RNA Structure Date: 1/9/06 Day A Objectives Identify the role of RNA Compare RNA with DNA.

10
RNA Structure Date: 1/9/06 Day A Objectives Identify the role of RNA Compare RNA with DNA

Transcript of RNA Structure Date: 1/9/06 Day A Objectives Identify the role of RNA Compare RNA with DNA.

Page 1: RNA Structure Date: 1/9/06 Day A Objectives Identify the role of RNA Compare RNA with DNA.

RNA Structure

Date: 1/9/06Day AObjectivesIdentify the role of RNACompare RNA with DNA

Page 2: RNA Structure Date: 1/9/06 Day A Objectives Identify the role of RNA Compare RNA with DNA.

DNA Decoding

RNA is made up of four components– 1. Phosphate– 2. Sugar (Ribose, not Deoxyribose)– 3. Nitrogen Bases (A, U, C, G-

instead of having Thymine RNA contains Uracil

– 4. Hydrogen bonds between the two nucleotides

Page 3: RNA Structure Date: 1/9/06 Day A Objectives Identify the role of RNA Compare RNA with DNA.

RNA Structure

RNA is called Ribonucleic AcidRNA is the principle molecule that carries out the instructions coded in DNA RNA is considered a macromoleculeRNA has three different types:– 1. mRNA (messenger RNA- mailman)– 2. rRNA (ribosomal RNA- the factory)– 3. tRNA (transfer RNA- deliveryman)

Page 4: RNA Structure Date: 1/9/06 Day A Objectives Identify the role of RNA Compare RNA with DNA.

Comparing DNA with RNA

DNADeoxyribonucleic AcidDeoxyribose SugarUses thymine (A=T, C=G)Only found in nucleusOne typeMaster copy

RNARibonucleic AcidRibose SugarUses Uracil (A=U, C=G)Can move from nucleus to cytoplasmThree types (mRNA, rRNA, tRNA)Blueprint

Page 5: RNA Structure Date: 1/9/06 Day A Objectives Identify the role of RNA Compare RNA with DNA.

Forms Of RNAmRNA rRNA tRNA

Name Messenger RNA

Ribosomal RNA

Transfer RNA

Role Transcribes the DNA into RNA by

changing the T into U everything else is the

same

Are the proteins where the assembly of the amino acids

takes place

The delivery man who brings the

proper amino acids for the sequences of

RNA

Found In Cell Nucleus/ cytoplasm

Cytoplasm Cytoplasm

Nickname mailman factory Delivery man

Page 6: RNA Structure Date: 1/9/06 Day A Objectives Identify the role of RNA Compare RNA with DNA.

Transcription

Transcription: Is the process by which RNA is made– In transcription part of the nucleotide

sequence of DNA molecule is copied into RNA• DNA acts as template for RNA, • A template is a pattern, or guide, from

which a copy can be made

– MAJOR COMPONENT• RNA Polymerase

Page 7: RNA Structure Date: 1/9/06 Day A Objectives Identify the role of RNA Compare RNA with DNA.

RNA Polymerase

Is an enzyme the binds directly to a molecule of DNARNA Polymerase produces a strand of RNA– One nucleotide at a time– RNA turns all T U– Example: AACT – UUGA– It gives it its complementary pair

without the T’s

Page 8: RNA Structure Date: 1/9/06 Day A Objectives Identify the role of RNA Compare RNA with DNA.

RNA Polymerase

Example #2

DNA strand , give the complementary strand

AATCGGCATTACGAACTACCGA

TTAGCCGTAATGCTTGATGGCT

From the Original Strand give the RNA

UUAGCCGUAAUGCUUGAUGGCU

So RNA is the some pattern as the complementary strand with T replacing U

Page 9: RNA Structure Date: 1/9/06 Day A Objectives Identify the role of RNA Compare RNA with DNA.

RNA as a Message

First, single sequence in DNA may be copied again and againSecond, by making RNA, the cell is able to keep its DNA in reserve controlling access to it and carefully regulating its use an dreplication

Page 10: RNA Structure Date: 1/9/06 Day A Objectives Identify the role of RNA Compare RNA with DNA.

QUIZ

Original Strand:CGCCTGACTAGGACATACGGGComplementary Strand:?RNA strand: ?AnswerComplementary Strand: GCGGACTGATCCTGTATGCCCRNA Strand: GCGGACUGAUCCUGUAUGCCC