CentralBringing Excellence in Open Access

JSM Microbiology

Cite this article: Tesalona S, Lagamayo E, Cabal AB (2017) Antibiotic Profiling and Detection of blaVIM-2, blaIMP-1, and blaSPM-1 in Carbapenem-Resistant Pseu-domonas aeruginosa Isolated in Selected Tertiary Hospitals in Metro Manila, Philippines. JSM Microbiology 5(3): 1045.

*Corresponding authorSherill Tesalona, Department of Medical Technology, University of Santo Tomas, 1015 Manila, Philippines, Tel: 639178283595; Email:

Submitted: 19 June 2017

Accepted: 20 October 2017

Published: 23 October 2017

Copyright© 2017 Tesalona et al.

OPEN ACCESS

Keywords•Carbapenem•Pseudomonasaeruginosa•Metallo-β-lactamase•Polymerase chain reaction•E-test

Review Article

Antibiotic Profiling and Detection of blaVIM-2, blaIMP-1, and blaSPM-1 in Carbapenem-Resistant Pseudomonas aeruginosa Isolated in Selected Tertiary Hospitals in Metro Manila, PhilippinesSherill Tesalona1,2*, Evelina Lagamayo3, and Ace Bryan Cabal4

1The Graduate School, University of Santo Tomas, Philippines2Department of Medical Technology, University of Santo Tomas, Philippines3Department of Laboratory Medicine, University of Santo Tomas, Philippines 4Biology Department, College of Science, Adamson University, Philippines

Abstract

Antibiotic resistance profile and the presence of several metallo-β-lactamase (MBL) genes conferring resistance to carbapenem were investigated in this study. Previously identified carbapenem-resistant Pseudomonas aeruginosa(P. aeruginosa) were tested for MBL enzymes using E-test. Amplification of blaVIM-2, blaIMP-1, and blaSPM-1 was done using conventional polymerase chain reaction (PCR). Antibiotic resistance pattern of each antibiotic tested among MBL and non-MBL producing strains were statistically tested using Fisher exact test. Any p ≤ 0.05 were considered significant. Of the 39 CRPA collected and tested, 10 MBL producing strains were detected, 9 (23.1%) carried the blaIMP-1 and 1 (2.5%) carried the blaVIM-2, whereas blaSPM-1 was not observed. Increased resistance against ceftazidime, piperacillin/tazobactam, and ciprofloxacin in blaIMP-1 and blaVIM-2 -producing strains showed significant difference compared to non-blaIMP-1 and non-blaVIM-2 producing strains (p<0.05). On the other hand, blaIMP-1 and blaVIM-2 producing strains with increased resistance to cefepime, and gentamicin has no significant difference when compared to non-blaIMP-1 and non-blaVIM-2 producing strains (p>0.05). This study concludes the presence of blaIMP-1 and blaVIM-

2-producing P. aeruginosa in the Philippines represented by the two [2] out of three [3] tertiary hospitals in Metro Manila that participated in this study. The presence of these MBL genes poses a threat in the pharmaceutical and medical industries. Furthermore, the detection of these genes can be used in a rational design of diagnostic platforms.

ABBREVIATIONSblaIMP: Imipenem Hydrolyzing Metallo-β-lactamase; blaVIM:

Verona Integron Metallo-β-lactamase; blaSPM: Sao-Paolo Metallo-β-lactamase; MBL: Metallo-β-lactamase; PCR: Polymerase Chain Reaction; CRPA: Carbapenem-resistant Pseudomonas aeruginosa

INTRODUCTIONPseudomonas aeruginosa (P. aeruginosa) is a gram-negative

non-fermentative bacillus that is ubiquitous in nature and a major cause of healthcare-associated infection. It can survive at temperature ranging from 4-42 °C and with low levels of nutrients. These characteristics are reasons why they can survive on medical equipment and on other hospital surfaces, which favors the beginning of infections in immuno - compromised patients [1]. The increasing prevalence of carbapenem-resistance in major nosocomial pathogens such as P. aeruginosa necessitates

intensive measures for diagnosis and treatment, and correct use of antibiotics.

Carbapenems including imipenem (IPM or IP) and meropenem (MEM) are beta (β) lactam antibiotics regarded as the primary choice and the most potent drugs for treatment of Gram-negative bacteria including P. aeruginosa that are multi-drug resistant [2,3]. However, there has been an increasing incidence of carbapenem resistance due to the expression of metallo-β-lactamases (MBLs), the class B β-lactamase.

The simplest classification of β-lactamases is by protein sequence, whereby the β-lactamases are classified into four molecular classes, A, B, C, and D, based on conserved and distinguishing amino acid motifs [4]. Classes A, C, and D include enzymes that hydrolyze their substrates by forming an acyl enzyme through an active site serine, whereas class B β-lactamases are metallo-enzymes that utilize at least one active-

CentralBringing Excellence in Open Access

Tesalona et al. (2017)Email:

JSM Microbiology 5(3): 1045 (2017) 2/5

site zinc ion to facilitate β-lactam hydrolysis. Molecular class B types of β-lactamases are all metallo-enzymes that require bivalent metal ions, usually zinc for their activity [5-7].

The main focus of this study is the ambler class B enzymes, or group 3 enzymes as classified by the Bush-Jacoby system include metallo-𝛽-lactamases (MBLs), which require Zn2+ as a cofactor. Bacteria that produce these enzymes show resistance to all 𝛽-lactams, including penicillins, cephalosporins, carbapenems, and 𝛽-lactamase inhibitors, except aztreonam. Genes encoding MBLs are found on plasmids; hence, they are easily transmitted to other microorganisms. The most common metallo-𝛽-lactamases (MBLs) are imipenemase metallo-𝛽- lactamases (IMP), Verona integron encoded metallo-𝛽-lactamases (VIM), and the newly described New Delhi metallo-beta-lactamase-1 (NDM-1) enzymes [8].

Infections with antibiotic-resistant pathogens as declared by the World Health Organization (WHO) is an increasingly problematic global disease and a major public health threat worldwide. The worldwide dissemination of acquired MBL genes and the emergence of new variants are becoming an emerging threat to public health because they are usually carried by mobile genetic elements that disseminate rapidly [9,10]. MBLs cause challenge to health care systems since the only option of treatment are polymyxin B and colistin which are potentially toxic [11]. The Philippines is not immune to the problem of antibiotic-resistant pathogens. Philippine data show that the trend is alarmingly increasing based on the executive summary of Antibiotic Resistance Surveillance Program[12]. To date, there is no published information prior to this study regarding the prevalence of MBLs in particular the blaVIM-2 blaIMP-1, and blaSPM-1 type in carbapenem-resistant P. aeruginosa (CRPA) in Metro Manila, much less among Filipinos.

This study was undertaken to determine the occurrence of blaIMP-1, blaVIM-2 and blaSPM-1 type of MBL genes which are the most common types of MBL gene with worldwide distribution, while other members are restricted in particular geographic regions [7,9,13]. This study also determined the source of clinical specimens where the blaIMP-1, blaVIM-2, and blaSPM-1 producing strains of P.aeruginosa are frequently isolated. Lastly, to compare the antimicrobial resistance patterns of blaIMP-1, blaVIM-2, and blaSPM-1 producing strains and non-producing strains.

MATERIALS AND METHODSBacterial Isolates

The total of 39 CRPA clinical isolates were obtained from 3 participating tertiary hospitals in Metro Manila. All clinical samples obtained were taken as part of the standard of care. All samples were analysed anonymously and only bacterial isolates were examined. Since there was no direct interaction or influence to the patients during the course of the study, ethical clearance was waived.

Phenotypic detection of MBL

All 39 CRPA isolates including the positive control (Acinetobacter baumannii with known IMP-1 gene) and negative control (P. aeruginosa ATCC 27853) were tested phenotypically for the presence of MBLs by E test. The protocol used was followed

according to manufacturer’s instruction. In the presence of MBL, MIC ratio of carbapenem/carbapenem plus EDTA must be ≥ 8 ug/ml. Phantom zone and deformation of ellipses were also interpreted as positive for MBLs.

Molecular Detection of drug-resistance determinants

All 39 isolates that has been phenotypically tested for MBL were tested again using PCR for the detection of blaIMP-1, blaVIM-2 and blaSPM-1. Preparation of DNA lysate was followed from the protocol used by Osmundson et al., 2013 [14]. All nucleic acid was amplified using Thermal Cycler UVDI (Esco Healthcare). The following primers were used to amplify MBL genes (bla genes): IMP-1 Forward TGAGCA AGTTATCTGTATTC and Reverse TTAGTTGCTTGGTT TTGATG with a size of 740 bp amplicon; VIM-2 Forward AAAGTTATGCCGCACTCACC and Reverse TGCAACT TCATGTTATGCCG with a size of 865 bp amplicon; and SPM-1 Forward CCTACA ATCTAACGGCGACC and Reverse TCGCCGTGTCCAGGTATAAC with a size of 650 bp amplicon. The primers were reconstituted according to manufacturer’s instruction and stored at -20 °C. Gel electrophoresis was performed using Electrophoresis machine (CBS Scientific). One kb DNA ladder, agarose gel, 1x TAE buffer, Gel Red dye and 6x loading dye were used [7].

CONTROLSPositive control

Strain of A. baumannii with a known IMP-1gene confirmed by DNA sequencing and BLAST, was used as positive control. The positive control has query coverage of 95.0% and 88.0% similarity based on BLAST search of IMP sequence. This was used as a positive control because it has blaIMP-1 gene in the plasmid that can also be detected in other bacteria other than A.baumannii.

Negative control

Pyrogen, DNAse and RNAase – free water was used as negative control.

RESULTS AND DISCUSSIONPatients demographic profile

The majority of the study isolates 34 (87.2%) were collected from hospitalized patients, mostly from intensive care units (ICU) and only 5 (12.8%) were collected from out-patients; 23 (58.9%) of them were male and 27 (69.2%) are on their late adult stage (61-90 years old). Moreover, the 10 (25.6%) CRPA isolates tested positive for blaIMP-1 and blaVIM-2 were mostly collected from 9 (90%) hospitalized patients and only 1 strain was isolated from out-patient; 6 (60%) of them were male and 7 (70%) were on the late adult stage. The data mentioned though not included in the researcher’s objective is significant in research concerning medical microbiology.

Phenotypic and genotypic results

Based on the phenotypic (MBL E-test) and genotypic test (PCR) of the 39 CRPA isolates collected from 3 tertiary hospitals in Metro Manila from January to September 2014, the following data were gathered:

MBL E test: MBL E test was positive in 11 (28.2%) strains,

CentralBringing Excellence in Open Access

Tesalona et al. (2017)Email:

JSM Microbiology 5(3): 1045 (2017) 3/5

negative in 24 (61.5% and undetermined in 4 (10.3%) out of 39 CRPA isolates tested. Among 11 strains positive for MBL E test, 6 (15.4%) strains were confirmed positive and 5 (12.8%) were confirmed negative for blaIMP-1, blaVIM-2 and blaSPM-1 by PCR and detection of MBL gene other than blaIMP-1, blaVIM-2, and blaSPM-1 is recommended. The false positive results of E test can be associated to bactericidal activity of EDTA that enhances zone of inhibition to strains that are not MBL producers. False positive results can also be attributed to loss or reduced expression of OprD [15]. Furthermore, the 4 (10.3%) strains that were undetermined in E test and were confirmed positive for MBL gene by PCR could be associated to limitations of E test to detect MBLs only in strains with high level enzyme production.

Polymerase chain reaction: It was confirmed in this study that among 39 CRPA tested, 9 (23.1%) isolates carried blaIMP-1 (740 bp), 1 (2.5%) isolate carried blaVIM-2 (865 bp), whereas, no blaSPM-1 were detected (650 bp) as shown in (Table 1,2) and (Figure 1). Even though early recognition of MBL through routine laboratory testing is important, care should be taken when phenotypic tests are interpreted based on inhibitor synergy. PCR should also be performed to validate results.

Source of Clinical Specimens: (Table 3) shows that the 39 CRPA isolates were mostly obtained from respiratory specimens 24 (62%) followed by urine 7 (18%), exudative specimens 6 (15%) and blood 2 (5%). The blaIMP-1were mostly amplified from strains isolated from endotracheal aspirate 6 (60%), while both blaIMP-1 and blaVIM-2 were detected from strains isolated from urine specimens 4 (40%). Furthermore, blaSPM-1 was not amplified from any specimens. Both blaIMP-1and blaVIM-2 was not detected in blood and exudative specimens which includes wound discharges and abscesses. To control the spread of P. aeruginosa in the hospital, it is necessary to identify its source or the potential reservoirs of the organism and the modes of transmission. Hence genes encoding MBLs are found on plasmids, they are easily transmitted to other microorganisms.The infection control management needs to

be strictly implemented when using ventilating machines and careful insertion and monitoring of the used of catheter should be followed. MBLs harbors’ within plasmids or transposons that act as the genetic vehicles, for dissemination of drug resistance and transmission cycle must be interrupted by implementing infection control measures most especially by health care workers.

Antibiotic resistance profile: Of the 10 blaIMP-1 and blaVIM-2 producing strains detected, the following antibiotic resistance pattern were observed: 10 (100%), 9 (90%), and 8 (80%) showed increased resistance against ceftazidime, piperacillin/tazobactam, and ciprofloxacin, with significant difference when compared to non-blaIMP-1 and non-blaVIM-2 producing strains, with 12 (41%), 13 (45%), and 9 (31%), (p<0.05), the increase resistance could be associated due to the presence of blaIMP-1 and blaVIM-2. Seven (70%) and 6 (60%) blaIMP-1 and blaVIM-2 producing strains also expressed increased resistance to cefepime and gentamicin, with no significant difference when compared to non-blaIMP-1 and non-blaVIM-2 producing strains, with 11 (38%) and 6 (21%), (p>0.05), the increased resistance may not be associated to the presence of blaIMP-1 and blaVIM-2 alone. It could be due to other resistance mechanism such as loss/altered or reduced expression of OprD, hyperproduction of AmpC enzymes and up-regulation of the MexAB-OprM efflux pump. Colistin appeared to be the most effective antimicrobial agent, with 0% resistance to both blaIMP-1 and blaVIM-2 producing and non-producing strains. Amikacin appeared to be the second most active drug with 2 (20%) resistance to blaIMP-1 and blaVIM-2 producing strains, with no significant difference when compared to non-blaIMP-1 and non-blaVIM-2 producing strains, with 4 (14%) (p>0.05) suggesting possible association of other resistance mechanisms. In this study, 10 (100%) resistance to carbapenem and ceftazidime, 9 (90%) to piperacillin/tazobactam, 8 (80%) to ciprofloxacin and 10 (100%) sensitivity to colistin is the classic picture of MBL phenotype. Antibiotic resistance profile of 39 CRPA isolates is shown in (Table 3) and (Figure 2).The detection of these genes

Figure 1 Gel electropherogram forblaIMP-1and blaVIM-2Lane 1, positive (+) control; lanes 2, 3, and 4 are samples (+) for blaIMP-1(740 bp); lane 5 is sample (+) for blaVIM-2(865 bp); lane 6, DNA ladder 1000 bp MW and lane 7, negative (-) control

CentralBringing Excellence in Open Access

Tesalona et al. (2017)Email:

JSM Microbiology 5(3): 1045 (2017) 4/5

Figure 2 Antibiotic Resistance Profile of 39 CRPA isolates, blaIMP-1 and blaVIM-2 Producing and non-Producing Strains Interpreted Based on CLSI, 2014, Collected from 3 Selected Tertiary Hospitals in Metro Manila from January to September 2014.

Table 1: Incidence of blaIMP-1,blaVIM-2andblaSPM-1 producing strains in 39 CRPA isolates from three selected tertiary hospitals in Metro Manila collected from January to September 2014 based from PCR.

Genotypes n %

blaIMP-1Positive 9 23.1

blaVIM-2Positive 1 2.6

blaSPM-1Positive 0 0

Negative for blaIMP-1, blaVIM-2 and blaSPM-1 29 74.4

Total 39 100CRPA: Carbapenem-resistant Pseudomonas aeruginosa;PCR: Polymerase Chain Reaction;IMP: Imipenem-hydrolyzing Metallo-β-lactamase; VIM: Verona-integron encoded Metallo-β-lactamase; SPM: Sao - Paolo Metallo-β-lactamase

Table 2: Distribution of blaIMP-1 and blaVIM-2 in CRPA strains from various clinical specimens from three selected tertiary hospitals in Metro Manila collected from January to September 2014.

Specimens

blaIMP-1/blaVIM-2 Total CRPAPositive Negative

n %n % n %

Respiratory Specimens (ETA=21, Sputum=3) 6 15.4 18 46.2 24 61.6

Urine 4 10.2 3 7.7 7 17.9

Exudative Specimens (Wound discharge=2; others=4) - - 6 15.4 6 15.4

Blood - - 2 5.1 2 5.1

Total 10 25.6 29 74.4 39 100

CRPA: Carbapenem-resistant Pseudomonas aeruginosa; ETA: Endotracheal aspirate; IMP: Imipenem-hydrolyzing Metallo-β-lactamase; VIM: Verona-integron encoded Metallo-β-lactamase; SPM: Sao- Paolo Metallo-β-lactamase

implied a need to monitor antibiotic therapies, and strictly implement antibiotic stewardship. Furthermore, the detection of such genes can be used in a rational design of a diagnostic platform.

CONCLUSIONSThis study concludes the presence of blaIMP-1 and blaVIM-2 in

the Philippines represented by the 2 out of 3 tertiary hospitals in Metro Manila that participated in this study from January to September 2014. The detection of these genes indicates the need to monitor antibiotic therapies and the worst is the need to look for an alternative antibiotic or an antibiotic with higher spectrum of activity. Perhaps, the detection of these genes can be used as a rational design in the development of antimicrobials which

CentralBringing Excellence in Open Access

Tesalona et al. (2017)Email:

JSM Microbiology 5(3): 1045 (2017) 5/5

Table 3: Antibiotic resistance profile of 39 CRPA isolates, blaIMP-1/blaVIM-2 and non-blaIMP-1/non-blaVIM-2 producing strains interpreted based on CLSI, 2014, collected from 3 selected tertiary hospitals in Metro Manila, Philippines from January to September 2014.

Antibiotics CRPA isolates(n=39)

blaIMP-1 and blaVIM-2 producing strains

(n=10)

blaIMP-1 and blaVIM-2 non-producing strains

(n=29)P-value Conclusion

Ceftazidime 22 (51%) 10 (100%) 12 (41%) 0.002 S

Ciprofloxacin 17 (44%) 8 (80%) 9 (31%) 0.019 SPiperacillin

/Tazobactam 22 (56%) 9 (90%) 13 (45%) 0.029 S

Gentamicin 12 (26%) 6 (60%) 6 (21%) 0.059 NS

Cefepime 18 (44%) 7 (70%) 11 (38%) 0.165 NS

Amikacin 6 (15%) 2 (20%) 4 (14%) 0.981 NS

Colistin 0 0 0 - -

Tested at p=0.05CRPA: Carbapenem-resistant Pseudomonas aeruginosa; PCR:Polymerase Chain Reaction; MBL:Metallo-β-lactamase; NMBL: Non-Metallo-β-lactamase; S: Significant; NS: Not significant

would target the genes or its gene products.

ACKNOWLEDGEMENTSThe authors are thankful to the following:

University of Santo Tomas, Department of Laboratory Medicine; Adamson University, Biology Department; Demeterio L. Valle, Jr. MD; Aaron Jan S. Palmares, MSMT; Kerfelcel B. Retoriano, MPH

REFERENCES1. Kaur DC, Wankhede SV. A study of Biofilm formation &Metallo-

β-Lactamases in Pseudomonas aeruginosa in a tertiary care rural hospital. 2013; 3: 1-7.

2. Khosravi Y, Tee Tay S, Vadivelu J. Metallo-β-lactamase-producing imipenem-resistant Pseudomonas aeruginosa clinical isolates in a university teaching hospital in Malaysia: detection of IMP-7 and first identification of IMP-4, VIM-2, and VIM-11. Diagn Microbiol Infect Dis. 2010; 67: 294-296.

3. Behera B, Mathur P, Das A, Kapil A, Sharma V. An evaluation of four different phenotypic techniques for detection of metallo-β-lactamase producing Pseudomonas aeruginosa. Indian J Med Microbiol. 2008; 26: 233-237.

4. Bush K, Jacoby GA. Updated Functional Classification of β-Lactamases. Antimicrob Agents Chemother. 2010; 54: 969-976.

5. Attal R, Basak S, Mallick S, Bose S. Metallo-beta-lactamase Producing Pseudomonas Aeruginosa: An Emerging Threat to Clinicians. Journal of Clinical and Diagnostic Research [serial online] 2010 August [cited: 2010 August 15 ]; 4:26912696. Journal of Clinical and Diagnostic. 2010; 4: 2691-2696.

6. Horsfall LE, Izougarhane Y, Lassaux P, Selevsek N, Liénard BMR, Poirel

L, et al. Broad antibiotic resistance profile of the subclass B3 metallo-β- lactamase GOB-1, a di-zinc enzyme. FEBS J. 2011; 278: 1252-1263.

7. Queenan AM, Bush K. Carbapenemases: the versatile β-lactamases. Clin Microbiol Rev. 2007; 20: 440-458.

8. Kumarasamy KK, Toleman MA, Walsh TR, Bagaria J, Butt F, Balakrishnan R, et al. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. Lancet Infect Dis. 2010; 10: 597-602.

9. Walsh TR, Toleman MA, Poirel L, Nordmann P. Metallo-β-Lactamases: the Quiet before the Storm? Clin Microbiol Rev. 2005; 18: 306-325.

10. Dortet L, Poirel L, Nordmann P. Further proofs of concept for the carba NP test. Antimicrob Agents Chemother. 2014; 58: 1269.

11. Giske CG, Gezelius L, Samuelsen Ø, Warner M, Sundsfjord A, Woodford N. A sensitive and specific phenotypic assay for detection of metallo-β-lactamases and KPC in Klebsiella pneumoniae with the use of meropenem disks supplemented with aminophenylboronic acid, dipicolinic acid and cloxacillin. Clin Microbiol Infect. 2011; 17: 552-556.

12. Department of Health. Antimicrobial Resistance Surveillance Program. 2013; 19-25.

13. Deshpande P, Rodrigues C, Shetty A, Kapadia F, Hedge A, Soman R. New Delhi Metallo-beta lactamase (NDM-1) in Enterobacteriaceae: treatment options with carbapenems compromised. J Assoc Physicians India. 2010; 58: 147-149.

14. Osmundson TW, Eyre CA, Hayden KM, Dhillon J, Garbelotto MM. Back to basics: An evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples. Mol Ecol Resour. 2013; 13: 66-74.

15. Public Health England. UK Standards for Microbiology Investigations Laboratory Detection and Reporting of Bacteria with. 2014; 1-25.

Tesalona S, Lagamayo E, Cabal AB (2017) Antibiotic Profiling and Detection of blaVIM-2, blaIMP-1, and blaSPM-1 in Carbapenem-Resistant Pseudomonas aeru-ginosa Isolated in Selected Tertiary Hospitals in Metro Manila, Philippines. JSM Microbiology 5(3): 1045.

Cite this article