNM-GFP]

Z3-3401Wild type

78.34.66Z3-3298

54.83.16Z3-3401

01.15Wild Type

% Unequal PolesAI + TI

Mean # MI

ClumpsGenotypeD

% Paired (N)Gonia Early PI

Wild Type 64%(42) 74%(35)Z3-3401/T16 72%(11) 84%(59)

Wild Type

Wild Type Z3-3401/T16

Z3-3401/T16

A

B

Soltani-Bejnood et al., Fig. 3

Mean MeanNuc. Diam. Disp. N

Wild Type 17.9±2.7 2.8±0.8 24Z3-3401/T16 17.3±3.6 4.4±2.9 9

Wild Type Z3-3401/T16

Spermatogonia Early prophase I (S2a)

Z3-3401 Z3-3401

WT

WT

Z3-3401 Z3-3401

MNM

MNM

SNM

SNM

A

B

WT

WT

Soltani-Bejnood et al., Fig. 4

Z3-3401A

Mod-C

DNA

Z3-3298 Z3-5578

Mod-C

DNA

Z3-3298 Z3-3401

DNA

Z3-5578B

Tubulin

WT-S3 WT-S1

Tubulin

WT-S5 WT-S4

Merge

Merge

S4/S5

S1

Soltani-Bejnood et al., Fig. 5

MNM-specific exon

m

m

m

m

mm

m

m

m m

Common exons

Z3-5578

Z3-3401

m

Soltani-Bejnood et al., Fig. 6

P1

m

m

Cis-splicingTrans-splicing

Discontinuous

Discontinuous

Continuous

Continuous

P onlyP & R

B

A

m

+

++

+

+

+ +

+

+

+

+

+

130137Total

RNA source & # of cDNAs of each type

C

9 (.07)29 (.21)R2

R: 0.35+/- .08

12 (.09)26 (.19)R1

42 (.32)29 (.21)P2

P: 0.65+/- .08

67 (.52)53 (.39)P1

f(P&R)ControlTrans-het.cDNA

P2

R1

R2

+

+