RNA-seq: analysis of raw data and preprocessing - part 2

Raw data investigation

Joachim Jacob20 and 27 January 2014

This presentation is available under the Creative Commons Attribution-ShareAlike 3.0 Unported License. Please refer to http://www.bits.vib.be/ if you use this presentation or parts hereof.

http://www.bits.vib.be/

Experimental setup

We have decided on:● how many samples per condition● how deep

This determines how reliable the statistics will be, using experience, and tools like Scotty. A wrong experimental design cannot be fixed. Best approach: pilot data (3 samples per condition, 10M)

But we have other sequencing options to choose!

PE versus SE Illumina

● Single end (SE): from each cDNA fragment only one end is read.

● Paired end (PE): the cDNA fragment is read from both ends.

Purify and fragment

PE

SE

PE versus SE Illumina

Single end (SE):

● Gene level differential expression

Paired end (PE):

● Novel splice junction detection

● De novo assembly of transcriptome

● Helps with correctly positioning reads on the reference genome sequence.

Note: PE not the same as mate pairs.

Strandedness

● Naive protocols obtain reads from cDNA fragments. BUT the link with the sense or antisense strand is broken.

● Stranded protocols generate reads from one strand, corresponding to the sense or antisense strand (depending on the protocol).

Strandedness

Not strandedStranded

Example of a stranded protocol

● dUTP protocol to generate stranded reads.

Importance of strandedness

● Strandedness can bias the read counts compared to non-stranded protocols.

● Depends on the genome whether you should apply it, e.g. in case genes overlap, the improved benefit of assigning reads to correct genes can outweigh technical variation.

Length of the reads

● Does not matter so much (when we want to quantify aligning to a reference sequence): 50 bp will do.

● The most important point is to be able to accurately position the read on the reference genome sequence, to assign it to the correct gene.

● Length can become important, if you want to assemble the transcriptome.

For DE on the gene level

The 'cheapest' protocol for high-throughput sequencing suffices to achieve DE detection:● SE● 50bp● Option: strandedness.

Use the money you have left over for increasing the number of replicates.

Illumina Truseq protocol

sdf

Raw Illumina data

The data you get arrives as...

barcode

experiment

Compressed, usually with gzip

Raw Illumina data

@HWI-ST571:202:D1B86ACXX:2:1102:1146:2155 1:N:0:ACAGTG

CCAACATCGAGGTCGCAATCTTTTTNANCGATATGAACTCTCCAAAAAAA

+

@@@FFFDFHHDG?FFHIIJJJJJIJ#1#1:BFFIGJJJJJIJJGIJJJJA


CGGAGCTGAAGGAGAAACTGAAATCCCTGCAATGTGAATTGTACGTTCTT

+

CCCFFFFFGGHHHIJJJJJJJIJFHIJIIIJJJJGIIIIIEFGHIFCHJI


GTTGGCAGCCCTGGAGCCCTGCCTCGGTGGTTTAGCCAGTACTAGGGGAT

+

CCCFFFFFHHHHHJJJIJJJJJJGIJJCGHFHIGIHJJJBDHGHHJJJIE


ATTTCCTCTTATTTACGTTGCTTTAAAGCGAGACTTCAACGCCATTTGAC

+

@@CFFFFFHHFHDFGHIJIIJGIJGGEHGGJB>??FHHGFFFGHIGIECF


CATCGAAGCAAAGCATATAAAGTTANTNNTNNCTGAGTTGTACATATTGC

+

??;;D?DB6CDB+<EFE>:AFA443#2##1##11)0:0?9**0??DAGI4


GAAGTGCCCCGCTGGCAGCACACAAGGAGCAGCCCGCTGCCGGACCACTC

+

?@@DDDADFFAA:CEGHBFGAHGD?F@BE9BFF?D@F;'-8AG<B92=;;

One read (minimum 4 lines)

http://wiki.bits.vib.be/index.php/.fastq

sequence

certainty reading this base at this position ('quality')

(this one: 87196924 lines)


Exploring the raw data

1) check whether the Fastq file is consistent-

2) Make graphs of some metrics of the raw data


http://wiki.bits.vib.be/index.php/RNAseq_toolbox#Quality_control_and_visualization_of_raw_reads


http://wiki.bits.vib.be/index.php/RNAseq_toolbox#Quality_control_and_visualization_of_raw_reads

FastQC – graphical exploration

http://www.bioinformatics.babraham.ac.uk/projects/fastqc/

http://www.bioinformatics.babraham.ac.uk/projects/fastqc/

FastQC – perfect example

Reads have good quality!


Anna Karenina principle: “There is only one way to be good, but there are many ways to be wrong.”

We will start by showing a good sample. Afterwards we will discuss a less good sample.

http://en.wikipedia.org/wiki/Anna_Karenina_principle

http://en.wikipedia.org/wiki/Anna_Karenina_principle


Smooth histogram/ density line towards the right,


steady nucleotide distribution.

Bias typical for illumina

Not strongly fluctuating GC content

Bias typical for illumina


GC-content nicely bell shaped


No N's! (should ring something)


All reads have length 50bp,


Reads are nicely duplicated: some amount of duplication is to be expected in RNA-seq data.


Kmers are short sequence stretches. Sometimes they are overrepresented. But in RNA-seq this is not so important (duplication).


FastQC – less good RNA-seq sample

A relatively large Portion of the reads have mistakes at the 3' end of the read.


There is an over- representation of reads

with a low mean quality score


Not a steady levelof different nucleotide

fractions


Fluctuates


Heavily skewed versusAT rich reads


Apparently a mixture of two sets of reads

with different lengths


Duplication seems abit on the low side

(reported figures are from 60 -75%)


Very highly skewed read number.

Often the sequence of Truseqadaptor, or multi-

plex identifierscan be

found here. BLAST can reveal

more information!


Specific patterns of Specific kmers.

Note: A and T rich

Quality control of raw data

Proceed? Or rerun?

This QC can guide you to which preprocessing steps you need to apply for sure. The extra time and money needed to correct the biases can sometimes justify a rerun of the experiment.

This QC shows which preprocessing steps have already been made by the sequencing provider.

Preprocessing

Removing unwanted parts of the raw data so it helps as much as possible with reaching our goal: defining differentially expressed genes.

1) removing technical contamination● Low quality read parts● Technical sequences: adaptors● PhiX internal control sequences

2) removing biological contamination● polyA-tails● rRNA sequences● mtDNA sequences

After this, we run FastQC again.

Technical contamination

Our goal is to define DE expression, for this we need to assign reads with a high confidence to the correct genomic location.

Removal of low quality read parts: they have a higher chance to contain errors, and cause noise in our read counts.



Removal of adaptor sequences (and other technical sequences, such as multiplex) as they cannot be mapped to the reference genome.



Removal of adaptor sequences (and other technical sequences, such as multiplex) as they cannot be mapped to the reference genome.

List of technical sequences

Advised to use defaults

http://code.google.com/p/ea-utils/wiki/FastqMcf


Fastq-mcf output




● Never remove duplicate reads! Highly expressed genes can have genuine duplicate reads, which are not due to the PCR amplification step in the protocol.

● PhiX sequences: the DNA of Phi X bacteriophage is spiked in to monitor and optimize sequencing on Illumina machines. Your sequencing provider should filter out those sequences before delivery. You can filter them out by aligning your reads to the PhiX genome.

http://en.wikipedia.org/wiki/Phi_X_174

http://en.wikipedia.org/wiki/Phi_X_174

Biological contamination

Mitochondria containrRNA, mRNA and mtDNA

cell

rRNA and non-coding (95% of RNA)

mRNA (5% of RNA)

nucleus


mRNAs are captured with oligo-dT coated beads.

Occasionally, non-protein coding sequences are also captured (especially since mtRNA and rRNA can be relatively rich in AT).

We can remove them via homology searching (BLAST) with known non-protein coding sequences.

Mitochondrial

mRNA (5% of RNA)

rRNA and nc


mRNAs are post-transcrip- tionally modified: e.g. the addition of a poly-A tail. If our goal is to map the reads to a reference genome sequence, the polyA tails should be removed. This can be viewed as some source of 'biological contamination' in our sequences (…).

AAAAAAAAAAAAA

● Get the non-protein coding sequences via Biomart.

Mitochondrial genome sequence also.


Filter the biological contamination

Your reads

The biological readsImported via Biomart

We are interested in the reads that don't map!

Doing this in Galaxy

Useful: take a sample of your reads: fastq-to-tabular, select random lines, tabular-to-fastq

1. create a new history2. load the sample data in3. Run fastqMcf to remove technical sequences4. Run bowtie to match against biological sequence databases, and keep reads that don't match.5. Summarize: fastqc

→ make a workflow of this sample history.→ run the workflow on all your samples in parallel→ store the cleaned reads in a data library.

Summary preprocessing

Your reads

…...Format consistent? Errors in quality?

Your groomed reads

…....…... Trends in raw data? QC report

Your groomed reads without technical contamination

….... ... Get biological contaminants- ….- ….

Your groomed reads without technical and biological contamination

…... How does your data look now? QC

... Get technical contaminants- ….

KeywordsPaired end

Stranded reads

gzip

fastq



Adapter sequence

Write in your own words what the terms mean

Exercise

→ investigating and preprocessing raw RNA-seq data

http://wiki.bits.vib.be/index.php/RNA-Seq_analysis_for_differential_expression#Investigating_and_preprocessing_raw_RNA-seq_data

RNA-seq: analysis of raw data and preprocessing - part 2

Technology

Transcript of RNA-seq: analysis of raw data and preprocessing - part 2