The Plant Cell, Vol. 4, 1199-1211, October 1992 O 1992 American Society of Plant Physiologists

Rhizobium meliloti Elicits Transient Expression of the Early Nodulin Gene ENOD12 in the Differentiating Root Epidermis of Transgenic Alfalfa

Magalie Pichon, Etienne-Pascal Journet, Annie Dedieu, Françoise de Billy, Georges Truchet, and David G. Barker’ Laboratoire de Biologie Moléculaire des Relations Plantes Microorganismes, INRA-CNRS, BP27, 31326 CastanetTolosan Ckdex, France

To study the molecular responses of the host legume during early stages of the symbiotic interaction with Rhbobium, we have cloned and characterized the infection-related early nodulin gene MtENOD12 from Medicago fjuncalula. In situ hybridization experiments have shown that, within the indeterminate Medicago nodule, transcription of the MfENOD12 gene begins in cell layers of meristematic origin that lie ahead of the infection zone, suggesting that these cells are un- dergoing preparation for bacterial infection. Histochemical analysis of transgenic alfalfa plants that express an MfENOD12 promoter-p-glucuronidase gene fusion has confirmed this result and further revealed that MfENOD12 gene transcription occurs as early as 3 to 6 hr following inoculation with R. meli lot i in a zone of differentiating root epidermal cells which lies close to the growing root tip. It is likely that this transient, nodulation (no@ gene-dependent activation of the ENODl2 gene also corresponds to the preparation of the plant for bacterial infection. We anticlpate that this extremely precocious response to Rhizobium will provide a valuable molecular marker for studying early signal exchange between the two symbiotic organisms.

INTRODUCTION

The symbiotic interaction between prokaryotic rhizobia and leguminous plants leads to the formation of nove1 plant organs known as root nodules. Within these organs, the microsymbi- ont uses photosynthate-derived energy to convert atmospheric nitrogen into ammonia, a form of fixed nitrogen that can be assimilated by the plant host. A complex interplay between the legume host and its bacterial partner is required to assure the induction and subsequent development of the nitrogen- fixing root nodule.

In the case of temperate legumes such as pea and alfalfa, the first morphological event marking the initial symbiotic in- teraction with Rhizobium is the characteristic curling of root hairs into so-called “shepherd’s crooks.” Specialized tubular structures known as infection threads then convey the microsymbiont from the root hair tip toward the root inner cor- tex, where the initiation of cell division has already led to the formation of the nodule primordium. As infection threads pene- trate and ramify within the primordium, releasing bacteria into the central tissue, a zone of apical meristematic activity directs outward growth of the differentiating nodule. Mature pea and alfalfa nodules are cylindrical in shape because these nod- ules, known as indeterminate, possess persistent apical

To whom correspondence should be addressed.

meristems. A longitudinal section through such a nodule re- veals the entire series of developmental steps that correspond to the concerted codifferentiation of the two symbiotic part- ners. The apical (or distal) meristematic zone I is followed consecutively by the prefixing zone II (zone of infection), the amyloplasi-rich interzone 111111, the nitrogen-fixing zone 111, and finally zone IV of senescence (Vasse et al., 1990).

Recent research has shown that multiple signal exchange is essential for the correct recognition between the plant and the microsymbiont (for reviews, see Long, 1989; Fisher and Long, 1992; Verma, 1992). In particular, rhizobial nodulation (nod) genes, whose transcription requires plant flavonoids, are responsible for the synthesis of extracellular lipooligosaccha- rides that mediate the specific symbiotic interaction with the legume host (D6narié and Roche, 1992). In the case of R. meliloti, sulfated and acetylated lipooligosaccharides have been purified from the supernatants of luteolin-induced cell cultures (Lerouge et al., 1990), and it has been demonstrated that these so-called Nod factors are biologically active in specific root hair deformation assays on the host plant alfalfa. Furthermore, these same signaling molecules are also capable of eliciting cortical cell divisions and the formation of genuine nodules on alfalfa roots (Truchet et al., 1991). Interestingly, the sulfate group appears to be necessary for the expression of host spec- ificity because nonsulfated factors are not active on alfalfa,

1200 The Plant Cell

but are now able to elicit symbiotic responses on the roots ofcommon vetch, a nonhost for R meliloti (Roche et al., 1991).

A detailed analysis of the plant response to these bacterialsignal molecules requires the identification of plant genes thatcan serve as molecular markers for the recognition, infection,and nodule organogenesis triggering processes. The pioneer-ing work of Bisseling and coworkers (reviewed in Nap andBisseling, 1990) has shown that certain plant genes are spe-cifically expressed in a variety of plant tissues that are involvedin early stages of rhizobial infection and nodule development.It was shown that transcription of the pea early nodulin geneEA/OD12, which encodes a (hydroxy)proline-rich protein, takesplace within root cortical cells that either contain or lie aheadof the advancing infection thread (Scheres et al., 1990). Tran-scripts of EA/OD12 were also found within cells of the noduleprimordium prior to infection thread penetration and within theinfection zone of the mature root nodule. These same authorsfurther showed that ENOD12 mRNA could be detected in totalRNA extracts of pea root hairs 24 to 48 hr after infection with

RsatM.tr M.trEco Eco Hin

kb

-12-

-6-

M.tr M.tr M.satEco Hin Eco

sf

R leguminosarum and that this response was dependent onfunctional nod genes. The fact that EA/OD12 transcription couldalso be elicited in root hairs following treatment with cell-freesupernatants of flavonoid-induced bacterial cultures providedfurther evidence for the role of Nod factors in the expressionof this early plant symbiotic gene (Scheres et al., 1990).

In recent years, research in our laboratory has focused onthe nitrogen-fixing symbiosis between R. meliloti and a vari-ety of plants from the genus Medicago, including alfalfa andthe diploid autogamous M. truncatula (Barker et al., 1990). Theavailability of a wide range of R meliloti mutants that have al-tered symbiotic properties and the means of purifying thecorresponding Nod factors from these mutant strains makethis a most attractive system with which to study the regula-tion of plant genes in response to bacterial lipooligosaccharidesignals. Furthermore, certain alfalfa genotypes are amenableto transformation and regeneration procedures (Deak et al.,1986; Chabaud et al., 1988), thus enabling us to construct trans-genic plants expressing reporter genes under the regulatorycontrol of the plant gene of interest. In this way, the transcrip-tional activity of the gene can be evaluated both at the cellularlevel and throughout the intact root system using a simplehistochemical staining procedure (Jefferson et al., 1987).

In this study, we describe the isolation and characterizationof a single-copy gene, homologous to pea EA/OD12, that wasobtained by screening a genomic library of M. truncatula. Thetissue-specific transcription of this early nodulin gene has beenstudied by both in situ hybridization and the analysis of trans-genic alfalfa plants that express a chimeric gene fusionbetween the M. truncatula MtENOD12 promoter and the(3-glucuronidase (gusA) reporter gene (previously known asuidA). The discovery of novel expression patterns for theE/VOD12 gene provides new insights into the molecular andcellular mechanisms involved in preparing plant tissues forsubsequent infection by Rhizobium.

-1.5-RESULTS

Identification of an At. truncatula Gene Homologous toPea ENOD12

PsENOD12 MfENOD12probes

Figure 1. Genomic DMA Gel Blot Analysis Using Pea and M. truncat-ula 0VOD12 Probes.

Fifteen micrograms of pea genomic DNA (P. sat), 5 ng of M. truncatulaDNA (M. tr), and 5 ng of alfalfa DNA (M. sat) were digested with eitherEcoRI (Eco) or Hindlll (Hin), electrophoresed on 0.8% agarose gels,and blotted onto GeneScreen membranes. Hybridization was carriedout as described in Methods using either a Ps£WOD12 cDNA probe(left-hand three lanes) or the 0.5-kb Sphl-BamHI fragment of theMf£A/OD12 gene (right-hand three lanes).

Figure 1 shows that several hybridizing bands of variable in-tensity can be observed when a pea EA/OD12 cDNA fragmentis used to probe restriction digests of M. truncatula genomicDNA under low-stringency conditions. Genomic clones corre-sponding to each of the major hybridizing bands were isolatedby screening an M. truncatula gene library constructed in thephasmid vector pGY97 (Vincze and Kiss, 1990). By means ofDNA-DNA hybridization and partial sequence analysis (seebelow and results not shown), we were able to conclude thatonly one of these clones (pMt12) contained a gene that is ho-mologous to the pea EA/OD12 probe. Details of the four otherM. truncatula genes that were isolated by this screening pro-cedure will be presented elsewhere.

Medicago ENODl2 Gene Transcription 1201

- A - probe -

BIS H H B H Sp B M C H BIS I I I

- B - 5' ... GCATGCCATGCAATMTAATACTAACGGGTCTAGTGCCT~GCTATTTTTTATTTCMGCAMATTGAATTTATCCAAATTGAATATTACATTT -227

TTTMATAATATTCCACGTACACCMTACGTTCTTTGTTAATATTCGACACAAATTTT~CATTACATAGAGTGATTAATTATTAGTTTATTGATCTATAGTMTAATAACCTATT~ -108

TCGGTCGAGACATTGCACTTCCATTGAGGCCCCTAACTACTATAAAACCTGATTATTCCCTMATCCCTATATGTTATATGCACTAACATT~TTACTACTTMA ATG GCT TCC 9 Met A l a Ser (3)

99

(33)

189

(63)

279

(93)

387

Y TTT TCG CTG TCC ATA TTA GTG TTT TTC TTT TCT GCT CTT GTC CTT GTT CCT C A I GGC TTT GCT GAA TAT TAC CTT TAT CCT GCT TAT AGG Phe Ser L e u Ser I l e Leu Val Phe Phe Phe Ser A l a L e u Val L e u Val P m Gln G7y Phe Ala G l u T y r T y r Leu T y r Pro A l a T y r A r g

CCA CCA CAA ACG AAA CCA CCG GTG M T AAG CCA TCA CAC AAG GAA CCA CCG GTG M T AAG CCA CCA CAC AAG GAA CCG CCG GTC CAC M G

P r o P r o G l n T h r Lys P r o P r o V a l A s n Lys P r o Ser His Lys G l u P r o P r o V a l A s n Lys P r o P r o His Lys G l u P r o P r o V a l His LYS

CCA CCA CAC AAG GAT CCA CCG GTT AAT M G CCA CCA CAA AAG GAA TCA CCA GTG CAC AAG CCA CCA CGA AAG GAA TCA CCG ACG CAT AGG

P r o P r o H i s Lvs A s p P r o P r o V a l A s n Lys P r o Pro G l n Lys G l u Ser P r o V a l His LVS Ser P r o T h r Hls A r g

CAT CCT CCA GCA GAA GAT AAC ATC CAT TTC TAA A G C A T G A A A A T A C A A C T T T A A G G C T T A T T T A T A T C T A C A A T T T G T T G T A T

H i s P r o P r o A l a G l u A s p A s n Ile Hls P h e

TMTAATTTTTGTACAATGTATGGGCMGCMGTTGTATCTTGCCTTATCTAT~CA. . . 3 '

Figure 2. Restriction Map and DNA Sequence of the M. truncatula fNODl2 Gene.

(A) Partia1 restriction map of the 8.8-kb insert of the genomic clone pMtl2 containing the MtfNOD12 gene (see Methods). The coding region of MtENODlP is represented by the thickened horizontal lhe, and the accompanying arrow shows the direction of transcription. A horizontal bar indicates the 0.5-kb Sphl-BamHl restriction fragment that was used for hybridization studies. The 2.3-kb promoter fragment that was amplified by PCR to generate the gusA transcriptional fusion (see Methods) is shown by the horizontal dashed line bordered by asterisks. Abbreviations for restriction sites are as follows: B, BamHI; C, Clal; H, Hindlll; M, Mscl; N, Ncol; Sp, Sphl; B/S, BamHIISau3A junction. (8) DNA sequence lying between the Sphl and Mscl restriction sites and covering the MtENOD12 coding region. The deduced amino acid se- quence has been annotated to indicate the putative signal peptide (italics), the peptide cleavage site (vertical arrow), and the proline-rich pentapeptide repeat motifs (double-underlining). A potential TATA element within the promoter region has been underlined. Nucleotide numbering is relative to the A residue (+1) of the initiator ATG codon; there is no " O position. Amino acid numbering is shown in parentheses.

*

The partia1 restriction map of the pMtl2 insert is presented in Figure 2A, showing both the location of the coding region and the direction of transcription of MtENOD12, as determined by sequence analysis (see below). Genomic gel blot hybrid- ization of M. fruncatula DNA with the 0.5-kb Sphl-BamHI fragment, which covers part of the coding region and the 5' noncoding region of MtENOD12 (Figure 2), showed that this single-copy gene lies within the 12-kb EcoRl and 6-kb Hindlll genomic fragments (Figure 1) and, thus, corresponds to the most intense hybridization signal seen with the pea ENOD12 probe. Govers et al. (1991) have shown that, in the case of the pea (Pisurn safivum) genome, there are two closely related ENOD12 genes, PsENOD12A and PsENOD12B, and that both genes have the same organ-specific pattern of expression. The fact that MtENOD12 is a single-copy gene has greatly simpli- fied the analysis of MtENOD12 transcription by means of

specific DNA and RNA hybridization probes (see below). In contrast, severa1 hybridizing bands can be seen when alfalfa genomic DNA is hybridized with the MfENOD12 probe (Figure 1). This probably reflects the allelic heterozygosity commonly found with the tetraploid allogamous alfalfa and serves to illustrate the advantage of using the diploid autogamous M. fruncafula for such molecular studies.

Sequence Analysis of the MtENOD12 Gene

The nucleotide sequence of the coding strand of MtENOD12 and the deduced amino acid sequence are presented in Fig- ure 28. No alternative open reading frame of significant length could be identified on either strand. As is the case for the pea ENODl2 proteins (Govers et al., 1991), the ATG initiation codon

1202 The Plant Cell

of MtENOD12 is followed by 23 amino acids that, according to the rules of Von Heijne (1983), are likely to serve as a membrane-translocation signal peptide. The remaining cod- ing sequence (79 amino acids) is mainly composed of the repeating pentapeptide unit PPXXX, a structural feature that has also been found in a family of hydroxyproline-rich cell wall proteins of soybean known as SbPRPs (Hong et al., 1990).

The homologies between the Medicago and the two pea ENOD12 proteins are shown in Figure 3A. It is striking that only a single gap of 7 amino acids has to be introduced into the C-terminal region of MtENOD12 to optimize the alignment with PsENOD12A. The two regions of maximum homology cor- respond to the signal peptide sequence (83% nucleotide and 71% amino acid identities) and the proline-rich repeat region (76% nucleotide and 69% amino acid identities). The greater nucleotide sequence homology coupled with the near perfect alignment of the two sequences strongly suggest a common

-A- v ----

MIENODIZ MPSFSLSILVFFFSALVLVFWFA EYYL YPAYR P W T K PPVNK PSHKE PPVNK

PsENOD12A MPSFFLSSLVLFLAALILVFWLA QYHL NPVYE PPVNG PPVNK PFQKE TPVHK

PsENOD12B MPSLFLSSLVLFLAALILVFWFA QYHL NPVDE PPVNE PTVNK P W K E TPVYK

**** nu ..I" * e.. ***** * * LI * I ** *UD*" u na. >(" >,

nu* *I*"*U**I*.*******%" * **** a** * e*** * *iy* **o** *l* .I

------- Mf PPHKE PPVHK PPHKO PPVNK PFQKE SPVHK PPRKE SPTH.. . . . . .RHPPAEONIHF ** um *nu* *\- * >?* * I**** * ** ** I * 0 ** * *i>**

PSA P W K E TPVHK PFQKE PPRHK P W K E PPRHK PPHKK SHLHVTKPSYGKHPTEEHNIHF

PSB P W K K SFUYM PEQKE . . . . . , . . . . . . . . . . . . . . SHLHV.. . .YOKHLTAEHNIHI **** I) * * n * ***** I; ** * *nu**

-B- 4.- .-.-.-.-.____ m *.-. * ******* ***o ****** I ** * * 11111 MlENOO I2 G T T T A T l G I \ T C T A T A G T M T M T A A C C T A T T ~ T C ~ l C G t G (-99)

PsENOD12B GI\TTATTGPIGPITATA.TAATAAATTAGTTTT ..... GPITTGPIG ( - 8 5 )

MI ACATTKACTTCCATTGAGGCCCTAACTAC~ÃZZECCTG~TT~TTC ( - 50)

PsB A C C T T C C A C T T C T A T T ~ G G P I T C C T T A C T A G ~ C C T T A T T A T T C ( -36) .\,:, *e , *..IllZ** *<*<***>.*< ,*O>' *O\'* I I I ' *L I *L l * * l l * *****"Q

.-.* * -.-.-.-. -.-.-* Mf CCTAAATCCCTATAIGTTATATKACTAACATTAAAATTACTACTTMA ( - 1 )

(lil * I," ** ** **>.ir &,l,n** I. i)Ii.,lllll,I"

PSB CCCATAT.. , . . . . , , . , . .GTG.A~AAACACAAAAATCATTACTTAAA ( - 1 )

Figure 3. Homology between the Coding and 5' Upstream Sequences of the Medicago and Pea ENODl2 Genes.

(A) Alignment of the deduced amino acid sequences of the MtENOD12 gene and the two peagenes, PsENOM2Aand PsENOD12B. Gaps have been introduced into the MtENOD12 gene and the PsENOD12B gene (Govers et al., 1991) to maximize the alignments, and amino acid iden- tities are indicated by asterisks. The putative signal peptide is italicized, the peptide cleavage site is marked by a vertical arrow, and the proline- rich pentapeptide repeat elements are overlined. (6) Alignment of nucleotide sequences 5'to the initiation codons of the MtENOD12 and PsfNOD12B genes. Gaps have been introduced into the PsENOD12B promoter sequence to optimize the alignment, and dashed horizontal lines with arrowheads mark the three stretches of homology referred to in the text. Potential TATA elements are under- lined and overlined, and the transcription initiation site of the pea

evolutionary origin for these two genes. Closer inspection of the proline repeat region of MtENOD12 and PsENOD12A re- veals five well-conserved repeats of the decameric sequence PPVNI~KPPHloKE. Despite the extensive deletion within the fsEN0012B coding region, it is clear that the two putative pea proteins are more closely related to each other than to the Medicago protein.

A comparison between the 5' flanking sequence of MfENOD12 and that of fsENOD12B (the only upstream se- quence currently available) reveals three stretches of quite striking homology within 140 bp upstream from the transla- tion initiation site (Figure 38). The first stretch runs from positions -1 to -29 (76% conservation), the second from -43 to -105, including the putative TATA element (~WO), and the third from -111 to -141 (68%). Numbering is based on the Medicago sequence. Interestingly, it has already been shown that upstream sequences of the fsENOD12B gene, which cor- respond to the central conserved stretch, can also be aligned with equivalent promoter regions of the small family of soy- bean genes that encode the SbPRPs (Govers et al., 1991). However, as these authors have pointed out, the considerable differences in both developmental and tissue-specific expres- sion patterns shown by €NO012 and these three soybean f R P genes (Wyatt et al., 1992) make it unlikely that this conserved region could be a determinant of organ-specific regulation.

Spatial-Temporal Expression of MtENODl2 during Nodule Development

Studies on the variation in ENOD12 mRNA levels during nod- ule development in pea had revealed two particular characteristics. First, gene transcription could be detected ear- lier during nodule development as compared with previously described nodule-specific genes, and second, the abundance of €NO012 transcripts decreases as the young immature nod- ule develops into the mature nitrogen-fixing nodule (Scheres et al., 1990).

When M. truncafula plants are grown in aeroponic condi- tions (see Methods), nodules first become visible on the root system between 3 and 4 days following inoculation with R. meliloti, and nitrogenase activity is first detectable 2 to 3 days later. Figure 4 shows the profile of MtENOD12 mRNA abun- dance in total RNA extracts prepared from nodules of M. fruncatula harvested between 4 and 8 days after inoculation. The leve1 of MfENOD12 transcripts is relatively high at 4 to 5 days postinoculation and then drops rapidly by a factor of ap- proximately 10-fold as the nodule continues to mature and begins to fix atmospheric nitrogen. As is the case for the pea nodule, this is in striking contrast to the profiles observed for transcripts encoding either the abundant oxygen-buffering pro- tein leghemoglobin or the nodule parenchyma-specific protein ENOD2 (van de Wiel et al., 1990), both of which remain at con- stantly high levels as the nodule reaches maturity (Figure 4).

PsENOD12B gene is double underlined (Govers et al., 1991). Nucleo- tide numbering is the same as given in Figure 2.

A control hybridization with a human ubiquitin probe has been included to show that RNA loadings were approximately equal.

Medicago EA/OD12 Gene Transcription 1203

days post-inoculation4 5 6 7 8

-MfENOD12

ENOD2

- Leghemoglobin

- Ubiquitin

N2 fixation

Figure 4. Comparison of the Expression Patterns ot the Mf£WOD12Gene and Other Symbiosis-Related Genes during Nodule Development.Total RNA was extracted trom M. truncatula nodules harvested between4 and 8 days after inoculation with R. meliloti, and 10-ng samples weresubjected to denaturing gel electrophoresis followed by transfer toGeneScreen membranes (see Methods). The same RNA gel blot washybridized consecutively with the following 32P-labeled DMA probes:the 0.5-kb Sphl-BamHI fragment of /WEA/OD12 (see Figure 2 and text);a soybean ENOD2 cDNA fragment; an alfalfa leghemoglobin cDNAfragment; and a human ubiquitin gene fragment (see Figure 6 ofGallusci et al., 1991 for details regarding these heterologous probes).Hybridization and washing conditions were identical for all probes (seeMethods), and the blot was totally stripped between hybridizations.Nitrogen-fixing activity within M. truncatula nodules can first be de-tected approximately 6 days postinoculation under the aeroponic growthconditions used in these experiments.

M. truncatula nodules harvested 2, 3, or 4 weeks after inocu-lation showed essentially the same pattern of mRNAabundance as did 8-day-old nodules (results not shown), whichis consistent with the presence of the persistent apical meristemof the indeterminate Medicago nodule.

Scheres et al. (1990) have shown that pea EA/OD12 mRNAcan also be detected (albeit at low levels) in both stem andflower tissue, showing that these genes are not strictly nodulespecific. Gel blot analyses with total RNA isolated from differ-ent M. truncatula tissues (uninoculated roots, stem, hypocotyl,cotyledon, leaf, petiole, flower, and dry seeds) have so far failedto reveal the presence of MfEA/OD12 mRNA. This does not,of course, rule out the possibility of either very low transcriptlevels or brief transient expression in such tissues.

Having established that the pattern of MfEA/OD12 mRNAabundance during nodule development resembles that de-scribed for the homologous pea genes, we decided to examine

the tissue-specific location of these transcripts within the nod-ule using in situ hybridization. Sections of M. truncatulanodules, harvested either 4 days or 3 weeks after inoculation,were hybridized with a 35S-labeled antisense RNA probe.Control experiments with sense probes routinely gave low, evenbackgrounds (results not shown). Figure 5A shows that a rela-tivelf uniform hybridization signal is present within the centraltissue of the 4-day-old nodule. At this early stage of develop-ment, the nodule is approximately spherical in shape with acentral tissue in which ramifying intercellular infection threadspenetrate the plant tissue. Our results showed that all cellswithin the central tissue of the 4-day-old nodule express theMf£A/OD12 gene, which is in line with the results obtained forEA/OD12 mRNA localization in immature pea nodules (Schereset al., 1990).

In situ hybridization experiments carried out on sections of3-week-old mature nitrogen-fixing nodules of M. truncatulashowed that A/WEA/OD12 transcripts are present at the distalend of the prefixation zone II, corresponding to a region of thenodule where bacteria are being released from the infectionthreads (Figure 5B). When examining the apical region of the3-week-old Medicago nodule at a higher magnification, it ispossible to distinguish meristematic cells undergoing cell di-vision (Figure 5C). While MfEA/OD12 transcripts are absent inthese actively dividing cells, a hybridization signal is clearlyvisible in the two to three cell layers in which infection threadsare not yet present. These results suggest that MtENOD~\2 tran-scription is initiated in the proximal cell layers of zone I thathave ceased to divide, but that are not yet part of the prefixa-tion zone II where infection takes place. The hybridization signaldrops to background levels at the proximal end of prefixingzone II where bacteroids and plant cells are rapidly differen-tiating. This occurs prior to the amyloplast-rich interzone region(results not shown), which we have previously shown to bethe site of leghemoglobin gene transcriptional activation(de Billy et al., 1991).

Expression of a Transcriptional MfEA/OO12 Promoter-gusA Fusion in Nodules of Transgenic Alfalfa

To complement the in situ hybridization studies and to facili-tate the analysis of /WE/VOD12 gene expression during earlierstages of the symbiotic interaction, we decided to introducean MfEA/OD12 promoter-gus>4 fusion into transgenic Medicagoplants. The 2.3 kb of DNA lying immediately upstream of the/WE/VOD12 ATG translation initiation codon was cloned in frontof the Escherichia coli gusA coding region in such a way asto generate a precise transcriptional fusion (see Methods). Thischimeric construction was then introduced into M. varia A2plant tissue by means of an Agrobacterium fumefac/ens-leafdisc transformation protocol (Chabaud et al., 1988). Regener-ation of whole plants via somatic embryogenesis led to theisolation of 20 kanamycin-resistant plants that were phenotyp-ically indistinguishable from the nontransformed line. GenomicDNA gel blot analysis of 12 of these regenerated plants provided

1204 The Plant Cell

*•" CFigure 5. In Situ Hybridization of M. truncatula Nodule Sections (7 urn) with an Mf£WOD12 35S-Labeled Antisense Probe.(A) Four-day-old immature nodule showing a uniform pattern of hybridization within the central tissue. Silver grains appear as bright spots whenviewed by dark-field microscopy. Bar = 50 um-(B) Three-week-old mature nodule. The hybridization signal is maximal at the distal end of the prefixation zone II (large asterisk), which corre-sponds to the infection zone of the nodule. Note the low level of hybridization at the proximal end of this zone (arrows). The meristematic zoneis indicated by the small asterisk. Bar = 200 um.(C) Bright-field microscopic image of a 3-week-old nodule. Mf£WOD12 transcripts (silver grains now appear as dark spots) are present in thetwo to three cell layers of the "preinfection" zone (star, see Discussion), which lie proximal to actively dividing meristematic cells. The arrowheadindicates a cell in anaphase. Note that infection threads (arrows) are not yet present in the cells of the "preinfection" zone. Bar = 20 um.

direct evidence for the successful integration of between twoand five copies of the reporter gene fusion (results not shown).

To examine the expression pattern of the MtENOD12-gusAfusion following inoculation with Rhizobium, primary trans-formants were taken through several cycles of vegetativepropagation and then 4- to 5-cm-long cuttings were grown forabout 3 weeks in aeroponic conditions until the root systemswere well developed. R. melilotiwas added to the liquid growthmedium lacking combined nitrogen, and samples of the rootswere examined for GUS activity at regular intervals after in-oculation. Two of the 20 plants were scored negative for GUSactivity throughout the experiment, and the remaining 18responded in a qualitatively identical fashion.

Nodules first became visible on the transgenic alfalfa rootsystem approximately 3 to 4 days following Rhizobium inocu-lation, showing that M. varia and M. truncatula have very similarkinetics of nodule development. These immature nodules de-veloped an intense indigo blue coloration when treated withthe histochemical GUS substrate X-gluc, and subsequent sec-tioning showed that the GUS activity was distributed uniformlythroughout the central tissue (results not shown). Figure 6Ashows that at a slightly later stage of nodule development (4to 5 days postinoculation) the blue staining zone had clearly

moved to the distal end of the central tissue. Expression ofthe gusA fusion is clearly visible in tissue that lies distal tothe zone where infection threads are visible. This correlateswell with the localization of Mf£7VOD12 mRNA by in situ hy-bridization (Figure 5C). The very pale coloration that is presentin certain peripheral cells of the nodule may be due to limiteddiffusion from the intensely staining regions.

The distal localization of GUS activity in nitrogen-fixing andelongating indeterminate alfalfa nodules can be clearly seenin stained whole root segments (Figure 6B). Thick sections(80 u,m) of GUS-stained mature nodules have also been stainedwith potassium iodide to reveal starch-containing cells (Fig-ure 6C), showing that the MfEA/OD12 promoter fusion is nolonger being expressed in the central cell layers that immedi-ately precede the amyloplast-rich interzone region.

Expression of the Mt£NOD12 Promoter-gusA Fusionduring the Earliest Stages of the Symbiotic Interaction

Having established that the expression of the EA/OD12 pro-moter-guaA fusion in transgenic alfalfa nodules was verysimilar to the pattern of gene transcription in M. truncatula

Medicago OVOD12 Gene Transcription 1205

nodules as determined by in situ hybridization, we decidedto focus on reporter gene expression within the alfalfa root sys-tem at much earlier stages of the symbiotic interaction.

The first response to the addition of R. meliloti could be de-tected in apical regions of the root system as little as 3 to 6hr after inoculation. As shown in Figure 7A, a uniform pale bluestaining covered a region that starts within the root elongationzone just behind the root tip, continues throughout the zoneof root hair emergence and development, and terminates atthe start of the mature root hair zone. GUS activity was pres-ent in all epidermal cells of this reactive region, including thosewhich had developed root hairs (Figures 7B and 7C), and nostaining could be detected in internal cortical cell layers (resultsnot shown) or in the region of the root with mature root hairs(Figure 7D). It should be emphasized that identical expres-sion patterns were recorded for all 18 of the transgenic linesanalyzed. During the following 18- to 24-hr period, we observedan increase in the blue coloration within this reactive zone,although the intensity of staining remained uniform through-out. Control experiments using these same transgenic alfalfaplants failed to detect GUS activity in either root hairs or rootepidermal cells prior to inoculation or following a 6-day period

of nitrogen starvation in the absence of Rhizobium. Further-more, inoculation with a non-nodulating strain of R. meliloticarrying a mutation in the nodA gene failed to elicit any reportergene expression within the apical region of the root (resultsnot shown), demonstrating that this early response is indeeddependent on the activity of the bacterial nod genes.

Histochemical staining of transgenic alfalfa root segments48 to 72 hr after inoculation with R. meliloti revealed a numberof discrete, dark blue-colored loci within the mature root hairregion (Figure 7E). Preliminary observations have shown thatcertain early symbiotic events, such as root hair deformation,root hair infection, and cortical cell division, do indeed takeplace within these reactive loci, where GUS activity can nowalso be detected within the root cortex (results not shown). How-ever, a detailed cytological study will be required to identifythose cell types that express the gusA fusion and to correlateevents occurring on the root surface with those that take placewithin the cortex. With the exception of these intensely stain-ing loci, all the surrounding epidermal cells (including roothairs) were without detectable GUS activity. Harvesting andstaining root segments at intermediate time points (results notshown) have confirmed that this region corresponds to the

* ,•

BFigure 6. GUS Activity in Root Nodules of Transgenic M. war/a Expressing the Mf£WOD12 Promoter-gusA Gene Fusion.(A) Section (1 to 2 urn thick) of a 5-day-old immature nodule. Reporter gene activity is present in distal cell layers (arrows) that lie ahead of theprefixation zone II (asterisk). The blue coloration is most intense within the distal part of the prefixation zone, where it is possible to visualizesections through infection threads (arrowheads). Bar = 100 urn.(B) Histochemical staining of a whole nodulated root segment harvested 7 days postinoculation. GUS activity is clearly visible at the distal endof the nodules. The arrowhead indicates a localized region of the root where earlier stages of the symbiotic interaction are visible (see also Figure7E). Bar = 250 urn.(C) A section (80 urn thick) of a mature nitrogen-fixing nodule harvested 3 weeks after inoculation. A gradient of GUS activity can be observedwithin prefixation zone II (star), decreasing from the distal end toward the proximal end. The section was cleared with sodium hypochlorite andthen stained with potassium iodide (Vasse et al., 1990) to reveal the amyloplast-rich cells of interzone ll/lll (arrowheads). Bar = 200 urn.

1206 The Plant Cell

DFigure 7. Expression of the Mf£A/OD12 Promoter-gu&4 Fusion in Transgenic M. varia Roots during Early Stages of the Symbiotic Interaction.

(A) Pattern of GUS activity throughout the zone of epidermal cells close to the growing root tip 20 hr after inoculation with R. meliloti. Bar = 250 |im.(B) Reactive epidermal cells of the root elongation zone (marked by a single arrowhead in [A]). Bar = 125 urn.(C) Reactive zone of root hair emergence (double arrowheads in [A]). Bar = 125 urn.(D) Zone of mature root hairs (triple arrowheads in [A]) in which GUS activity cannot be detected. Bar = 500 urn.(E) GUS activity within discrete loci of the mature root hair zone of the transgenic alfalfa root harvested 72 hr after inoculation. Note that, withthe exception of the intensely stained regions, GUS activity is absent throughout the remaining root epidermis. Bar = 700 urn.

maturation of the zone which had previously stained uniformlyfor GUS activity close to the root tip (Figures 7A to 7C). Wetherefore concluded that, for the majority of differentiating rootepidermal cells, this early transcription of the /Wf£A/OD12 geneis a transient phenomenon (compare Figures 7A and 7E).

DISCUSSION

Detailed molecular and cellular analyses of the events that oc-cur during the earliest stages of the symbiotic interactionbetween the host legume and the corresponding rhizobial part-ner require the identification of genes that can act as markersfor the plant response. With this goal in mind, and wishingto focus our studies on the Medicago-R meliloti symbiosis

for the reasons discussed earlier (see Introduction), we havecloned and characterized an M. truncatula gene, Mff A/OD12,that appears to be both structurally and functionally homolo-gous to the pea early nodulin gene EA/OD12 (Scheres et al.,1990). These authors have proposed that the protein encodedby the pea EA/OD12 gene is most probably a (hydroxy)proline-rich cell wall protein. Their argument is based on the pres-ence of a putative N-terminal transmembrane signal sequenceand by drawing an analogy with the small family of SbPRPs,which are composed almost entirely of a proline-rich pentapep-tide repeat motif (Hong et al., 1990). The fact that the homologybetween the deduced pea and Medicago ENOD12 amino acidsequences is greatest within both the signal peptide (71%)and the domain of proline-rich repeats (69%) (Figure 3A) fur-ther argues for the cell wall localization of this nodulation-related protein.

Medicago ENODl2 Gene Transcription 1207

By means of in situ hybridization experiments, we have shown that, in both immature and mature nitrogen-fixing nodules of M. truncatula, MtENOD12 transcription is maximal in the zone in which infection threads are spreading and releas- ing bacteria into host cells. Those cells that are “infected” will subsequently differentiate into the enlarged Rhizobium-filled cells of the nitrogen-fixing zone, whereas the uninfected cells will remain small in size and develop large vacuoles. By ex- amining the apical meristematic region of the Medicago nodule in greater detail, we have been able to observe that MtENOD12 transcription is in fact initiated within a narrow zone, composed of two or three cell layers, which is immediately adjacent and proximal to the actively dividing meristematic cells, but clearly lacking infection threads (Figure 5C). We propose that the term “preinfection zone” be used to describe this narrow band of cells lying between the meristematic cells and the infection thread region. That MtfNOD12 transcription should be trig- gered within this zone is interesting in light of the fact that, during early stages of infection, pea ENODl2 transcripts have been found in cortical cells that lie ahead of the progressing infection thread (Scheres et al., 1990), thus leading to the hy- pothesis that “diffusible” signal molecules originating from the infection thread are responsible for fNOD12 gene activation at a distance. Our observations would suggest that a similar gene activation mechanism exists in the developing nodule, where the cells that lie immediately ahead of the infection thread region are also preparing for subsequent infection. This would also explain why all cells within this zone contain €NOD12 transcripts irrespective of whether they become in- fected or remain uninfected.

One of the principle advantages of studying symbiosis- related plant gene expression in species of the genus Medicago lies in the possibility of obtaining transgenic alfalfa via A. tumefaciens transformation and somatic embryogenesis. With the notable exception of Lotus (Petit et al., 1987), alfalfa is the only legume that is currently amenable to such routine transformation and regeneration procedures. Based on the as- sumption that gene regulatory mechanisms would be highly conserved between closely related species of the genus Medicago, we have introduced a chimeric gene composed of a 2.3-kb MtENOD12 promoter fragment fused to the coding region of the gusA reporter gene into the high-frequency regenerating line of alfalfa, M. varia A2. A qualitatively homo- geneous response, in terms of reporter gene expression, was obtained for 18 of the 20 transgenic plants tested following in- oculation with R. meliloti. More importantly, the distribution of GUS activity within the nodules that formed on the roots of these transgenic plants correlated remarkably well with the localization of MtENOD12 mRNA, as determined by in situ hy- bridization analyses on sections of M. truncatula nodules (Figure 5). The leve1 of GUS activity was found to be maximal within the invasion zone of both immature and mature nitrogen- fixing nodules. Furthermore, expression of the chimeric re- porter gene also appeared to be initiated in preinfection cell layers which precede the zone of infection thread prolifera- tion (Figure 6A). These results provide convincing evidence

that the 2.3-kb MtENOD12 promoter fragment contains all the information necessary for regulated expression of the Medicago fNOD12 gene and that our reporter gene assay in transgenic alfalfa provides avalid means of evaluating the ex- pression patterns of this early symbiotic gene.

When transgenic alfalfa plants were used to examine the expression of the MtENOD12 gene during the earliest stages of the symbiotic interaction, we discovered that reporter gene activity could first be detected in roots as little as 3 to 6 hr fol- lowing inoculation with R. meliloti. Furthermore, GUS activity was present not only in young developing root hairs but throughout all epidermal cells of a region extending from just behind the growing root tip as far as the beginning of the ma- ture root hair region (Figure 7A). The relatively uniform pattern of staining suggests that all cells on the outer surface of the root and lying within this zone respond to the presence of the bacterial symbiont. Because a nodulation-deficient mutant of R. meliloti carrying a Tn5 insertion in the nodA gene does not elicit this reaction, we can reasonably conclude that this cor- responds to a nod gene-dependent symbiotic response.

The fact that fNOD12 gene expression should be triggered in this actively differentiating region of the root is of consider- able interest because it is now well established for alfalfa (and indeed for most other legumes so far examined) that the events that lead to subsequent nodule formation are generally initi- ated within the part of the root that lies between the elongating root tip and the zone of root hair emergence (Bhuvaneswari et al., 1981; CaetanoAnollés and Gresshoff, 1991). Even when successful infections are initiated within the more mature re- gion of the root, these are usually restricted to a zone no greater than 1 cm distant from the point of first root hair emergence. The striking correlation with the pattern of early reporter gene expression suggests that the transcription of the ENODl2 gene parallels the differentiation of a zone that is undergoing prep- aration for subsequent Rhizobium infection.

Epidermal cells that form root hairs are known as trichoblasts, and during this differentiation process, polar tip growth is es- tablished only after cells have initiated a round of cell division and have arrested in cytokinesis (for a review, see Kijne, 1991). We can speculate that, in response to rhizobial signals, spe- cific symbiosis-related proteins, such as ENOD12, may be incorporated into the developing root hair cell wall, thus ren- dering the root hairs susceptible to Rhizobium infection. Modifications in the cell wall of the root hair could have an important role in severa1 stages of the infection process in- cluding bacterial attachment, localized cell wall degradation, and the development of the infection thread. In the case of pea, it has been shown that the mRNA population of root hairs is significantly modified following infection by R. leguminosa- rum, with the appearance of at least one new mRNA species and a significant enhancement in the levels of a second mRNA (Gloudemans et al., 1989). However, the identity and subcel- lular localization of the corresponding proteins have not yet been determined.

Could the rhizobial signals that trigger this very early reac- tion in epidermal cells close to the root tip be the same

1208 The Plant Cell

symbiotic Nod factors recently identified as extracellular lipooligosaccharides? Interestingly, Nod factors are able to specifically induce root hair branching of the host legume (Lerouge et al., 1990). Morphologically, this branching process corresponds to the formation of a new growth tip on the side of the root hair and is, therefore, analogous in certain respects to root hair growth during trichoblast differentiation. Because it has been shown that Rhizobium Nod factors are able to stimu- late root hair development (Roche et al., 1991) and also to induce ENOD12 gene expression in pea root hairs (Scheres et al., 1990), these molecules could well be responsible for initiating changes in the number and composition of the root hairs that will permit subsequent Rhizobium infection. The purification of sulfated lipooligosaccharides from the parenta1 strain of R. me/iloti(NodRm-IV [Ac,S]), which specifically elicit alfalfa root hair branching, and the corresponding nonsulfated derivatives purified from nodH mutants (NodRm-IV [Ac]), which have lost this capacity (Roche et al., 1991), will now enable us to examine directly how these molecules influence ENODl2 gene transcription in relation to the infection process.

The zone of epidermal and root hair cells that stained uni- formly for GUS activity continued to be clearly visible near the root tips of transgenic alfalfa plants until approximately 24 hr after inoculation with R. meliloti. During the period 24 to 72 hr postinoculation, as the distance between the reactive zone and the root tip gradually increased dueto root growth, a small percentage of root hairs within this zone began to stain very intensely for GUS activity, while the remaining root hairs and epidermal cells rapidly lost their blue coloration (Figure 7E). Preliminary analysis suggested that GUS activity was also pres- ent within inner regions of the root cortex at this stage (Figure 7E and results not shown), most probably corresponding to the development of the nodule primordium, as described for the pea ENOD12 gene (Scheres et al., 1990).

Taken together, our findings suggest the following scenario. Within hours of the addition of Rhizobium, the Medicago ENOD12 gene is activated transiently within epidermal cells of a reactive zone close to the root tip. This rapid response leads to the differentiation of root hairs that are susceptible to infection by Rhizobium. Root hairs that are infected continue to express the ENOD12 gene, and in this case, the leve1 of tran- scription is enhanced.

Such a series of events is interesting for the following rea- sons. First, we can draw a correlation between the expression of MtENOD12 in epidermal cells preparing for infection thread initiation (this study), the expression of the pea ENOD12 gene in cortical cells and cells of the nodule primordium that lie ahead of the infection thread (Scheres et al., 1990), and the expression of the Medicago gene in cells of the preinfection zone of the differentiating nodule prior to infection thread penetration (this study). Could Nod factors be involved in all of these processes? The fact that the appropriate factors can elicit both cortical cell divisions and nodule organogenesis in alfalfa roots (Truchet et al., 1991) and cortical cell divisions in Vicia roots (Spaink et al., 1991) provides indirect evidence that this may indeed be the case. Second, our findings suggest

that recognition of the lipooligosaccharide factor precedes dif- ferentiation of the root hair. If so, then it is easier to appreciate how severa1 different determinants of host specificity may be involved in the preliminary stages of the symbiotic interaction. The production and specific recognition of Nod factors would provide the initial trigger to the process, leading subsequently to the expression of other specificity determinants, such as lectins (Diaz et al., 1989), involved at later stages of the inter- action (e.g., at the surface of the root hair). The identification and localization of Nod factor receptors will clearly be of con- siderable importance in understanding the role(s) played by these molecules during symbiosis.

In addition to providing new insights into the nature of the plant response during the earliest stages of the Rhizobium- legume interaction, transgenic alfalfa expressing the ENODl2-gusA fusion should also prove useful for monitoring the plant reaction to a variety of R. meliloti mutants with altered symbiotic characteristics. In particular, the very precocious ex- pression of reporter gene activity in root epidermal cells should provide an excellent marker for studying the response to mu- tants that produce modified Nod factors, and may even lead to a convenient and sensitive assay for the lipooligosaccha- ride factors themselves.

METHODS

Plant Material and Growth Conditions

Plants of Medicago truncatula cv Jemalong were grown aeroponically and inoculated with the wild-type Rhizobium meliloti RCR2011, as pre- viously described (Gallusci et al., 1991). Cuttings of the M. varia genotype A2 (Deak et al., 1986) were kindly provided by G. B. Kiss (Szeged, Hungary) and were propagated vegetatively in axenic cul- ture on SH agar medium (Schenk and Hildebrandt, 1972) containing 1% sucrose. For nodulation experiments, cuttings of transgenic M. varia plants were grown aeroponically using the same conditions as for M. truncatula. After 2 to 3 weeks, plants were inoculated with either R. meliloti RCR2011 or the control non-nodulating nodA- mutant strain (GM15386; Debellé et al., 1986). Whole root fragments or nodules were collected at various times after inoculation and treated as described below.

Purification of Nucleic Acids and Filter Hybridization

The isolation and purification of high molecular weight genomic DNA from leaves of M. truncatula cv Jemalong, M. sativa cv Gemini, and Pisum sativum cv Rondo were carried out as described in Barker et al. (1988). Total RNA was extracted from M. truncatula nodules har- vested at various times after inoculation with R. meliloti according to Lullien et al. (1987). Electrophoresis of restricted genomic DNA on non- denaturing agarose gels and of denatured total RNA on 6% formaldehyde-agarose gels was performed according to Sambrook et al. (1989). Transfer to GeneScreen membranes (Du Pont-New En- gland Nuclear) and subsequent hybridization at 37OC in the presence of 50% formamide and 10% dextran sulfate were carried out follow- ing the manufacturer's instructions. After hybridization, blots were

Medicago ENODl2 Gene Transcription 1209

washed in 2 x SSC (1 x SSC is 0.15 M NaCI, 0.015 M sodium citrate), 0.1% SDS at temperatures between 55 and 65OC. Radioactive probes were prepared by the oligolabeling procedure (Feinberg and Vogelstein, 1983) using U-~~P-~CTP, and unincorporated nucleotides were sub- sequently removed by spin dialysis through Sepharose CL 6B (Pharmacia, Sweden).

lsolation of a Genomic Clone Containing the M. truncatula ENOD12 Gene

The construction and screening protocol of the genomic library of M. fruncafula leaf DNA prepared in the phasmid vector pGY97 (Vincze and Kiss, 1990) has already been described (Gallusci et al., 1991). A pea ENOD12 cDNA probe (Scheres et al., 1990), kindly provided by T. Bisseling (Wageningen, The Netherlands), was used to identify posi- tive clones within the library. Hybridization conditions were the same as those used for genomic DNA gel blot analysis (see above). One of these clones, pMtl2, was partially sequenced and found to contain a gene (MtENOD12) whose coding sequence is highly homologous to pea ENODl2 (see text). This clone has a total insert size of approxi- mately 8.8 kb, and Figure 2A shows the partial restriction map of the insert and the location of the MtENOD12 gene.

DNA Sequenclng

The sequence of the Sphl-Mscl DNA fragment that covers the MtENOD12 coding region and immediate flanking sequences (Figure 2) was determined by subcloning short restriction fragments (200 to 300 bp) into the multipurpose vector pUC19. To obtain the sequence of both DNA strands, the dideoxy chain termination reaction (Sanger et al., 1977) was carried out using double-stranded templates (Murphy and Kavanagh, 1988) and polymerase priming from both ends of the pUC19 polylinker. The junction sequences between adjacent fragments were confirmed either by using overlapping clones or by sequencing from synthetic oligonucleotide primers. The nucleotide sequence data reported in this paper has been submitted to EMBL, GenBank, and DDBJ as accession number X68032.

In Situ Hybridlzation

For the preparation of the single-stranded RNA probes, the 05-kb Sphl- BamHl restriction fragment from the MtENOD12 genomic clone was subcloned into pBlueScript SK+ (Stratagene). Synthesis and partial hydrolysis of radiolabeled sense and antisense RNA were carried out as described in de Billy et al. (1991). In situ hybridizations on 7-bm- thick sections using 35S-labeled RNA probes were performed as de- scribed previously (de Billy et al., 1991), except for the addition of a 24-hr prehybridization step using the standard hybridization buffer mi- nus dextran sulfate.

Constructlon of a Transcriptional MtENOD12 Promoter-gusA Fuslon

As afirststep, the 23kb DNA fragment lying upstream of theMt€NODl2 ATG translation initiation codon (Figure 2) was amplified using the poly- merase chain reaction (PCR) to introduce appropriate restriction sites at either end of the fragment. The genomic clone pMtl2 was used as

a template for a PCR, using the phosphorylated forward primer P1 (5’-TTAGGAAITC(EcoRI)ATATACATGGGGGAG-3’) and reverse primer P2 (5’-GGAAGCCATGG(Ncol)TAAGTAGTAATTTT-3’); the bases under- lined in the primer sequences correspond to substitutions in the genomic sequence. Twenty cycles of amplification were performed (94% for 1 min, 57OC for 1 min, 72°C for 3 min) under otherwise stan- dard PCR conditions (Gelfand and White, 1990). The PCR product was then blunt-ended using T4 DNA polymerase (Sambrook et al., 1989) and cloned into Smal-linearized pUC19 to obtain pUC19-prMtl2.

Sequence analysis of five such clones failed to reveal a single error within the 300-nucleotide stretch that lies immediately upstream of the ATG codon, suggesting a very low error frequency for the Taq DNA polymerase under our experimental conditions. Because of the pres- ente of a second Ncol site within the MtENOD12 promoter (Figure 2), it was necessary to carry out a partial digestion of pUC19-prMtl2 after linearization with EcoRl to recover the full-length 23-kb EcoRI-Ncol fragment. This promoter fragment was then cloned between the EcoRl and Ncol polylinker sites of pCCOGUS (Axelos et al., 1989) so that subsequent digestion with EcoRl and Pstl would yield a DNA frag- ment containing the MtENOD12 promoter fused to the gusA coding sequence with a 3‘ flanking polyadenylation signal (cauliflower mo- saic virus 35s). After adding an Sstl site to the 3’terminus, the resultant fragment was cloned between the unique EcoRl and Sstl sites of the binary vector pLPl00 to give pLP100-prMt12. Plasmid pLPl00 (a kind gift of I? Ratet, Gif-sur-Yvette, France) is a derivative of pBinl9 (Bevan, 1984). As a result of the preceding manipulations, the MtfNOD12 pro- moter sequence upstream of the P-glucuronidase (gusA) coding region is identical to that in the MtfNOD12 gene itself, except for the substi- tution of two C residues for the two A residues at positions -1 and -2. The resultant junction sequence -ACCATG-, which has been veri- fied by sequencing pLP100-prMt12, satisfies the preferences shown by plant genes for the three nucleotide positions that precede the ATG codon (Cavener and Ray, 1991).

Transformation of M. varia and Recovery of Transgenic Plants

The binary vector pLP100-prMt12 was mobilized into the Agmbacterium tumefaciens LBA4404 (Hoekema et al., 1983) according to the proce- dure described by Holsters et al. (1978), with three freeze-thaw cycles, and transformed A. tumefaciens colonies were selected by growth on 50 pglmL kanamycin. Leaf segments of M. varia A2 were transformed via A. tumefaciens, and somatic embryogenesis was induced on kanamycin-resistant callus tissue as described by Chabaud et al. (1988). Embryos were matured on the modified UM medium of Strickland et al. (1987), with the addition of 5 glL charcoal (T. Huguet, personal com- munication). The regenerated primary transformants were grown in axenic culture on SH medium (Schenk and Hildebrandt, 1972) with 1% sucrose and propagated by taking cuttings. Patterns of reporter gene expression from the MtENOD12 promoter-gusA fusion were un- altered even after numerous cycles of vegetative propagation.

Histochemical Localization of GUS Activity

Histochemical staining for GUS activity was performed as previously described (Jefferson et al., 1987) with the following modifications. Whole root fragments or nodules were excised from the plant and prefixed byvacuum infiltration with an ice-cold solution of 0.3Vopformaldehyde in 0.1 M potassium phosphate buffer, pH 7.0, followed by incubation on ice for 45 min. After two washes in the phosphate buffer, whole

1210 The Plant Cell

organs were immersed in the GUS substrate solution containing 1 mM X-gluc (5-bromo-4-chloro-3-indolyl glucuronide, cyclohexylammonium salt; Biosynth AG, Staad, Switzerland), 5 mM EDTA, 0.5 mM potas- sium ferricyanide, O5 mM potassium ferrocyanide, and 0.1 M potassium phosphate buffer, pH 7.0. lncubation was performed in the dark at 37% for periods of time between 4 and 24 hr, depending upon the intensity of the coloration. After rinsing in phosphate buffer, stained tissues were observed either as whole specimens or as sections (80 pm thick; Microcut H 1200; Bio-Rad) with an Olympus Vanox light microscope using bright-field optics. To improve the contrast between stained and nonreactive tissues, the samples were briefly cleared with sodium hypochlorite (Boivin et al., 1990). Using these methods, endogenous GUS activity was never observed in either root or root nodule tissues from untransformed alfalfa plants.

For the localization of GUS activity at the cellular level, nodules were dissected from stained nodulated root segments and then, succes- sively, postfixed for 1 hr in 2.5% glutaraldehyde buffered with 0.2 M sodium cacodylate, pH 7.2, rinsed in the same buffer, dehydrated in an alcohol series, and embedded in Epon resin (Merck, Darmstadt). Sections (1 to 2 pm thick) were counterstained with basic fuchsin (2% in distilled water) and observed by bright-field microscopy.

ACKNOWLEDGMENTS

We are very grateful to Ton Bisseling, Wageningen, The Netherlands, for providing us with the pea ENOD12 probe and to Gyorgy 8. Kiss, Szeged, Hungary, for cuttings of the M. varia genotype A2. We would also like to thank colleagues in the laboratory for their constructive criticisms of the manuscript.

Received June 18, 1992; accepted August 17, 1992.

REFERENCES

Axelos, M., Bardet, C., Llboz, T., Le Van Thai, A., Curie, C., and Lescure, 8. (1989). The gene family encoding the Arabidopsis thaliana elongation factor EF-1 a: Molecular cloning, characteriza- tion and expression. MOI. Gen. Genet. 219, 106-112.

Barker, D.G., Gallusci, P., Lullien, V., Khan, H., Ghbrardi, M., and Huguet, T. (1988). ldentification of two groups of leghemoglobin genes in alfalfa (Medicago sativa) and a study of their expression during root nodule development. Plant MOI. Biol. 11, 761-772.

Barker, D.G., Bianchi, S., Blondon, F., DattB, Y., Duc, G., Flament, P., Gallusci, R, Gbnier, R, Guy, R, Muel, X., Tourneur, J., DBnarib, J., and Huguet, T. (1990). Medicago truncatula, a model plant for studying the molecular genetics of the Rhizobium-legume symbio- sis. Plant MOI. Biol. Rep. 8, 40-49.

Bevan, M.W. (1984). Binary Agrobacterium vectors for plant transfor- mation. Nucl. Acids Res. 12, 8711-6721.

Bhuvaneswari, T.V., Bhagwat, A.A., and Bauer, W.D. (1961). Tran- sient susceptibility of root cells in four common legumes to nodulation by rhizobia. Plant Physiol. 68, 1144-1149.

Boivin, C., Camut, S., Malplca, C.A., Ruchet, G., and Rosenberg, C. (1990). Rhizobium meliloti genes encoding catabolism of trigonel- line are induced under symbiotic conditions. Plant Cell2,1157-1170.

Caetanodnoll6ss, G., and Gresshoff, P.M. (1991). Alfalfa controls nodu- lation during the onset of Rhizobium-induced cortical cell division. Plant Physiol. 95, 366-373.

Cavener, D.R., and Ray, S.C. (1991). Eukaryotic start and stop trans- lation sites. Nucl. Acids Res. 19, 3185-3192.

Chabaud, M., Passiatore, J.E., Cannon, F., and Buchanan-Wollaston, V. (1988). Parameters affecting the frequency of kanamycin-resistant alfalfa obtained by Agrobacterium tumefaciens-mediated transfor- mation. Plant Cell Rep. 7, 512-516.

Deak, M., Kiss, G.B., Koncz, C., and Dudits, D. (1986). Transforma- tion of Medicago by Agrobacferium-mediated gene transfer. Plant Cell Rep. 5, 97-100.

Debellb, F., Rosenberg, C., Vasse, J., Maillet, F., Martinez, E., Dbnarib, J., and Truchet, G. (1986). Assignment of symbiotic de- velopmental phenotypes to common and specific nodulation (nod) genetic loci of Rhizobium meliloti. J. Bacteriol. 168, 1075-1086.

de Billy, F., Barker, D.G., Gallusci, t?, and Trochet, G. (1991). Leghae- moglobin gene transcription is triggered in a single cell layer of the indeterminate nitrogen-fixing root nodule of alfalfa. Plant J. 1,27-35.

Dbnarib, J., and Roche, P. (1992). Rhizobium nodulation signals. In Molecular Signals in Plant-Microbe Interactions, D.P.S. Verma, ed (Boca Raton, FL: CRC Press), pp. 295-324.

Diaz, C.L., Melchers, L.S., Hooykaas, P.J.J., Lugtenberg, B.J.J., and Kijne, J.W. (1989). Root lectin as a determinant of host-plant specificity in the Rhizobium-legume symbiosis. Nature 338,579-581.

Feinberg, AR, and Vogelstein, 8. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6-13.

Fisher, R.F., and Long, S.R. (1992). Rhizobium-plant signal exchange. Nature 357, 655-660.

Gallusci, P., Dedieu, A., Journet, E.P., Huguet, T., and Barker, D.G. (1991). Synchronous expression of leghaemoglobin genes in Med- ícago truncatula during nitrogen-fixing root nodule development and response to exogenously supplied nitrate. Plant MOI. Biol. 17, 335-349.

Gelfand, D.H., and White, T.J. (1990). Thermostable DNA polymer- ases. In PCR Protocols: A Guide to Methods and Applications, M.A. Innis, D.H. Gelfand, J.J. Sninsky, and T.J. White, eds (New York: Academic Press), pp. 129-141.

Gloudemans, T., Bhuvaneswari, T.V., Moerman, M., van Brussel, T., van Kammen, A., and Bisseling, T. (1989). lnvolvement of Rhizo- bium leguminosarum nodulation genes in gene expression in pea root hairs. Plant MOI. Biol. 12, 157-167,

Govers, F., Harmsen, H., Heldstra, R., Michlelsen, P., Prins, M., van Kammen, A., and Bissellng, T. (1991). Characterization of the pea ENODl2B gene and expression analyses of the two ENODlP genes in nodule, stem and flower tissue. MOI. Gen. Genet. 228,

Hoekema, A., Hirsch, P.R., Hooykaas, P.J.J., and Schilperoort, R.A. (1983). A binary plant vector strategy based on separation of vir- and T-regions of the Agrobacterium tumefaciens Ti-plasmid. Nature

Holsters, M., de Waele, D., Depicker, A., Messens, E., Van Montagu, M., and Schell, J. (1978). Transfection and transformation of A. tumefaciens. MOI. Gen. Genet. 163, 181-187.

Hong, J.C., Nagao, R.T., and Key, J.L. (1990). Characterization of a proline-rich cell wall protein gene family of soybean. J. Biol. Chem.

160-166.

303, 179-180.

265, 2470-2475.

Medicago ENODl2 Gene Transcription 121 1

Jetferson, R.A., Kavanagh, T.A., and Bevan, M.W. (1987). GUS fu- sions: P-Glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EM60 J. 6, 3901-3907.

Kijne, J.W. (1991). The Rhizobium infection process. In Biological Nitro- gen Fixation, G. Stacey, H. Evans, and R. Burris, eds (London: Chapman and Hall), pp. 348-397.

Lerouge, P., Roche, P., Faucher, C., Malllet, F., Truchet, G., PromQ, J.-C., and DenariQ, J. (1990). Symbiotic host-specificity of Rhizo- bium meliloti is determined by a sulphated and acylated glucosamine oligosaccharide signal. Nature 344, 781-784.

Long, S.R. (1989). Rhizobium-legume nodulation: Life together in the underground. Cell 56, 203-214.

Lullien, V., Barker, D.G., de Lajudle, P., and Huguet, T. (1987). Plant gene expression in effective and ineffective root nodules of alfalfa (Medicago sativa). Plant MOI. Biol. 9, 469-478.

Murphy, G., and Kavanagh, T. (1988). Speeding-up the sequencing of double-stranded DNA. Nucl. Acids Res. 16, 5198.

Nap, J.-P., and Bissellng, T. (1990). Developmental biology of a plant-prokaryotic symbiosis: The legume root nodule. Science 250,

Petlt, A., Stougaard, J., Kühle, A., Marcker, K.A., and TempQ, J. (1987). Transformation and regeneration of the legume Lotus cor- niculatus: A system for molecular studies of symbiotic nitrogen fixation. MOI. Gen. Genet. 207, 245-250.

Roche, I?, DebellQ, F., Malllet, F., Lerouge, P., Faucher, C., Truchet, G., DQnarlQ, J., and PromQ, J.-C. (1991). Molecular basis of symbi- otic host specificity in Rhizobium meliloti: nodH and nodPQ genes encode the sulfation of lipo-oligosaccharide signals. Cell 67,

Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular Clon- ing: A Laboratory Manual, 2nd ed. (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press).

Sanger, F., Nlcklen, S., and Coulson, A.R. (1977). DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74,

948-954.

1 131 -1 143.

5463-5467.

Schenk, R.V., and Hildebrandt, A.C. (1972). Medium and techniques for induction and growth of monocotyledonous and dicotyledonous plant cell cultures. Can. J. Bot. 50, 199-204.

Scheres, B., van de Wiel, C., Zalensky, A., Horvath, B., Spaink, H., van Eck, H., Zwartkruis, F., Wolters, A.-M., Gloudemans, T., van Kammen, A., and Bisseling, T. (1990). The fNOM2 gene prod- uct is involved in the infection process during the pea-Rhizobium interaction. Cell 60, 281-294.

Spaink, H.P., Sheeley, D.M., van Brussel, A.A.N., Glushka, J., York, W.S., Tak, T., Geiger, O., Kennedy, E.P., Reinhold, V.N., and Lugtenberg, B.J.J. (1991). A nove1 highly unsaturated fatty acid moi- ety of Iipo-oligosaccharide signals determines host specificity of Rhizobium. Nature 354, 125-130.

Strickland, S.G., Nlchol, J.W., McCall, C.M., and Stuart, D.A. (1987). Effect of carbohydrate source on alfalfa somatic embryogenesis. Plant Sci. 48, 113-121.

Truchet, O., Roche, P., Lerouge, P., Vasse, J., Camut, S., de Billy, F., PromQ, J.-6, and Denarib, J. (1991). Sulphated lipo-oligo- saccharide signals of Rhizobium meliloti elicit root nodule organogenesis in alfalfa. Nature 351, 670-673.

van de Wiel, C., Scheres, E., Franssen, H., van Lierop, M.J., van Lammeren, A., van Kammen, A., and Bisseling, T. (1990). The early nodulin transcript fNOD2 is located in the nodule-specific pa- renchyma (inner cortex) of pea and soybean nodules. EMBO J. 9,l-7.

Vasse, J., de Billy, F., Camut, S., and Truchet, G. (1990). Correlation between ultrastructural differentiation of bacteroids and nitrogen fix- ation in alfalfa nodules. J. Bacteriol. 172, 4295-4306.

Verma, D.P.S. (1992). Signals in root nodule organogenesis and en- docytosis of Rhizobium. Plant Cell 4, 373-382.

Vincze, E., and Kiss, G.B. (1990). A phosphate group at the COS ends of phage lambda is not a prerequisite for in vitro packaging: An al- ternative method for constructing genomic libraries using a new phasmid vector, pGY97. Gene 96, 17-22.

Von Heijne, G. (1983). Patterns of amino acids near signal-sequence cleavage sites. Eur. J. Biochem. 133, 17-21.

Wyatt, R.E., Nagao, R.T., and Key, J.L. (1992). Patterns of soybean proline-rich protein gene expression. Plant Cell 4, 99-110.

DOI 10.1105/tpc.4.10.1199 1992;4;1199-1211Plant Cell

M Pichon, E P Journet, A Dedieu, F de Billy, G Truchet and D G Barkerdifferentiating root epidermis of transgenic alfalfa.

Rhizobium meliloti elicits transient expression of the early nodulin gene ENOD12 in the

 This information is current as of June 25, 2018

 

Permissions X

https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298

eTOCs http://www.plantcell.org/cgi/alerts/ctmain

Sign up for eTOCs at:

CiteTrack Alerts http://www.plantcell.org/cgi/alerts/ctmain

Sign up for CiteTrack Alerts at:

Subscription Information http://www.aspb.org/publications/subscriptions.cfm

is available at:Plant Physiology and The Plant CellSubscription Information for

ADVANCING THE SCIENCE OF PLANT BIOLOGY © American Society of Plant Biologists