THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1993 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 268, No. 10, Issue of April 5, pp. 7435-7441,1993 Printed in U.S.A.

Role of Oligosaccharides in the Processing and Function of Human Transferrin Receptors EFFECT OF THE LOSS OF THE THREE N-GLYCOSYL OLIGOSACCHARIDES INDIVIDUALLY OR TOGETHER*

(Received for publication, September 8, 1992)

Bing Yang, Mee H. Hoe$, Penni Black, and Richard C. Hunt8 From the Department of Microbiology and Immumlogy, University of South Carolina School of Medicine, Columbia, South Carolina 29208

When the coding sequence for human transferrin receptors was expressed in a Chinese hamster ovary cell line lacking endogenous transferrin receptors, 86- kDa molecules containing three N-glycosidically linked oligosaccharides were synthesized. These rap- idly dimerized to form 172-kDa molecules which in- creased in size to 190 kDa. After site-directed muta- genesis of all three N-glycosylation sites, 80-kDa receptors were synthesized and only a few dimers were formed. 84-kDa monomers were synthesized in the absence of the oligosaccharide attached to Asn727 or Asn317. Dimerization and maturation through the Golgi body of the Asn727 mutant receptors were much slower than the wild type whereas the Asn3I7 mutant receptors behaved more similarly to the wild type. Lack of the oligosaccharide at AsnZK’ gave rise to 73-kDa mono- mers because of proteolytic processing (Hoe, M. H., and Hunt, R. C. (1992) J. Biol. Chem. 267, 4916-4923), but a second mutation at a potential cleavage site al- lowed the formation of 84-kDa receptors. These also dimerized at a similar rate to wild type receptors. The three-site mutant receptors were degraded in the en- doplasmic reticulum but all three 84-kDa single site mutant receptor species migrated to the cell surface. However, receptors lacking the oligosaccharide at AsnTZ7 bound and internalized little transferrin as a result of reduced affinity.

Human transferrin receptors (hTfRs)’ are initially synthe- sized as 86-kDa monomers that cotranslationally acquire three high mannose N-glycosyl chains in the endoplasmic reticulum (ER). After passage through the Golgi apparatus, complex oligosaccharides containing galactose and sialic acid are formed, thereby increasing the monomer size to 95 kDa (1-3). Shortly after synthesis, the monomers associate by disulfide bridging to give rise to homodimers of 172 kDa in

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Present address: Cell Biology Laboratory, Imperial Cancer Re- search Fund Laboratories, P. 0. Box 123, Lincoln’s Inn Fields, London WC2 3PX, United Kingdom.

§ To whom correspondence should be addressed Dept. of Micro- biology, University of South Carolina Medical School, Columbia, SC 29208. Tel.: 803-733-3218; Fax: 803-733-3192.

The abbreviations used are: hTfRs, human transferrin receptors; CHO, Chinese hamster ovary; ER, endoplasmic reticulum; PAGE,

wt, wild type. polyacrylamide gel electrophoresis; Tf, transferrin; TM, tunicamycin;

the ER that are processed to 190 kDa as a result of complex oligosaccharide formation (3, 4). HTfRs are also post-trans- lationally modified by fatty acylation (51, phosphorylation (6- 8), and 0-glycosylation (9).

The functions of the N-glycosyl chains remain obscure although studies on a variety of receptors using glycosylation inhibitors suggest that they may be involved in folding of the molecule during biosynthesis and can be dispensed with there- after (10,11). The aberrant folding of hTfRs as a consequence of the absence of sugar chains often prohibits export to the cell surface and reduces ligand binding affinity (12,13). Inter- pretation of data derived from glycosylation inhibitor studies, however, carries the caveat that inhibitor-treated cells syn- thesize many other nonglycosylated proteins that may also be misfolded. As a result, the high cellular content of such proteins may obscure the normal fate of individual misfolded nonglycosylated proteins.

In order to address the function of N-glycosylation of hTfRs more specifically, site-directed mutagenesis has been used to abolish the addition of the three oligosaccharides to hTfRs together or individually. The mutated coding sequences were expressed in a line of Chinese hamster ovary (CHO) cells that lacks endogenous hamster transferrin receptors. It was found that loss of all three sugar chains resulted in the retention of mostly monomeric, nonfunctional proteins within the ER where they were rapidly degraded. Loss of the oligosaccharide nearest the C terminus of the protein (attached to resulted in much slower formation of dimers than in wild type (wt) receptors and only low affinity transferrin (Tf) binding was exhibited by the mutant proteins. In contrast, loss of the oligosaccharide a t Asn317 had little effect on hTfR function.

It has been shown previously that loss of the sugar chain attached to AsnZ5l results in site-specific cleavage of the hTfR (14). However, when this cleavage was inhibited by the intro- duction of a second mutation into the molecule, the resulting hTfR lacking glycosylation at AsnZ5l functioned normally.

EXPERIMENTAL PROCEDURES

Construction of a Coding Sequence for an hTfR Lucking Oligosaccharides at AsnZS1. Asn317, and

A 1.4-kb HindIII/XbaI fragment was cut from pCDTR1, a plasmid containing the cDNA for the entire hTfR coding sequence. The 1.4- kb fragment which contains the DNA segment coding for the C- terminal portion of transferrin receptor was inserted into the multiple cloning site of M13mp19 replicative form. Two oligonucleotides were synthesized using an Applied Biosystems oligonucleotide synthesizer. One oligonucleotide with the sequence CAGCGTTTCAGTAAA- AGCACC was used to change the codon for Asn317 to Thr thus

gonucleotide, with the sequence GGAAACTGAGCGTGATT- stopping the addition of oligosaccharides at Asn317. The second oli-

7435

7436 Human Transferrin Receptor Oligosaccharides GAAGG, was used to change the codon for Thrm to Ala thus stopping the addition of N-linked oligosaccharides a t Asn'*'. Site-directed mutagenesis was carried out with both oligonucleotides using the Amersham site-directed mutagenesis system. Mutations were con- firmed by sequencing with Sequenase System Version 2.0 (U. S. Biochemical Corp). After site-directed mutagenesis, the 1.4-kb frag- ment was removed using HindIII and BamHI and ligated to dephos- phorylated BamHI-cut pZipNeoSV(X) together with a 0.9-kb BamHI-Hind111 fragment containing the coding sequence for the N- terminal portion of the hTfR with a mutation that changes the codon for AsnZ6' to Gln (14). A plasmid containing the correct fragments in the correct orientation was selected and verified by restriction endo- nuclease analysis.

Construction of Coding Sequences for hTfRs Lacking One Oligosaccharide

Mutation at AsnS1'-The M13mp19 described above containing a 1.4-kb HindIII/XbaI with mutations at the codons for Asn3" and thr'28 was digested with HindIII and NsiI. The resulting 0.4-kb fragment containing only the A d 1 ' mutation was ligated to pUC19 together with a 1.0-kb NsiIIXbaI fragment of pCDTR1. A 1.4-kb HindIII/BamHI fragment of this construct was ligated to a 0.9-kb BamHI/HindIII fragment of pCDTRl and inserted into BamHI- digested dephosphorylated pZipNeoSV(X).

Mutation at Thr728-A 1.4-kb HindIII/XbaI fragment from pCDTRl was inserted into the multiple cloning site of M13mp19. The oligonucleotide GGAAACTGAGCGTGATTGAAGG was used to change the codon for T h P to Ala. The mutated fragment was removed with BamHI and HindIII and ligated to dephosphorylated BamHI cut pZipNeoSV(X) together with a 0.9-kb BamHI/HindIII fragment from pCDTR1.

Double Mutation at Amm' and G1yBI-A construct containing a 0.9- kb BamHI/HindIII fragment of pCDTRl subcloned into the BamHI cloning site of M13mp8 and mutated to alter the codon for Amm' to Gln has been described (14). Site-directed mutagenesis of this was carried out using the oligomer TGG?TCTACCCT"TACAATA to convert Gly" to Phe. The correct mutagenesis was confirmed by sequencing. The double mutant construct was ligated to a 1.9-kb HindIII/BglII fragment from a partial digest of pCDTR1. The ligated fragments were digested with BamHI and BglII, and the resulting 2.8-kb fragment was inserted into the BamHI cloning site of pZip- NeoSV(X).

Growth and Transfection of TrVb-CHO Cells TrVb-CHO cells were obtained from Dr. T. McGraw (Columbia

University, New York) and grown and transfected as previously described (14).

Metabolic Labeling Cells were washed in basal salts solution (GIBCO) and incubated

in methionine-free minimal essential medium (Flow Laboratories) with 200 pCi of Tran3'S-label (ICN) per ml. After 30 min, the cells were supplemented with complete serum-containing medium aug- mented with 1 ml of 100 X basal medium (Eagle) amino acids (GIBCO) per 100 ml of medium.

Immunoprecipitation and SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE)

These were carried out as previously described (12, 15).

Immunoflwrescence Microscopy Cells were stained using mouse monoclonal OKT9 anti-hTfR an-

tibody and Texas Red rabbit anti-mouse IgG or using a rabbit polyclonal anti-ER antibody (kindly given by Dr. D. Meyer) and fluorescein isothiocyanate-labeled goat anti-rabbit IgG. For cell sur- face staining, cells were fixed in 2% paraformaldehyde in Sorrensen's buffer, while for staining of internal components cells were perme- abilized in methanol/acetone (1:l) at 4 "C for 5 min. The cells were viewed using a Bio-Rad MRC600 confocal microscope system.

Memurement of Relative Expression Levels of hTfRs on Transfected Cells

Cells expressing mutant or w t hTfRa were permeabilized and fixed in methanol-acetone and stained with OKT9 anti-hTfR monoclonal antibody or a polyclonal anti-hTfR antibody to determine the to t a l receptors in the cells. The antibodies were detected using an FITC-

conjugated second antibody. The degree of staining was assessed by anchored cell cytometry using an ACAS 570 cytometer (Meridian Instruments).

RESULTS

Size and Dimerization of Wild Type and Mutant hTfRs- Transferrin receptor-deficient CHO cells were transfected with a plasmid containing the coding sequence for the entire wt hTfR. The receptors expressed by these cells migrated to the cell surface where they functioned normally in Tf uptake (14). 86-kDa hTfRs were synthesized when the transfected cells were labeled with Tran3'SS-label for 30 min, and anti- hTfR immunoprecipitates were analyzed by SDS-PAGE un- der reducing conditions (Fig. 1, p a n e l A: lane I ). Pulse-chase analysis showed that the wild type receptors increased in size to 95 kDa over a period of 60 min (Fig. 1, p a n e l A ) reflecting passage from the ER to t h e Golgi body (1, 12, 14). In experi- ments in which the chase periods extended up to 24 h, the half-life of t h e wt receptors in CHO cells was found to be about 20 h (data not shown).

80-kDa hTfRs were synthesized by cells expressing an hTfR coding sequence that had been mutated to abolish N-glyco- sylation at all three sites (Fig. 1, p a n e l R: lane I) . This size is similar to hTfRs synthesized by human cells incubated with tunicamycin (TM) (12,13), an N-glycosylation inhibitor (16), and is consistent with the protein sequence (17, 18). Pulse- chase analysis of the hTfRs of these cells showed no increase in size over a period of 2 h, but a marked loss of radioactivity from the hTfRs was observed with longer periods of incuba- tion (Fig. 1,panel B ) suggesting that the pulse-labeled protein was being degraded. Densitometry of an autoradiogram such as that in Fig. 1B indicated a half-life of approximately 3 h for the mutant receptors. This apparent instability could be artifactual. For example, loss of labeled protein in the im- munoprecipitates could result from a conformational change in t he receptors with time so that they were no longer recog- nized by the monoclonal anti-hTfR antibody that was used in these experiments. It is also possible tha t t he mu tan t receptors might not be extractable at the detergent concen- trations used. However, when the experiment was repeated with a polyclonal anti-hTfR antibody or after extraction in solutions containing a higher concentration of detergent, the same results were obtained (data not shown).

Analysis of immunoprecipitated hTfRs under nonreducing conditions showed that wt receptors formed homodimers rap- idly with only a minority of 86-kDa monomers at the end of the pulse labeling period (Fig. 2 A , lane 1 ) . After 60 min of chase, almost all the receptors had formed 190-kDa dimers

A B

- 80

1 2 3 4 5 1 2 3 4 5 FIG. 1. An hTfR mutant protein that lachs three oligosae-

charides forms an 80-kDa protein that doen not increase in size and is degraded. CHO cells expressing wt ( p n e l A ) or mutant ( p a n e l B) hTfRs were labeled for 30 min with Tran-S-label and chased for 0 (lanes I ) , 15 (lanes 2 ) , 30 (lones 3). 60 (lones 4 ) , or 120 min (lanes 5 ) . The hTfRs were immunoprecipitated and analyzed under reducing conditions. The size (in kDa) of the various bands is indicated.

Human Transferrin Receptor Oligosaccharides 7437

(Fig. 24, lane 2) indicative of their passage through the Golgi body. In contrast, the vast majority of nonglycosylated hTfRs retained a size of 80 kDa throughout the chase period although a small proportion of mutant 160-kDa hTfRs was observed (Fig. 2B, lanes 1-5).

To determine whether there was any difference in the stability of the mutant monomers compared to the minority of mutant receptors that formed dimers, analysis under non- reducing conditions was carried out after longer chase periods. After 8 h of chase, the majority of the monomers had disap- peared with a half-life of about 3 h. However, the 160-kDa dimers appeared much more stable (Fig. 2C).

After site-directed mutagenesis to abolish N-glycosylation of hTfRs at Asn3", the transfected cells expressed 84-kDa hTfRs as detected by SDS-PAGE analysis under reducing conditions. With longer times of incubation, these receptors increased in size to 91 kDa (Fig. 3A). Analysis under nonre- ducing conditions showed that the rate of dimerization was a little slower than wt receptors (Fig. 3B) .

When N-glycosylation a t was abolished, again an 84-kDa hTfR species was observed when immunoprecipitates were analyzed under reducing conditions (Fig. 3C, lane 1 ). Upon longer incubation times, these receptors also increased in size to 91 kDa (Fig. 3C). Analysis under nonreducing

A 190 1 7 3

6 C

e m 88.

1 2 3 4 1 2 3 4 5 1 2 3 4

FW. 2. Mutant hTfRs lacking three oligosaccharides mostly fail to dimerize. Panel A, CHO cells expressing wt hTfRs were labeled for 30 min in TranWS-label and chased for 0 ( l a n e I ), 30 ( l a n e 2) , 60 ( l a n e 3), or 120 min ( l a n e 4 ) . Panel B, CHO cells expressing mutant hTfRs were labeled and chased for 0 ( l a n e I), 15 ( l a n e 2) , 30 ( l a n e 3), 60 ( l a n e 4) , or 120 min ( l a n e 5). Panel C, similarly labeled mutant cells were chased for 0 ( l a n e I), 2 ( l a n e 2) , 4 ( l a n e 3), and 8 h ( l a n e 4) . The hTfRs were immunoprecipitated and analyzed under nonreducing conditions. The positions of the 86-kDa monomers and the 172- and 190-kDa dimers are shown for the wt receptors. The positions of the mutant 80-kDa monomers and 160-kDa dimers are indicated by rn and d , respectively.

A B

conditions showed that dimerization was much slower than that of the wt hTfRs with about half of the mutant receptors still as monomers after 30 min of chase (Fig. 3 0 , lane 3).

Comparison of the rate at which 91-kDa receptors appear in cells expressing hTfRs lacking the oligosaccharide a t Am'*' or a t AS^"^ (Fig. 3, panels A and C ) with the rate at which 95-kDa hTfRs are made by cells expressing wt receptors (Fig. 1, panel A ) shows that the form of the receptor containing complex oligosaccharides is generated more slowly when one sugar chain is lost. This probably reflects slower migration from the ER to the Golgi apparatus.

Site-specific Cleauage Occurs When the Olifosaccharide Nearest the Trammembrane Domain Is Lost but This Can Re Inhibited by a Second Mutation Close to the Transmembrane Domain--Loss of the sugar chain at Am2"' has previously been shown (14) to result in rapid cleavage of the mutant hTfR so that the receptors have a size of 73 kDa (Fig. 44, lane 3). These molecules fail to dimerize and are degraded intracellularly with a half-life of about 1 h (14). The properties of the mutant receptor suggest that the 73-kDa polypeptide represents the extracellular domain of normal h T R s a n d imply a site-specific cleavage close to the lumenal surface of the ER membrane. There is, indeed, a cryptic signal protease consensus site near the transmembrane domain in the pri- mary sequence of the hTfR (17, 18). Although there is no evidence that this is in fact the site of cleavage, a second amino acid change was introduced into this region in an attempt to prohibit proteolysis. In this way it would be pos- sible to determine the effect of loss of the sugar chain at Ams1 without the subsequent loss of the protein that nor- mally occurs. In fact, the second mutation did result in the 84-kDa hTfR species that would be expected from the loss of one sugar chain in the absence of proteolytic cleavage (Fig. 4A, lane 1) . This protein dimerized to 168 kDa and matured to 182 kDa in the Golgi body (Fig. 4R, euen numbered lanes) with similar kinetics to w t receptors (Fig. 4R, odd numbered l a n f ? S ) .

Mutant hTfRs Lacking All Three Oligosaccharides Were Retained in the ER and CouM Not Be Detected on the Cell Surface-When cells expressing w t hTfRs were permeabilized and labeled with an anti-hTfR antibody, the receptors were found by confocal fluorescence microscopy to be located in a punctate pattern throughout the cytoplasm with a major coalescence of the receptors in a juxtanuclear region (Fig.

C D

1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5

FIG. 3. Pulse-chase analysis of hTIRe lacking an oligosaccharide at either Am"' or Amn'. Panel A, HTfRB lacking the sugar chain at Asn3" form 84-kDa hTfRs that increase in size to 91 kDa. CHO cells expressing the mutant hTfR were labeled for 30 min with Tran"S-label and chased for 0 ( l a n e I), 15 ( l a n e 2),30 ( l a n e 3), 60 ( l a n e 4 ) , or 120 min ( l a n e 5 ) . The receptors were immunoprecipitated and analyzed by SDS-PAGE under reducing conditions. The positions of the 84-kDa high mannose mutant hTfRs and the 91-kDa complex oligosaccharide-containing hTfRs are shown. Panel B, HTfRs lacking the sugar chain at Asn3" dimerize rapidly. The immunoprecipitates from cells treated as in panel A were analyzed under nonreducing conditions. The position of the dimeric hTfRs is indicated (d ) . Panel C. HTfRs lacking the sugar chain at Asn7*? form 84-kDa hTfRs that increase in size to 91 kDa. CHO cells expressing the mutant hTfR were labeled for 30 min with TranWS-label and chased for 0 ( l a n e I), 15 ( l a n e 2), 30 ( l a n e 3), 60 ( l a n e 4 ) or 120 min ( l a n e 5 ) . The receptors were immunoprecipitated and analyzed by SDS-PAGE under reducing conditions. The positions of the 84-kDa high mannose mutant hTfRn and the 91-kDa complex oligosaccharide-containing hTfRs are shown. Panel D, HTfRs lacking the sugar chain at dimerize much more slowly. The immunoprecipitates from cells treated as in pane l C were analyzed under nonreducing conditions. The position of the dimeric hTfRs is indicated by d. The position of the M-kDa monomers is also shown.

7438 Human Transferrin Receptor Oligosaccharides

A B

1 2 3 4 1 2 3 4 5 FIG. 4. In the abeence of peptide cleavage, 84-kDa hTfRa

lacking the oligosaccharide at Asn'" are formed that behave similarly to wt receptors. Panel A, cells were labeled for 30 min with Tran"S-label. HTfRs were immunoprecipitated and analyzed by SDS-PAGE under reducing conditions. Lane 1 , cells expressing hTfRa that lack an oligosaccharide at Asn"' and are mutated at Gly" in which 84-kDa proteins are formed. Lane 2, cells expressing 86-kDa wt hTfRs. Lune 3, cells expressing hTfRa that lack an oligosaccharide at Asn"' in which 73-kDa proteins are formed. Lane 4, untransfected cells. Panel B, cells expressing w t hTfRs or hTfRs lacking the oligosaccharide at AsnZ6' and with a conversion of Gly" to Phe were pulse labeled for 30 min with Tran=S-label and chased for various periods of time. HTfRs were immunoprecipitated and analyzed under nonreducing conditions. Lanes 1 and 2, no chase; lanes 3 and 4, 30- min chase; lanes 5 and 6,6O-min chase; lanes 7 and 8,120-min chase. Odd numbered lanes, cells expressing wt hTfRs. Even numbered lanes, cells expressing mutant hTfRs.

5A). This staining was clearly different from the reticular pattern observed when similarly transfected cells were stained with an anti-ER antibody (Fig. 5B). Staining of these cells without permeabilization revealed a punctate pattern of hTfRs on the cell surface (Fig. 5C) which probably represents clustering into clathrin-coated pits.

In contrast to the cells expressing wt receptors, no surface fluorescence could be detected on nonpermeabilized cells ex- pressing the mutant receptors lacking all three oligosaccha- rides (Fig. 50). After permeabilization, hTfRs were located in a reticular structure (Fig. 5E) which was similar to the morphology of the ER in these cells (Fig. 5F). In contrast to these staining patterns, the parental untransfected cell line showed no reaction with the anti-hTfR antibody (data not shown).

Single Site Mutant hTfRs Are Distributed in the Cell in a Manner Similar to Wt hTfRs-Staining of cells expressing hTfRs lacking the oligosaccharide at or Asn317 showed punctate surface fluorescence (data not shown) indicating migration of the receptor to the plasma membrane. In per- meabilized cells, hTfRs were distributed in a similar manner to those in cells expressing wt hTfRs with punctate fluores- cence throughout the cytoplasm and, again, a coalescence near the nucleus (compare Fig. 6, panels C and D with Fig. 5, p a n e l A).

HTfRs containing only the Am"' mutation were retained in the ER (14) and showed a characteristic reticular pattern of staining with anti-hTfR antibody (Fig. 6A). In contrast, those that lack the sugar chain at A S P 1 and had been mutated at a second site to stop rapid cleavage were distributed in transfected cells in a manner very similar to the wt receptors (Fig. 6B ).

The hTfRs That Lack Three Oligosaccharides Do Not Bind Tf-In order to determine whether the intracellular mutant

hTfRs lacking all three sugar chains were capable of binding Tf, cells expressing these proteins were dissolved in a Triton X-100-containing solution and the extract incubated with '%I- labeled Tf at 4 T. The receptor-ligand complexes were then immunoprecipitated with an anti-hTfR antibody. Wt recep- tors bound the radiolabeled Tf which was identified by SDS- PAGE, and the binding was abolished in the presence of a 1000-fold excess of unlabeled Tf (Fig. 7, lanes I and 2). However, no binding of labeled Tf to hTfRs in extracts of cells expressing the mutant receptors was seen (Fig. 7, lanes 3 and 4 ) .

Cells Expressing hTfRs Lacking the Oligosaccharide Nearest the C Terminus Internalize Reduced Amounts of Tf While the Other Single Site Mutant hTfRs Internalize Tf Normally- Since the mutant 84-kDa hTfRs lacking the oligosaccharides at Asn317, or Ams1 all reach the cell surface they have the potential to participate in Tf uptake. Incubation of cells expressing these proteins with lm1-Tf for various periods of time showed specific uptake of the labeled ligand but to different extents.

Cells expressing the uncleaved Asn"' mutant protein take up '%I-Tf to about the same extent as those expressing wt receptors (Fig. 8, top panel) and bind Tf with a similar affinity (Fig. 9), whereas cells expressing the mutant protein take up the ligand to a lesser extent (Fig. 8. bottom panel). However, fluorescence cytometry showed that this probably reflects the smaller total expression of mutant hTfRs ex- pressed by transfected cells since those expressing the A S P mutant receptors bound an anti-hTfR antibody at approxi- mately 60% of the level of cells expressing wt hTfRs (data not shown).

Cells expressing mutant hTfRs also took up '"I-Tf specifically but only to about 11% of the extent of cells expressing wt hTfRs. This could not be explained by lower expression levels of the mutant hTfRs since fluorescence cytometry suggested that the cells expressed the mutant hTfRs at approximately 55% of the level of the expression of w t hTfRs (data not shown).

Scatchard analysis of the binding of '"I-Tf to cells express- ing Asn7*' mutant hTfRs was carried out in order to determine whether a reduction in the affinity of the receptor for its ligand might be the explanation of the reduced uptake. These studies showed that binding by the mutant receptors was of low affinity (Fig. 9).

DISCUSSION

The roles of the oligosaccharide chains attached to cell surface and secreted proteins remain obscure, but it seems that in some cases they play little part in the function of the final product (10.11). Instead, they often appear to participate in the generation of the correct conformation of a protein during and soon after synthesis in the ER. In some instances, proteins that lack sugar chains remain as monomers (13) or form oligomers only slowly (12) but, in others, aberrant cross- linking occurs so that the deglycosylated proteins assume insoluble disulfide-bridged aggregates (19-21) that appear unable to escape from the ER.

A role for N-linked oligosaccharides in protein folding during hTfR biosynthesis has also been inferred from studies with TM. Inhibition of N-glycosylation slows (12) or abolishes (13) dimerization, implying failure of the monomers to asso- ciate with the correct interchain disulfide bonds and also slows or abolishes migration of hTfRs to the cell surface (12, 13). In instances where nonglycosylated h T m do get to the cell surface, they exhibit a greatly reduced affinity for Tf (121,

Human Transferrin Receptor Oligosaccharides 7439

FIG. 5. HTfRs lacking three oli- gosaccharides are retained in the ER. Cells expressing wt or nonglycosy- lated hTfRs were either permeabilized by fixation in methanol/acetone (1:1) or fixed without permeabilization with par- aformaldehyde. They were then labeled with either OKT9 anti-hTfR mono- clonal antibody or with a polyclonal anti- ER antibody. The primary antibodies were detected with Texas Red anti- mouse IgG or FITC anti-rabbit IgG. Panel A, permeabilized wt hTfFt-ex- pressing cells, stained for hTfRs. Panel B, permeabilized wt hTfR-expressing cells stained with an anti-ER antibody (the same cells are shown using double fluorescence staining in panels A and E ) . Panel C, intact wt hTfR-expressing cells stained for hTfRs. Panel D, intact cells expressing nonglycosylated hTfRs stained for hTfRs. Panel E, permeabil- ized cells expressing nonglycosylated hTfRs stained for hTfRs. Panel F, per- meabilized cells expressing nonglycosy- lated hTfRs stained with an anti-ER antibody.

FIG. 6. The distribution of hTfRs in cells expressing single site mu- tant hTfRs. Cells expressing single site mutant hTfRs were fixed, perrneabilized, and incubated with OKT9 anti-hTfR monoclonal antibody. The latter was de- tected using Texas Red-conjugated goat anti-mouse I&. Panel A. cells express- ing 73-kDa cleaved hTfRs that lack the oligosaccharide a t Asn’”. Panel R, cell expressing 84/91-kDa hTfRs that lack the oligosaccharide a t Asn’’” and that also have a conversion of GI?’ to Phe. Panel C, cells expressing 84/91-kDa hTfRs that lack the oligosaccharide a t Asn”’?. Panel D, cells expressing R4/91- kDa h T R s t h a t lack the oligosaccharide a t AS^"^.

implying a conformational change that results in a misfolded ligand-binding site.

The use of glycosylation inhibitors such as TM. however, is fraught with problems since the drug is not specific to the molecules under study, and the many nonglycosylated pro- teins that are produced are likely to overwhelm the normal protein-editing machinery of the ER. In addition, TM treat- ment greatly enhances the production of proteins that bind

misfolded proteins such as the immunoglobulin heavy chain- binding protein, BiP (22). Such profound changes in protein synthesis could greatly influence the synthesis and handling of other proteins.

Because of the difficulties inherent in the lack of specificity of glycosylation inhibitors, site-directed mutagenesis offers a more restricted means of altering N-glycosylation of a partic- ular glycoprotein so that only one protein exhibits a changed

7440 Human Transferrin Receptor Oligosaccharides

TF

1 2 3 4 FIG. 7. HTfRs lacking three oligosaccharides do not bind

Tf. Cells expressing wt (lanes I and 2) or mutant (lanes 3 and 4 ) hTfRs were dissolved and the extracts incubated with '"I-Tf without (lanes I and 3 ) or with (lanes 2 and 4 ) excess unlabeled Tf. Immu- noprecipitates were prepared using OKT9 anti-hTfR antibody and protein A-agarose, and the bound proteins were analyzed by SDS- PAGE. The '"I-Tf band is indicated.

? d w

- A 0 20 40 60 00 100 120

66

L 40 t

0 0 20 40 60 00 100 120

time (minutes) FIG. 8. Uptake of ""I-Tf by cells expressing wt and mutant

hTfRs. Cells were incubated with '"I-Tf for various periods of time. Nonspecific binding was determined by parallel incubations with excess unlabeled Tf and subtracted from total uptake. The bars show the range of duplicate determinations where the range was greater than the size of the symbols. Top panel: 0, wt hTfRs. V, HTfRa lacking the oligosaccharide at Amm1 and carrying the Gly" to Phe conversion. A, untransfected CHO cells. Bottom panel: 0, w t hTfRs. A, HTfrs lacking the oligosaccharide at Asn317. 0, HTfRa lacking the oligosaccharide at

glycosylation pattern. Moreover, site-directed mutagenesis allows the abolition of glycosylation a t selected sites in gly- coproteins that bear multiple oligosaccharides.

When hTfRs lose all three N-linked oligosaccharides, they mostly fail to dimerize and appear to be retained in the ER. Here they are broken down rapidly by a mechanism that is not affected by agents that are known to inhibit lysosomal proteolysis (data not shown). This is probably similar to the ER-associated degradation mechanism of certain peptide

1.00 I

0.80

0.60

0.40

0.20

0.00 0 10 20 3 0 40 SO

ng bound/million cells FIG. 9. Scatchard analysis of the binding of "%TI to wt

and mutant hTfRs. Cells were incubated with various amounts of '"1-Tf at 4 'C and the specific binding subjected to Scatchard analy- sis. 0, wt hTfRs. A, HTfRa lacking the oligosaccharide at Asn*" and bearing a second mutation at Cly". 0. HTfRs lacking an oligosac- charide at AS^'^'.

chains in T cell receptors and asialoglycoprotein receptors

In contrast to the loss of all three sugar chains, the loss of the individual sugar chain a t close to the C terminus of the molecule, does not result in degradation. Instead the mutant receptors migrate normally to the cell surface and become internalized. Other aspects of receptor function are, however, affected since dimerization is slowed, and high affin- ity ligand binding is abolished suggesting that loss of this oligosaccharide alters the conformation of the molecule in- cluding both the ligand-binding site and the region involved in dimerization. Normally, dimerization occurs rapidly and post-translationally in the ER so that two interchain disulfide bridges are formed between cysteines 89 and 98 very close to the transmembrane domain (4). Thus, the results with hTfRs lacking the sugar chain a t Asn7*' indicate that a conforma- tional change at the ligand-binding site near the C terminus of the molecule also affects the region of the molecule very close to the ER membrane. In contrast, the loss of a sugar chain at Am3", which is much closer to the residues involved in dimerization, has very little effect on disulfide bridge formation or ligand binding.

When an hTfR-coding sequence is constructed such that the oligosaccharide a t Asn'" fails to be added, a very different result occurs on expression in CHO cells. In this instance, there are two proteolytic events (14). First, a rapid, site- specific cleavage occurs close to the transmembrane sequence which is followed by complete and rapid proteolysis of the remaining hTfR. It appears that the initial specific proteolysis yields a 73-kDa extracellular domain implying a cleavage site near the lumenal surface of the ER membrane. Here, as in several other class I1 membrane proteins (26, 27), is a cryptic signal protease consensus sequence (28) that can become patent when mutations that affect conformation are intro- duced into the polypeptide (27). The signal protease consensus sequence consists of three amino acids. The outer amino acids must be small and are often alanine, glycine, or cysteine whereas the middle residue can be almost any amino acid (28). A change of either small amino acid to a large one (such as phenylalanine) is likely to disrupt the consensus sequence and, indeed, when a second mutation that converted Cly@' to Phe was introduced into the construct with an alteration at ASP', no proteolysis was seen and an M-kDa hTfR was synthesized. This double mutant hTfR behaved in a very similar manner to w t receptors. It therefore seems that the

(23-25).

Human Transferrin Receptor Oligosaccharides 7441

oligosaccharide at is unnecessary for dimerization, ligand binding, or internalization. Rather, it protects a region of the molecule that would otherwise be available for proteo- lytic cleavage and which may be exposed in misfolded recep- tors.

While this work was proceeding, Williams and Enns (29) reported the results of site-directed mutagenesis of the three sugar chains of the hTfR expressed in mouse 3T3 cells. They showed that the mutant receptors failed to dimerize as rapidly as the wt receptors (although to a greater extent than the mutant receptors in the TrVb-CHO cells described here) and failed, for the most part, to reach the cell surface. These results, although similar to those reported in the present paper, were compromised by the fact that the 3T3 cells expressed wt mouse transferrin receptors. This resulted not only in the formation of mouse homodimers but heterodimers of mutant hTfRs and wt mouse receptors. The formation of the latter could well have affected the behavior of the mutant hTfR dimers and, moreover, hTfR bands observed under reducing conditions were undoubtedly partly derived from these heterodimers.

Acknowledgments-We thank Dr. T. McGraw (Columbia Univer- sity, New York) for the CHO-TrVb cells, Dr. F. Ruddle (Yale Uni- versity, New Haven, CT) for pCDTR1, Dr. R. Mulligan (Whitehead Institute, Cambridge, MA) for pZipNeoSV(X), and Dr. D. Meyer (University of California, Los Angeles) for an anti-ER antibody.

REFERENCES 1. Omary, M. B., and Trowbridge, I. S. (1981) J. Biol. Chem. 256 , 12888-

12892

2. Hanover, J. A,, and Dickson, R. B. (1985) in Endocytosis (Pastan, I., and

3. Schneider. C.. Sutherland. R.. Newman. R.. and Greaves. M. (1982) J. Biol. Willingham, M. C., e&) pp. 131-161, Plenum Press, New York

Chem. 267,8516-8522' '

. .

4. Jing, S., and Trowbridge, I. S. (1987) EMBO J. 6 , 327-331

6. Zerial, M., Suomalainen, M., Zanetti-Schneider, M., Schneider, C., and 5. Jing, S., and Trowbridge, I. S. (1990) J. Biol. Chem. 265,11555-11559

7. Davis, R. J., Johnson, G. L., Kelleher, D. J., Anderson, J. K., Mole, J. E.,

8. McGraw, T. E., Dunn, K. W., and Maxfield, F. R. (1988) J. Cell Biol. 106 ,

9. Do, S-I., Enns, C., and Cummings, R. D. (1990) J. Biol. Chem. 2 6 5 , 114-

Garoff, H. (1987) EMBO J. 6,2661-2667

and Czech, M. P. (1984) J. Biol. Chem. 261,9034-9041

1061-1066

125 10. Olson, T. S., and Lane, M. D. (1987) J. Biol. Chem. 262,6816-6822 11. Slieker, L. J., Martensen, T. M., and Lane, M. D. (1986) J. Biol. Chem.

12. Hunt, R. C., Riegler, R., and Davis, A. A. (1989) J. Biol. Chem. 264,9643-

13. Reckhow, C. L., and Enns, C. A. (1988) J. Biol. Chem. 2 6 3 , 7297-7301 14. Hoe, M. H., and Hunt, R. C. (1992) J. Biol. Chem. 267,4916-4923 15. Hunt, R. C., Ruffin, R., and Yang, Y-S. (1984) J. Biol. Chem. 259,9944-

16. Tkacz, J. S., and Lampen, J. 0. (1975) Biochim. Biophys. Acta 65,248-257 17. Schneider, C., Owen, M. J., Banville, D., and Williams, J. G. (1984) Nature

18. McClelland, A,, Kuhn, L. C., and Ruddle, F. H. (1984) Cell 39,267-274

20. Hurtley, S. M., Bole, D. G., Hoover-Litty, H., Helenius, A., and Copeland, 19. Machamer, C. E., and Rose, J. K. (1988) J. Biol. Chem. 263,5955-5960

21. Marquardt, T., and Helenius, A. (1992) J. Cell Biol. 117,505-513 22. Haas, I. G., and Wable, M. (1983) Nature 306,387-389 23. Amara, J. F., Lederkremer, G., and Lodish, H. F. (1989) J. Cell Biol. 109,

24. Lippincott-Schwartz, J., Bonifacino, J. S., Yuan, L. C., and Klausner, R.

25. Chen, C., Bonifacino, J. S., Yuan, L. C., and Klausner, R. D. (1988) J. Cell

26. Schmid, S. R., and Spiess, M. (1988) J. Biol. Chem. 263 , 16886-16891 27. Lipp, J., and Dobberstein, B. (1986) Cell 4 6 , 1103-1112 28. von Heijne, G. (1987) Sequence Analysis in Molecular Biology: Treasure

29. Williams, A. M., and Enns, C. A. (1991) J. Biol. Chem. 266,17648-17654

261,15233-15241

9648

9952

311,675-678

C. S. (1989) J. Cell Biol. 108,2117-2126

3315-3324

D. (1988) Cell 54,209-220

Biol. 107,2149-2161

Trove or Trivial Pursuit, Academic Press, New York