of April 12, 2018.This information is current as

Responsein Cell Type-Specific Delayed Transcriptionalof the Polymeric Ig Receptor: Role of STAT6 Mechanism of IL-4-Mediated Up-Regulation

Hilde Schjerven, Per Brandtzaeg and Finn-Eirik Johansen

http://www.jimmunol.org/content/165/7/3898doi: 10.4049/jimmunol.165.7.3898

2000; 165:3898-3906; ;J Immunol 

Referenceshttp://www.jimmunol.org/content/165/7/3898.full#ref-list-1

, 18 of which you can access for free at: cites 48 articlesThis article

        average*  

4 weeks from acceptance to publicationFast Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

Submit online. ?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2000 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Mechanism of IL-4-Mediated Up-Regulation of the PolymericIg Receptor: Role of STAT6 in Cell Type-Specific DelayedTranscriptional Response1

Hilde Schjerven,2 Per Brandtzaeg, and Finn-Eirik Johansen

The polymeric IgR (pIgR) mediates transport of dimeric IgA and pentameric IgM across mucosal epithelia, thereby generatingsecretory Abs. Its expression is up-regulated at the transcriptional level by IL-4 in HT-29 cells. In this study, we demonstrate thatIL-4 mediates up-regulation of human pIgR through a 554-bp IL-4-responsive enhancer in intron 1. Mutation of a binding sitefor STAT-6 within this region abolished IL-4-induced enhancement, while an adjacent putative C/EBP site was dispensable. IL-4treatment induced binding of STAT6 to the intronic STAT6 site, but cooperation with nearby upstream and downstream DNAelements was required for IL-4 responsiveness. Furthermore, IL-4-mediated increased transcription of the pIgR-derived en-hancer, like the endogenous pIgR gene, required de novo protein synthesis. Interestingly, a conditionally active form of STAT6sufficed to activate a pIgR-derived enhancer in HT-29 cells, but not in Cos-1 cells, suggesting a requirement for cell type-specificfactors. Thus, STAT6 activation mediates a delayed transcriptional enhancement of pIgR by induction of a de novo synthesizedprotein that cooperates with STAT6 itself bound to its cognate DNA element in intron 1. This mechanism may represent a generalstrategy for how pleiotropic cytokines elicit cell type-specific transcriptional responses.The Journal of Immunology,2000, 165:3898–3906.

T he polymeric IgR (pIgR),3 also known as the transmem-brane secretory component (SC), mediates the generationof secretory Abs (SIgA and SIgM) in exocrine secretions.

Locally produced pIgs (mainly dimeric IgA, but also larger poly-mers of IgA and pentameric IgM) bind to the pIgR basolaterally onsecretory epithelial cells, and are subsequently translocated acrossthe epithelium. At the apical surface, the receptor is cleaved, giv-ing rise to SIgA and SIgM Abs with bound SC as well as free SCderived from unoccupied pIgR (1, 2). Several clinical and exper-imental studies have provided evidence for the importance of SIgAAbs in the protection of mucosal surfaces (3, 4). Recently, pIgRknockout mice have confirmed the essential role of this receptor inthe transport of pIgs to secretions (5, 6). Further analysis of suchmice demonstrated the importance of secretory Abs in maintainingthe barrier function of mucosal linings (5).

pIgR is expressed at mucosal surfaces in human tissues with thehighest expression in the small and large intestine (1). In epithelialcell lines, its expression has been shown to be regulated by severalfactors, including cytokines, hormones, vitamin A, and butyrate(1). In situ studies have shown up-regulation of pIgR in severalchronic inflammatory mucosal diseases such as celiac disease,Hel-icobacter pylorigastritis, and Sjogren’s syndrome afflicting sali-

vary glands; this is suggested to be a secondary effect of cytokinesproduced locally in these disorders (7).

Several immunoregulatory and proinflammatory cytokines, in-cluding IL-4, IFN-g, IL-1, and TNF-a, enhance the expression ofpIgR in cell culture systems (1). Such cytokine-mediated up-reg-ulation of pIgR is known to depend on de novo protein synthesis(8–11), and has recently been shown to take place at the level oftranscription in which IL-4 had the greatest effect on the transcrip-tion rate of the tested cytokines (10). This effect of IL-4 has beenobserved both in a human lung carcinoma cell line, Calu-3 (11,12), and in a human colonic carcinoma cell line, HT-29 (13, 14).Furthermore, IL-4-mediated up-regulation of pIgR is known to besensitive to inhibitors of tyrosine phosphorylation, indicating asignaling pathway dependent on protein tyrosine phosphorylation(11, 15).

DNA elements that mediate regulation of pIgR expression havebeen extensively studied. We and others have demonstrated that anE-box in the proximal promoter is essential for the constitutiveexpression of the human and murine pIgR genes (16, 17). Hor-mone-regulated transcriptional elements have been identified bothin exon 1 and in the far upstream region of the human pIgR gene(18, 19), as well as in the promoter of the murine pIgR gene (20).For IFN-g-mediated transcriptional up-regulation of pIgR, an IFN-stimulated response element (ISRE) located in exon 1, and twoother ISREs in the proximal promoter have been implicated asnecessary (21). One report indicated that TNF-a mediates its tran-scriptional up-regulation of pIgR (at least partly) through the exon1 ISRE (22). In support of this possibility, we found that TNF-ainduced binding of NFs from HT-29 cells to the exon 1 ISRE,although weaker than after IFN-g stimulation (10). TNF-a alsoinduced NF-kB binding to a putative target site in the pIgR pro-moter (10, 23), and inhibitors of this transcription factor partiallyblocked induction of pIgR (23). However, no transcriptional mech-anisms for IL-4-mediated up-regulation of pIgR have been re-ported, perhaps because the previously published sequence of thehuman pIgR gene contains no obvious IL-4-responsive elements,

Laboratory for Immunohistochemistry and Immunopathology, Institute of Pathology,University of Oslo, Rikshospitalet, Oslo, Norway

Received for publication May 15, 2000. Accepted for publication July 12, 2000.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby markedadvertisementin accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This work was supported by the Norwegian Cancer Society, the Research Councilof Norway, and Anders Jahre’s Fund.2 Address correspondence and reprint requests to Hilde Schjerven, Laboratory forImmunohistochemistry and Immunopathology, Institute of Pathology, University ofOslo, Rikshospitalet, N-0027 Oslo, Norway.3 Abbreviations used in this paper: p, polymeric; CHX, cycloheximide; GFP, greenfluorescent protein; ISRE, IFN-stimulated response element; JAK, Janus kinase;PGK, phosphoglycerokinase; S, secretory; SC, secretory component; 4-HT,4-hydroxytamoxifen.

Copyright © 2000 by The American Association of Immunologists 0022-1767/00/$02.00

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

either in the proximal promoter or in the 59 regulatory sequences(21, 24). Although the entire gene of mouse pIgR (29 kb) has beensequenced (25), only 59sequences have been studied in the mouseand the rat pIgR genes in the search of putative binding sites forregulatory transcription factors (17, 25–27).

IL-4 is a pleiotropic cytokine, known to be important for devel-opment of type 2 Th cell responses, thus supporting humoral im-munity (28). IL-4 is involved in the differentiation and maturationof B cells; although it is most commonly thought of as a switchfactor for the IgE and IgG (mouse IgG1 and human IgG4) isotypes,it may also be involved in switching to IgA (29). Studies of IL-4-deficient mice demonstrated an important role for IL-4 in theinduction of intestinal Ab responses (30). It has furthermore beenshown that IL-4 (and the related cytokine IL-13) plays an impor-tant role in protection against intestinal parasites ( (31) and refer-ences therein). Thus, IL-4 might exert effects on both B cells andmucosal epithelial cells to enhance the production of SIgs gener-ated through the cooperation between these two cell types.

Engagement of the IL-4R is known to activate several intracel-lular signaling pathways, one of which is the Janus kinases (JAK)/STAT signaling pathway (28, 32, 33). STAT6 is latent in the cy-toplasm, and upon engagement of the IL-4R, the receptor-associated JAKs become activated and phosphorylate STAT6.Once phosphorylated, STAT6 dimerizes and translocates to thenucleus, where it binds to its DNA elements and activates tran-scription (33). Thus, this is a direct mechanism of transcriptionalactivation not requiring synthesis of novel factors. STAT6 isknown to be directly involved in the transcriptional up-regulationof some genes important in the immune system such as CD23(FceRII) (34, 35) and the germlinee transcription before classswitching (29). For these genes, it has been demonstrated thatSTAT6 requires cooperation with other transcription factors, forexample, C/EBP for germlinee transcription (36, 37) and NF-kB(34) or IRF-4 (38) for induction of CD23 expression.

The genomic DNA of the human pIgR gene has been cloned,spanning approximately 2.7 kb of upstream sequences and includ-ing all coding exons with intervening introns (39). In this study, weidentify an IL-4-responsive enhancer in the 5.7-kb intron 1, locatedapproximately 4.1 kb downstream of the transcriptional start site.We further characterize this IL-4-dependent enhancer and demon-strate that STAT6 is involved, both directly and indirectly, in thelate de novo protein synthesis-dependent IL-4-mediated transcrip-tional up-regulation of human pIgR.

Materials and MethodsPlasmid construction

All primers used are shown in Table I. Nucleotide numbering is givenrelative to the transcriptional start site (16). Plasmids denoted pSC1through pSC23 contained different lengths of regulatory sequences (includ-

ing the promoter) from the human pIgR/SC gene (36) subcloned intoXhoI/NcoI-digested pGL3 enhancer vector (Promega, Madison, WI). pSC1 ex-tended from22684 to anNcoI site (introduced by PCR) at the ATG startcodon in exon 2 of the human pIgR gene. pSC2 was made by substitutingthe genomic fragment from theBstEII site in exon 1 to the start codon inexon 2, with the equivalent fragment from pIgR cDNA. In pSC3 throughpSC9, internal deletions were made by digesting with different restrictionenzymes (indicated in Fig. 1), blunting with Klenow fragment where nec-essary, and religating. The plasmids pSC16 through pSC22 were made bydigesting pSC1 withNcoI (partial digestion) andHindIII, and then insert-ing either aHindIII linker (pSC16), or different lengths of PCR-amplifiedNcoI/HindIII-digested DNA fragments, from pIgR intron 1.

Plasmids denoted p1 through p51 contained different fragments of DNAsequence from intron 1 of the human pIgR gene, subcloned upstream of theSV40 promoter of the pGL3 promoter vector (designated p0) (Promega).p1 and p2 contained a 1.3-kbSacI-HindIII fragment from intron 1 in eitherorientation. For p12, p14, p35, and p48, DNA fragments (indicated in Fig.3A) were amplified by PCR and subcloned into p0. The 4-bp mutations inp36-p41, p50, and p51 were introduced with the QuickChange Site-Di-rected Mutagenesis Kit (Stratagene, La Jolla, CA). Point mutations weredesigned that changed the nucleotide from a purine to the noncomplemen-tary pyrimidine and vice versa (i.e., A7C, T7G). The 4-bp deletion inp18 and pSC23 was introduced into p12 and pSC1, respectively, by di-gesting withPstI, blunting with T4-DNA polymerase, and religating.

The Renilla luciferase control vector, pRL-PGK, was constructed bysubstituting the CMV promoter from the pRL-CMV vector (Promega) withthe promoter of the housekeeping gene phosphoglycerokinase (PGK).pCDNA3-STAT6:ER* was made by subcloning a 3.6-kbEcoRI-SalI frag-ment from pMXH-STAT6:ER* (40) into theEcoRI-XhoI site of thepCDNA3 vector (Invitrogen, NV Leek, The Netherlands). The pCMV-GFP, a green fluorescent protein (GFP) expression plasmid, was con-structed by inserting the CMV promoter from pCDNA3 into the multiplecloning site of the pEGFP-1 plasmid (Clontech, Palo Alto, CA).

DNA sequencing

Sequencing of the human pIgR intron 1 was performed at the Biotechnol-ogy Center of Oslo (Oslo, Norway). The integrity of the vector-insertboundary of all subcloned DNA fragments, as well as all mutations, wasconfirmed by sequencing with the cycle sequencing kit (Amersham Inter-national PLC, Slough, U.K.).

Cell culture and transfections

The human colonic adenocarcinoma cell line, HT-29.m3, previously se-lected for high expression of pIgR (41), was maintained in RPMI 1640medium supplemented with 50mg/ml gentamicin, 2 mML-glutamine, and10% FCS. For transient transfections, approximately 1.53 106 cells per9.6-cm2 well were plated out on day 1. On day 2, the cells were transfectedwith 3 ml FUGENE 6 reagent (Roche Diagnostics, Indianapolis, IN) and1–1.5mg of plasmid DNA per well, according to the manufacturer’s pro-tocol. On day 3, the cells were either left untreated or stimulated with 10ng/ml human rIL-4, 2.5mg/ml cycloheximide (CHX), or 1mM 4-hy-droxytamoxifen (4-HT; Sigma, St. Louis, MO). Unless otherwise stated,cells were harvested after 24 h of stimulation, and the luciferase activity ofboth the reporter gene (Fireflyluciferase) and the internal control plasmidpRL-PGK (Renilla luciferase) was measured in a luminometer (Victor;Wallace, Turku, Finland) with the Dual Luciferase Reporter Assay System(Promega). Transfection efficiency of HT-29.m3 cells was approximately0.5–2%, as determined by FACS analysis of pCMV-GFP-transfected cells

Table I. Primers used for plasmid construction

Name of Construct Name of Primer Primer Sequencea

pSC1 and pSC2 nco-primer.rev AGCACCATGGCTGGTGGGTCpSC16 HindIII linker CAAGCTTGpSC17 nco2407i GCATTAACCATGGACCTGTAAGApSC18 nco2407ii CTATTGCCCATGGCTCAAGpSC19 nco2407iii AGACCCATGGGACCCTCpSC20 hind2407i TGCCCCAAAGCTTCTTACAGpSC21, p14 hind2407ii CCCTTCACAAGCTTGAGCpSC22, p12 hind2407iii ACCCCAACTAAAGCTTAGAGGAGp35 Bg12.rev TGTGAATATAAAGATCTTTTGTTTCTGCAGp48 Kpn5.fwd CCCATATTTGGTACCACTCCCTCC

aMutations are underlined.

3899The Journal of Immunology

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

(data not shown). Cos-1 monkey fibroblasts were grown in DMEM me-dium supplemented with gentamicin,L-glutamine, and FCS, and trans-fected essentially as described for HT-29.m3 cells, except that 105 cellswere plated per well. Data in Figs. 1, 2, 3A, and 6 show the mean6 SEMof three or more independent experiments.

Quantitative RT-PCR

Cytoplasmic RNA was isolated from untreated and treated HT-29.m3 cellswith the RNeasy Mini Kit (Qiagen, Hilden, Germany), according to themanufacturer’s protocol. RNA (1mg), primed with oligo(dT), and reversetranscribed with Superscript II, was used for a 20ml cDNA reaction. Spe-cific mRNA was quantified by real-time PCR with the Light Cycler (RocheDiagnostics) and SYBR Green I reagents, according to the manufacturer’sprotocol (Table II). The amplification coefficient was calculated by deter-mining the crossing point (number of cycles required to reach a set thresh-old) for a series of 2-fold dilutions of cDNA template for each gene ana-lyzed. The calculated crossing point at 1ml cDNA template was used as ameasure of gene-specific RNA quantity, and fold induction was calculatedby the following equation:Kgene

DCp, whereKgene is the amplification co-efficient, andDCp is (the crossing point for the RT-PCR from unstimulatedcells)2 (the crossing point for the RT-PCR from IL-4-stimulated cells) forthat gene.

Nuclear extract preparation and EMSA

Preparation of nuclear extracts from HT-29.m3 cells was performed es-sentially as described (42), except for the use of 0.6% Nonidet P-40 for celllysis instead of mechanical lysis. Also, freshly added 1 mM Na3VO4 (Sig-ma) was included in buffer A, and buffer C was supplemented with fresh 1mM Na3VO4, 1 mg/ml pepstatin A, 1mg/ml leupeptin, and 1mg/ml anti-pain. Nuclear extracts were aliquoted, frozen in liquid nitrogen, and storedat 270°C until used, and protein concentrations were determined withBio-Rad Protein Assay (Bio-Rad Laboratories, Hercules, CA). Approxi-mately 5mg of nuclear proteins was incubated with32P end-labeled dou-ble-stranded oligonucleotide probe (0.5 pmol/reaction) in buffer containing0.1 mM EDTA, 50 mM KCl, 1 mM DTT, 0.1mg/ml dI/dC, 0.05% NonidetP-40, 10 mM Tris, 1 mM MgCl2, 6% glycerol, and 20 mM HEPES (pH7.9) for 30 min at room temperature. The reaction was separated by elec-trophoresis on a 5% polyacrylamide gel (0.253 Tris/borate/EDTA) at 150V for approximately 1.5 h at room temperature, dried, and visualized onx-ray film overnight. Cold competitors were added in 10- or 100- foldexcess before addition of the labeled probe when indicated. For supershiftexperiments, 4mg of the anti-STAT6 polyclonal Ab (M-200; Santa CruzBiotechnology, Santa Cruz, CA) was added to the reaction mixture beforeaddition of the labeled oligonucleotide, and incubated overnight at 4°C.The labeled probe was added to the reactions and incubated for another 30min at 4°C, before electrophoresis on a 5% polyacrylamide gel for 2 h at4°C. The top strands of the oligonucleotide probes used were: wild-type,59-TTTATTCTTCCAAAGAACTGCAGA-39; mutated, 59-TTTATTCggaCAAAGAACTGCAGA-39; and Ce, 59-GATCAAGACCTTTCCCAAGAAATCTATC-39 (as used in Ref. 40).

ResultsDNA elements in intron 1 mediate IL-4-inducedup-regulation of pIgR

To identify DNA elements that mediate IL-4-induced transcrip-tional up-regulation of pIgR, we made luciferase reporter con-

structs containing putative regulatory sequences of the humanpIgR gene. Thus, the construct pSC1 contained approximately 2.7kb of upstream sequences, exon 1, the 5.7-kb large intron 1, andwas fused in frame with the luciferase gene at the ATG start codonin exon 2. A second reporter construct, pSC2, contained the same2.7-kb upstream sequences, exon 1, and exon 2, but lacked theentire intron 1. Transient transfections of these constructs wereperformed into HT-29.m3 cells that were either left untreated ortreated with IL-4 for 24 h. The activity of the intron-containingreporter gene was enhanced more than 7-fold after IL-4 treatment(Fig. 1, upper panel; pSC1), whereas that of the intron-less con-struct was only marginally enhanced by such treatment (Fig. 1,upper panel; pSC2). Up-regulation of the pIgR luciferase reporterconstruct by IL-4 was hence mediated through DNA elements inintron 1.

IL-4-mediated up-regulation of pIgR and pSC1-luciferase mRNAis blocked by CHX

The IL-4-mediated up-regulation of endogenous pIgR in HT-29cells has been shown to depend on de novo protein synthesis (10,11). We therefore tested whether this was true also for IL-4-me-diated up-regulation of the reporter construct pSC1 by performingquantitative RT-PCR with mRNA from transfected HT-29.m3cells. Cells were left untreated or stimulated with IL-4 for 24 h,either in the presence or absence of CHX. Cytoplasmic RNA wasisolated from these HT-29.m3 cells, and the levels of differentspecific mRNAs were quantified by real-time RT-PCR. For eachsample, we analyzed message for the endogenous pIgR gene, thetransfected pSC1 gene, and the housekeeping gene GAPDH as aninternal control for mRNA integrity and yield. We found that themRNA level for endogenous pIgR was increased approximately16-fold after IL-4 treatment, while simultaneous treatment withCHX abolished this up-regulation (Table III). The level of mRNAfor pSC1 luciferase was increased approximately 5-fold after 24 hwith IL-4 stimulation (Table III). This relatively small inductioncompared with the endogenous gene could be explained by ahigher basal level of transcription of the plasmid-encoded reportergene, or it could be due to the absence of other important regula-tory DNA elements. However, CHX blocked this IL-4-mediatedeffect, documenting that the pSC1 luciferase reporter constructmimicked the protein synthesis-dependent mechanism of IL-4-me-diated up-regulation of the endogenous pIgR gene. By contrast,GAPDH expression was only increased approximately 1.4-fold af-ter IL-4 treatment and 1.2-fold after addition of CHX togetherwith IL-4.

Table II. Primers and cycle parameters for real time RT-PCRa

Gene Primer Sequence (59to 39)Product Size

(bp)

AnnealingTemperature

(°C)

MeasuringTemperature

(°C)

AmplificationCoefficient

(Kgene)

pIgR AGAGGCAGGGGTTACCAACT 267 62 86 1.92GAGGTGGGTGGGTAGTAGCA

pSC1-luc AGAGGCAGGGGTTACCAACT 192 61 82 1.86GTTCCATCTTCCAGCGGATA

GAPDHb AAATCCCATCACCATCTTCC 313 60 72 1.68CATGAGTCCTTCCACGATACC

a The forward and reverse primers, respectively, are given for the genes investigated, together with the product size and annealing temperature of theRT-PCR. The temperature at which the signal was measured and the calculated amplification coefficients (fold increase per cycle) for each gene are givenas well. The amplification coefficients are calculated as described inMaterials and Methods.

b From Jahnsen et al. (50).

3900 ROLE OF STAT6 IN IL-4-MEDIATED UP-REGULATION OF pIgR

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Multiple elements within a 554-bp region cooperate for maximalIL-4-mediated pIgR induction

To map the localization of the IL-4-responsive element(s) moreclosely, we sequenced intron 1 of the human pIgR gene (sequencedata available from European Molecular Biology Laboratory(EMBL), accession number AJ276452), and made several con-structs with sequential internal deletions in this intron. When tran-siently transfected into HT-29.m3 cells, we found that deletion ofbases 847-1855, 1855–4118, or 4866–5163 in the reporter con-structs pSC3, pSC4, and pSC9, respectively, did not affect theirIL-4-mediated induction (Fig. 1,top panel). However, deletionfrom position 3464 to 4866 in intron 1 (pSC8) abolished IL-4responsiveness (Fig. 1,top panel). Therefore, the IL-4-responsiveelement(s) was localized to a 748-bp fragment between position4118 and 4866, present in pSC4 but absent in pSC8 (Fig. 1,toppanel). For more precise mapping, we made smaller stepwise de-letions within this 748-bp region. Reporter constructs pSC16,pSC18, pSC19, and pSC20 lost their ability to be induced by IL-4;all of them lacked a 198-bp fragment indicated in Fig. 1 (lowerpanel). pSC17 and pSC21, which contained this fragment (bases4250–4447) with some additional flanking sequences, bothshowed some IL-4 responsiveness, although reduced comparedwith the full-length pSC1 (Fig. 1). In contrast, pSC22, which con-tained 554 bp of the indicated 748-bp fragment, retained almostfull IL-4 responsiveness.

The IL-4-late-responsive region of the pIgR gene behaves like ageneral IL-4-responsive enhancer

To determine whether the identified IL-4-responsive region be-haved like a general enhancer, we subcloned a 1.3-kb fragmentcorresponding to the deleted region in pSC8 (Fig. 1,top panel)upstream of the minimal SV40 promoter in both orientations, andtested the luciferase activity of these reporter constructs (designat-ed p1 and p2, respectively) as above (Fig. 2). The basal viral pro-moter (designated p0) was unaffected by IL-4 treatment, whileboth p1 and p2 showed approximately 6-fold induction after IL-4treatment (Fig. 2). Furthermore, the 554-bp fragment identified inpSC22 (Fig. 1,lower panel) also retained full IL-4 responsivenesswhen transfected into HT-29.m3 cells (Fig. 3A; p12). Therefore,further studies were based on this plasmid rather than on the longerp1 reporter construct.

Internally in the 554-bp intronic fragment of p12, there was auniquePstI restriction enzyme recognition site; this was used tomake a 4-bp deletion that had a dramatic effect on the IL-4-me-diated gene induction in transfected HT-29.m3 cells, reducing it toless than 2-fold (Fig. 3A; p18). The same negative effect was seenwhen this small deletion was introduced into the full-length pSC1background (pSC23; data not shown). Interestingly, the 4-bp de-letion was located immediately downstream of a putative STAT6site (37, 43, 44).

A consensus STAT6 element is required for IL-4 responsivenessof the pIgR gene

To more precisely identify required DNA element(s) in the prox-imity of the PstI restriction enzyme recognition site, we made se-quential 4-bp mutations in p12 that covered 32 bp of the sequencespanning the putative STAT6 site. Two sets of four point muta-tions, upstream of the consensus STAT6 site, did not reduce IL-4responsiveness, while the three sets of point mutations that abol-ished the STAT6 binding site also abolished IL-4 responsiveness(Fig. 3A). Furthermore, the 4-bp mutation just downstream of theSTAT6 site, corresponding to the 4-bpPstI deletion, reduced in-duction to approximately 2-fold (Fig. 3A). Two mutations furtherdownstream that both mutated a putative C/EBP site (45) had littleor no effect on IL-4-mediated induction of the reporter genes(Fig. 3A).

The STAT6 element exerts its effect on the pIgR gene incooperation with surrounding DNA sequences

To test whether the STAT6 element and the partially overlappingputative C/EBP site were sufficient to confer IL-4 responsiveness,as seen in the germlinee promoter (36, 37), we subcloned singleor up to four (2-mer or 4-mer) copies of an oligonucleotide con-taining these two binding sites (indicated in Fig. 3B) upstream ofthe basal promoter in p0. Neither single nor multimerized copieswere sufficient to confer IL-4 responsiveness when transfected intoHT-29 cells (data not shown). We also made sequential deletionsfrom either end of the p12 reporter construct and found that aregion significantly larger than the STAT6 site was required forIL-4 responsiveness. A 340-bp fragment that contained 214 bp 59and 116 bp 39of the STAT6 site retained full IL-4 responsiveness(Fig. 3A; p14). However, deleting 102 bp from the 39 end of this

FIGURE 1. Mapping of the IL-4-respon-sive region in intron 1 of the human pIgRgene. HT-29.m3 cells were transiently trans-fected with the indicated luciferase reporterconstructs, and either left untreated or treatedwith IL-4 for 24 h before harvesting and mea-surement of luciferase activity. Names anddiagrams of the reporter constructs are givenon theleft, and fold induction after IL-4 stim-ulation on theright. The lower panelshowsan enlargement of a 748-bp region in intron1, where smaller deletions were made inpSC1. Indicated on the diagram are the5.7-kb intron 1, the position of exon 1 andexon 2, and the restriction enzyme sites usedin construction of the different internal dele-tions (N,NcoI; X, XhoI; S,SacI; H,HindIII;A, ApaI).

3901The Journal of Immunology

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

reporter gene abolished IL-4 responsiveness, despite the fact thatthis deletion ended 14 bp before the identified STAT6 site (Fig.3A; p35). Deletion of 195 bp from the 59end of p14 reduced IL-4responsiveness from 5.5-fold to approximately 2.5-fold (Fig. 3A,lower panel, compare p48 with p14).

IL-4 stimulation induces binding of STAT6 to the intronicSTAT6 site of the pIgR gene

To determine whether IL-4 stimulation affected protein-DNA in-teractions, we isolated nuclear extracts from HT-29.m3 cellstreated with IL-4 for various time periods and performed in vitroEMSA experiments with a probe spanning the identified STAT6site (Fig. 4A). We found that IL-4 induced the formation of twoprotein-DNA complexes within 10 min that still remained after24 h, the longest time point investigated (Fig. 4; complex I and II,see arrows). The higher mobility complex (I) peaked after 10 min,then decreased in intensity after 2 h, while the relatively weaklower mobility complex (II) remained stable in intensity over time(Fig. 4A). Competition experiments demonstrated that both com-plexes were abolished by an excess of wild-type oligonucleotide(Fig. 4,A andB), while an oligonucleotide with a mutated STAT6site had no effect (Fig. 4B). Furthermore, a consensus STAT6binding site from the human germlinee promoter (40) competed tothe same extent as the wild-type oligonucleotide (Fig. 4B). Finally,incubation with a polyclonal Ab against STAT6 resulted in a su-pershifted complex (Fig. 4B; complex III), unequivocally docu-menting that IL-4 induced activation of STAT6 and its binding tothis DNA element from intron 1.

IL-4-mediated up-regulation of the pIgR-derived reporterconstructs displays delayed kinetics

IL-4 treatment of HT-29.m3 cells induced STAT6 binding to thepIgR intronic enhancer within 10 min, much faster than the timedelay for transcriptional activation previously reported (10).Therefore, to further investigate the kinetics of pIgR up-regulation,we compared the time-dependent response to IL-4 of two pIgR-based reporter constructs, with a previously described syntheticIL-4-responsive promoter, p(Ie-IL4RE)4-Luc (46). pSC1 (whichcontained pIgR sequence from22684 to the start codon at position5928), p12 (which contained the IL-4-responsive enhancer up-stream of an unrelated promoter), or p(Ie-IL4RE)4-Luc was tran-siently transfected into HT-29.m3 cells, which were stimulatedwith IL-4 for different time periods. The p(Ie-IL4RE)4-Luc re-porter construct showed no activity above background in unstimu-lated cells, but was induced rapidly by IL-4, reaching maximalinduction after 6 h (Fig. 5). By contrast, the two pIgR-derivedreporter constructs, pSC1 and p12, demonstrated significantlyslower kinetics. Only modest induction was seen after 6 h; max-imal induction was not reached until after 24 h of IL-4 treatment(Fig. 5). Thus, the kinetics of the identified IL-4-responsive regionfrom the pIgR intron 1 differed substantially from the synthetic

multimerized IL-4-responsive enhancer derived from the germlinee promoter, p(Ie-IL4RE)4-Luc.

STAT6 activation is sufficient to up-regulate pIgR transcriptionin HT-29.m3 cells, but not in Cos-1 cells

To test whether activation of the STAT6 signaling pathway wassufficient to activate transcription from the pIgR IL-4-responsiveenhancer region, we cotransfected a conditionally active form ofSTAT6, the STAT6:ER* fusion protein (40), together with the p12reporter construct into HT-29.m3 cells. The cells were then eitherleft untreated or treated with 4-HT for 24 h to induce dimerizationand activation of the STAT6:ER* fusion protein. The reporter con-struct p12 was induced by the activated STAT6:ER* fusion protein(Fig. 6A). Thus, activation of the STAT6 signaling pathway wassufficient to provide up-regulation of the p12 reporter construct inHT-29.m3 cells.

To test whether cell type-specific factors were needed for thisSTAT6-mediated up-regulation of p12, we cotransfected theSTAT6:ER* fusion plasmid with either p(Ie-IL4RE)4-Luc or p12into monkey fibroblast Cos-1 cells, and incubated the cells with orwithout 4-HT for 24 h to activate the STAT6:ER* fusion protein.Its activation was sufficient to up-regulate transcription of thep(Ie-IL4RE)4-Luc reporter gene approximately 20-fold (Fig. 6B),but did not provide enhanced expression of p12 in Cos-1 cells(Fig. 6B).

DiscussionIn this study, we have identified a 554-bp DNA fragment withinintron 1 of the human pIgR gene that is necessary and sufficient forits IL-4-mediated induction. The resulting slow transcriptional re-sponse was mimicked by STAT6 activation alone and shown todepend on complex cooperation of several transcription factors:activated STAT6, a de novo synthesized protein(s), and the pres-ence (or induction) of a cell type-specific factor(s). Thus, STAT6mediates cell type-specific up-regulation of the pIgR gene bothdirectly (by binding to its DNA element in intron 1) and indirectly(by inducing the de novo expression of one or more possibly celltype-specific required factors).

Table III. IL-4-mediated up-regulation of pIgR and pSC1-luciferasemRNA is blocked by CHXa

GeneFold Induction

with IL-4Fold Induction with

IL-4 1 CHX

pIgR 15.86 1.3 1.76 0.04pSC1 5.16 1.0 1.16 0.4GAPDH 1.46 0.3 1.26 0.04

a Calculation of fold induction was performed as described inMaterials and Meth-ods. Data are the average of three independent experiments6 SD.

FIGURE 2. The 1.3-kb intronic fragment of the human pIgR gene con-fers IL-4 responsiveness to an unrelated basal promoter, independent of itsorientation. HT-29.m3 cells were transiently transfected with the indicatedreporter constructs and treated as described in the legend to Fig. 1. p0 is thepGL3-promoter vector containing the minimal SV40 promoter (Promega),and the indicated 1.3-kb fragment corresponds to aSacI/HindIII fragmentfrom intron 1 (Fig. 1).

3902 ROLE OF STAT6 IN IL-4-MEDIATED UP-REGULATION OF pIgR

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Mapping of the IL-4-responsive region

We identified an IL-4-responsive enhancer within intron 1, andfound this region necessary and sufficient to mediate gene induc-tion by IL-4, both in the context of the pIgR promoter and a het-erologous promoter. Location of this IL-4-responsive region 4.1 kbdownstream of the transcriptional start site opens for the possibil-ity that the regulatory element(s) functions at the RNA level. Thismode of up-regulation has been demonstrated for other genes, suchas the TAT-mediated activation of HIV (long terminal repeat-di-rected) transcription (47, 48). However, because the enhancer re-gion still conferred the same degree of IL-4 responsiveness whensituated upstream of a heterologous promoter in either orientation,the role of RNA elements could be eliminated.

Further mapping of the IL-4-responsive region was performedin this heterologous context by the use of sequential deletions, orwith specific point mutations. The IL-4 responsiveness was abol-ished by mutations affecting the consensus STAT6 site, implicat-ing its requirement in the IL-4-mediated effect. Mutation or dele-tion of 4 bp 39of the consensus STAT6 site indicated that thesenucleotides might also be important for the transcription factor-binding site, because such mutations also reduced the IL-4 respon-siveness significantly. These mutations also affected a partly over-lapping putative C/EBP site, suggesting that it might contribute tothe IL-4-mediated up-regulation of pIgR. Such a mechanism withcooperation between STAT6 and C/EBP binding sites has beendemonstrated for the IL-4-mediated induction of germlinee tran-scripts before class switching (29), as mutation of either one re-sulted in abolished IL-4 responsiveness (36, 37). Furthermore, ithas been shown that a minimal STAT6 binding site, even whenmultimerized, is not sufficient to confer IL-4 responsiveness, butappears to require cooperation with other DNA elements (for ex-ample, C/EBP in the germlinee promoter) (37, 46). However,

none of the two downstream 4-bp mutations in the pIgR-derivedenhancer that mutated the putative C/EBP site affected the IL-4responsiveness significantly, indicating that this putative C/EBPsite is not required for the IL-4-responsive enhancer in the pIgRintron 1. A similar observation has been reported for an IL-4-responsive enhancer in the mouse CD23 (FceRII) promoter, inwhich mutation of a STAT6 site abolished IL-4-mediated up-reg-ulation, while an adjacent C/EBP site was not required for IL-4responsiveness (34, 35). In addition, our observation that neither asingle copy nor multimerized copies of an oligonucleotide con-taining the STAT6 site and the putative C/EBP site from the pIgRgene were sufficient to confer IL-4 responsiveness to a basal pro-moter suggested that this was not a functional C/EBP site (as com-pared with the C/EBP site in the multimerized STAT6-C/EBP sitefrom the germlinee promoter, p(Ie-IL4RE)4-Luc). In support ofthis, the putative C/EBP site was not conserved in the mouse, asjudged from analysis of transcription factor databases (45), whilethe STAT6 site and two flanking bases on both sides were 100%conserved (Fig. 3B). However, participation of C/EBP in the ob-served IL-4-mediated up-regulation of pIgR could not be com-pletely ruled out because another putative C/EBP site is locatedapproximately 70 bp upstream of the STAT6 site within the554-bp intronic fragment required for complete responsiveness.However, it is beyond the scope of this article to analyze all pu-tative transcription factor-binding sites identified by searchesagainst database matrixes.

We found that a 214-bp deletion of the 39end of the 554-bpfragment did not affect the IL-4 responsiveness significantly (Fig.3A; comparing p14 with p12), while deleting the same bp in thecontext of the complete intron reduced induction slightly, possiblydue to positional or context-dependent effects (Fig. 1; comparepSC21 and pSC22). However, we found that more than 14 bp 39of

FIGURE 3. A consensus STAT6 sitein intron 1 of the human pIgR gene isnecessary, but not sufficient, to conferIL-4 responsiveness.A, HT-29.m3 cellswere transiently transfected with the in-dicated reporter constructs and treated asdescribed in the legend to Fig. 1. Thewild-type sequence of a 43-bp fragmentin p12, and the corresponding mutated se-quences of nine reporter constructs (des-ignated p18, p50, p51, p36-p41) are givenas an enlargement of the indicated frag-ment. The consensus STAT6 site, thePstIrestriction enzyme recognition site, and aputative C/EBP site are also indicated be-low or above the sequences.B, Sequencecomparison of the human and the murinepIgR intron 1. The human sequence isfrom nucleotides 4314 to 4356, and themurine sequence is from nucleotides 5844to 5886 (relative to start of exon 1, as givenby accession number AB001489). Con-served nucleotides are shaded, and the con-sensus STAT6 site and the putative C/EBPsite are indicated as boxes. The sequence ofthe oligonucleotide used to make multim-erized copies of the STAT6 and the puta-tive C/EBP site is indicated above the hu-man sequence.

3903The Journal of Immunology

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

the STAT6 site was required for IL-4 responsiveness and that morethan 17 bp upstream was needed for maximal induction. Takentogether, these findings suggested that the identified STAT6 siteneeds to cooperate with DNA elements located both upstream anddownstream to confer full IL-4 responsiveness of the pIgR gene.

Role of STAT6 in pIgR gene induction

Using EMSA with nuclear extracts from HT-29 cells, we identifiedtwo IL-4-inducible complexes that bound the pIgR STAT6 ele-ment. Competition experiments and supershift with an Ab toSTAT6 demonstrated that this factor was present in the complexes.The increase in transcription rate of the human pIgR gene afterIL-4 stimulation has been reported to peak as late as after 20 h ofstimulation (10), reflecting the slow de novo protein synthesis-dependent mechanism for up-regulation. The rapid activation ofSTAT6 with binding to the intronic DNA element, and the obser-vation that the most strongly induced complex decreased in inten-sity over time (after 2 h) apparently contradicted the delayed tran-scriptional response. However, in these experiments, we used an

oligonucleotide centered around the STAT6 site, spanning only 24bp. Conversely, in the endogenous pIgR gene, as well as in thepIgR-derived reporter constructs, large flanking sequences wouldallow for other transcription factors to bind, thereby stabilizing thebinding of the IL-4-induced complex(es). It has been shown invitro that binding of C/EBP to a DNA element adjacent to a

FIGURE 6. Cell type-specific activation of the IL-4-responsive enhancerfrom the pIgR gene by a conditionally active STAT6:ER* fusion protein.Graphs show fold induction after 24 h of stimulation with 4-HT.A, HT-29.m3cells were transiently transfected with the p12 reporter constructs together withthe pCDNA3-STAT6:ER* construct or empty vector control (pCDNA3).B, Cos-1 cells were transfected with either p(Ie-IL4RE)4-Luc (46) or p12 re-porter construct, together with either pCDNA3-STAT6:ER* or empty vectorcontrol (pCDNA3).

FIGURE 4. IL-4 treatment induces binding of STAT6 to the requiredDNA element in intron 1 of the human pIgR gene. EMSA experimentswere performed with nuclear extracts from HT-29.m3 cells stimulated withIL-4 for the indicated time periods. A 24-bp fragment, spanning the STAT6site from pIgR intron 1, was used as a labeled probe.A, IL-4 treatment fordifferent time periods (10 min-24 h) induced two complexes (I and II)indicated with arrows. A 100-fold molar excess of unlabeled wild-type (wt)oligonucleotide was added where indicated.B, Oligonucleotide competi-tion experiment with 10- or 100-fold molar excess (Fxs) of the cold com-petitors (cc): wild-type (wt), mutated STAT6 site (m), or a consensusSTAT6 site (37) (ce). Lanes 8–14were run at 4°C with nuclear extractsfrom unstimulated (lane 8) or IL-4-stimulated cells (lanes 9–14), withaddition of cold competitors as indicated, and addition of polyclonalSTAT6 Ab (lanes 12–14). The appearance of a supershifted complex III isindicated by arrow (lanes 12and14).

FIGURE 5. Delayed kinetics of the intronic pIgR enhancer comparedwith the IL-4-responsive enhancer from the germlinee promoter. HT-29.m3 cells were transiently transfected with the indicated reporter con-structs and treated with IL-4 for various time periods. Values are relativeluciferase activity (arbitrary units) as a function of time after IL-4 stimu-lation. The results are from one representative experiment of three inde-pendent ones.

3904 ROLE OF STAT6 IN IL-4-MEDIATED UP-REGULATION OF pIgR

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

STAT6 site (in the germlinee promoter) stabilized the binding ofSTAT6 by decreasing the dissociation rate (49). A similar mech-anism of transcription factor cooperation is likely to occur also forother factors that bind in the proximity of STAT6 in other genes.

The JAK-STAT6 pathway is an immediate early response,whereas the IL-4-mediated transcriptional up-regulation of pIgRdepends on de novo protein synthesis. We found that two key pIgRreporter constructs had similar slow-response kinetics, reaching amaximum luciferase level after approximately 24 h. This was sig-nificantly different from the early responsive enhancer derivedfrom the germlinee promoter, which gave a more rapid responseto IL-4, reaching a maximum approximately 6 h after stimulation.Thus, the pIgR-derived reporter constructs required other cellularevents in addition to STAT6 activation for their induction by IL-4.

The finding that activation of a conditionally active STAT6:ER*fusion protein was sufficient to up-regulate the pIgR-derived en-hancer construct (p12) to the same extent as IL-4 in HT-29 cellssuggested that IL-4 mediated its effects on the pIgR gene mainlythrough the STAT6 signaling pathway. However, when we quan-tified pIgR and reporter gene mRNA in unstimulated cells and inIL-4-induced HT-29 cells, the IL-4 responsiveness of both the en-dogenous pIgR gene and the reporter gene (pSC1) was shown to beCHX sensitive. This agreed with previous studies, which demon-strates that IL-4 induction of this gene depends on de novo proteinsynthesis (10, 11). Most likely, therefore, STAT6 has a dual role inthe IL-4-mediated up-regulation of pIgR: directly by binding to itsDNA element in the IL-4-responsive region in intron 1, and indi-rectly by inducing de novo synthesis of a required protein (Fig. 7).This protein could be a transcription factor or a coactivator thatcooperates with STAT6 to enhance the transcription rate. Alterna-tively, it might be an enzyme or some other protein that modulatestranscription through its effect on other DNA-bound factors.

We found that activation of STAT6 was sufficient to up-regulatethe pIgR-derived enhancer construct (p12) in HT-29 cells, but notin the monkey fibroblast Cos-1 cell line, suggesting that the pIgR-derived IL-4-responsive enhancer is cell-type specific. The re-quired lineage-specific transcription factor(s) might be a constitu-tively expressed protein, or it might be the de novo synthesizedprotein(s) failing to be induced by STAT6 in Cos-1 cells. The fact

that activation of STAT6 was sufficient to up-regulate the p(Ie-IL4RE)4-Luc reporter gene in Cos-1 cells, but not the pIgR-de-rived reporter gene, may in the future be exploited in a search forthis required factor by complementation experiments.

In conclusion, we have shown that a consensus STAT6 bindingsite within intron 1 of the human pIgR gene is absolutely necessaryfor its IL-4-mediated up-regulation. Nevertheless, this DNA ele-ment was not sufficient, but depended on cooperation with otherDNA elements located both upstream and downstream, thus sug-gesting a complex transcription factor cooperation involving sev-eral different DNA elements. Furthermore, the requirement for celltype-specific factors and de novo protein synthesis suggested amechanism of IL-4 induction similar in principle to that recentlydescribed for CD23 in lymphoid cells (38). The mechanism ofIL-4-mediated up-regulation of CD23 in B cells, and of pIgR inmucosal epithelial cells may hence constitute an emerging para-digm for how pleiotropic signaling substances exert differentialtranscriptional responses in distinct tissue compartments. Molec-ular characterization of the additional factor(s) required for pIgRgene induction, as well as more detailed description of the targetDNA elements involved, will be required to further understandhow IL-4 mediates enhanced pIgR expression in secretory epithe-lia. IL-4 may thus increase the external transport of secretory Absduring infections that provoke a type 2 Th cell response, and at thesame time stimulate pIgA production by mucosal B cells.

AcknowledgmentsWe thank the technical staff at LIIPAT for excellent laboratory assis-tance. The pMXH-STAT6:ER* plasmid was kindly provided by Dr. N.Arai (DNAX Research Institute, Palo Alto, CA) (40), and the p(Ie-IL4RE)4-Luc reporter gene by Dr. P. Rothman (Columbia University, NewYork, NY) (46).

References1. Norderhaug, I. N., F. E. Johansen, H. Schjerven, and P. Brandtzaeg. 1999. Reg-

ulation of the formation and external transport of secretory immunoglobulins.Crit. Rev. Immunol. 19:481.

2. Mostov, K., and C. S. Kaetzel. 1999. Immunoglobulin transport and the poly-meric immunoglobulin receptor. InMucosal Immunology. P. L. Ogra,J. Mestecky, M. E. Lamm, W. Strober, J. Bienenstock, and J. R. McGhee, eds.Academic Press, San Diego, p. 181.

3. Brandtzaeg, P., I. N. Farstad, F. E. Johansen, H. C. Morton, I. N. Norderhaug, andT. Yamanaka. 1999. The B-cell system of human mucosae and exocrine glands.Immunol. Rev. 171:45.

4. Mestecky, J., I. Moro, and B. J. Underdown. 1999. Mucosal immunoglobulins. InMucosal Immunology. P. L. Ogra, J. Mestecky, M. E. Lamm, W. Strober,J. Bienenstock, and J. R. McGhee, eds. Academic Press, San Diego, p. 133.

5. Johansen, F. E., M. Pekna, I. N. Norderhaug, B. Haneberg, M. A. Hietala,P. Krajci, C. Betsholtz, and P. Brandtzaeg. 1999. Absence of epithelial immu-noglobulin A transport, with increased mucosal leakiness, in polymeric immu-noglobulin receptor/secretory component-deficient mice.J. Exp. Med. 190:915.

6. Shimada, S., M. Kawaguchi-Miyashita, A. Kushiro, T. Sato, M. Nanno, T. Sako,Y. Matsuoka, K. Sudo, Y. Tagawa, Y. Iwakura, and M. Ohwaki. 1999. Gener-ation of polymeric immunoglobulin receptor-deficient mouse with marked reduc-tion of secretory IgA.J. Immunol. 163:5367.

7. Brandtzaeg, P., T. S. Halstensen, H. S. Huitfeldt, P. Krajci, D. Kvale, H. Scott,and P. S. Thrane. 1992. Epithelial expression of HLA, secretory component(poly-Ig receptor), and adhesion molecules in the human alimentary tract.Ann.NY Acad. Sci. 664:157.

8. Krajci, P., K. Tasken, D. Kvale, and P. Brandtzaeg. 1993. Interferon-g stimula-tion of messenger RNA for human secretory component (poly-Ig receptor) de-pends on continuous intermediate protein synthesis.Scand. J. Immunol. 37:251.

9. Piskurich, J. F., J. A. France, C. M. Tamer, C. A. Willmer, C. S. Kaetzel, andD. M. Kaetzel. 1993. Interferon-g induces polymeric immunoglobulin receptormRNA in human intestinal epithelial cells by a protein synthesis dependentmechanism.Mol. Immunol. 30:413.

10. Nilsen, E. M., F. E. Johansen, D. Kvale, P. Krajci, and P. Brandtzaeg. 1999.Different regulatory pathways employed in cytokine-enhanced expression of se-cretory component and epithelial HLA class I genes.Eur. J. Immunol. 29:168.

11. Ackermann, L. W., L. A. Wollenweber, and G. M. Denning. 1999. IL-4 andIFN-g increase steady state levels of polymeric Ig receptor mRNA in humanairway and intestinal epithelial cells.J. Immunol. 162:5112.

12. Loman, S., H. M. Jansen, T. A. Out, and R. Lutter. 1999. Interleukin-4 andinterferon-g synergistically increase secretory component gene expression, butare additive in stimulating secretory immunoglobulin A release by Calu-3 airwayepithelial cells.Immunology 96:537.

FIGURE 7. Proposed model for the late protein synthesis-dependent IL-4-mediated up-regulation of the pIgR gene through the STAT6 signalingpathway. Engagement of the IL-4R activates the receptor-associated JAKs,which in turn phosphorylate STAT6 (S). Upon phosphorylation (p),STAT6 dimerizes and translocates to the nucleus, where it binds the pIgRintronic STAT6 element as well as inducing transcription of an unknownrequired gene, X. CHX inhibits the translation of protein X in the cyto-plasm, and thus blocks IL-4-induced transcriptional activation of the pIgRgene. STAT6 and protein X cooperate with other transcription factor(s) (Y)to mediate maximal IL-4 responsiveness.

3905The Journal of Immunology

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

13. Phillips, J. O., M. P. Everson, Z. Moldoveanu, C. Lue, and J. Mestecky. 1990.Synergistic effect of IL-4 and IFN-g on the expression of polymeric Ig receptor(secretory component) and IgA binding by human epithelial cells.J. Immunol.145:1740.

14. Kvale, D., and P. Brandtzaeg. 1995. Constitutive and cytokine induced expres-sion of HLA molecules, secretory component, and intercellular adhesion mole-cule-1 is modulated by butyrate in the colonic epithelial cell line HT-29.Gut36:737.

15. Denning, G. M. 1996. IL-4 and IFN-g synergistically increase total polymericIgA receptor levels in human intestinal epithelial cells: role of protein tyrosinekinases.J. Immunol. 156:4807.

16. Johansen, F. E., B. A. Bosloven, P. Krajci, and P. Brandtzaeg. 1998. A compositeDNA element in the promoter of the polymeric immunoglobulin receptor regu-lates its constitutive expression.Eur. J. Immunol. 28:1161.

17. Martin, M. G., J. Wang, T. W. Li, J. T. Lam, E. M. Gutierrez,R. S. Solorzano-Vargas, and A. H. Tsai. 1998. Characterization of the 59-flankingregion of the murine polymeric IgA receptor gene.Am. J. Physiol. 275:G778.

18. Haelens, A., G. Verrijdt, E. Schoenmakers, P. Alen, B. Peeters, W. Rombauts,and F. Claessens. 1999. The first exon of the humanscgene contains an androgenresponsive unit and an interferon regulatory factor element.Mol. Cell. Endocri-nol. 153:91.

19. Verrijdt, G., E. Schoenmakers, P. Alen, A. Haelens, B. Peeters, W. Rombauts,and F. Claessens. 1999. Androgen specificity of a response unit upstream of thehuman secretory component gene is mediated by differential receptor binding toan essential androgen response element.Mol. Endocrinol. 13:1558.

20. Li, T. W., J. Wang, J. T. Lam, E. M. Gutierrez, R. S. Solorzano-Vargus,H. V. Tsai, and M. G. Martin. 1999. Transcriptional control of the murine poly-meric IgA receptor promoter by glucocorticoids.Am. J. Physiol. 276:G1425.

21. Piskurich, J. F., K. R. Youngman, K. M. Phillips, P. M. Hempen,M. H. Blanchard, J. A. France, and C. S. Kaetzel. 1997. Transcriptional regula-tion of the human polymeric immunoglobulin receptor gene by interferon-g. Mol.Immunol. 34:75.

22. Kaetzel, C. S., V. J. Blanch, P. M. Hempen, K. M. Phillips, J. F. Piskurich, andK. R. Youngman. 1997. The polymeric immunoglobulin receptor: structure andsynthesis.Biochem. Soc. Trans. 25:475.

23. Takenouchi-Ohkubo, N., T. Takahashi, M. Tsuchiya, J. Mestecky,Z. Moldoveanu, and I. Moro. 2000. Role of nuclear factor-kB in the expressionby tumor necrosis factor-a of the human polymeric immunoglobulin receptor(plgR) gene.Immunogenetics 51:289.

24. Verrijdt, G., J. Swinnen, B. Peeters, G. Verhoeven, W. Rombauts, andF. Claessens. 1997. Characterization of the human secretory component genepromoter.Biochim. Biophys. Acta 1350:147.

25. Kushiro, A., and T. Sato. 1997. Polymeric immunoglobulin receptor gene ofmouse: sequence, structure and chromosomal location.Gene 204:277.

26. Martin, M. G., E. M. Gutierrez, J. T. Lam, T. W. Li, and J. Wang. 1997. Genomiccloning and structural analysis of the murine polymeric receptor (pIgR) gene andpromoter region.Gene 201:189.

27. Fodor, E., A. Feren, and A. Jones. 1997. Isolation and genomic analysis of the ratpolymeric immunoglobulin receptor gene terminal domain and transcriptionalcontrol region.DNA Cell Biol. 16:215.

28. Nelms, K., A. D. Keegan, J. Zamorano, J. J. Ryan, and W. E. Paul. 1999. TheIL-4 receptor: signaling mechanisms and biologic functions.Annu. Rev. Immunol.17:701.

29. Stavnezer, J. 1996. Antibody class switching.Adv. Immunol. 61:79.30. Vajdy, M., M. H. Kosco-Vilbois, M. Kopf, G. Kohler, and N. Lycke. 1995.

Impaired mucosal immune responses in interleukin 4-targeted mice.J. Exp. Med.181:41.

31. Urban, J. F., L. Schopf, S. C. Morris, T. Orekhova, K. B. Madden, C. J. Betts,H. R. Gamble, C. Byrd, D. Donaldson, K. Else, and F. D. Finkelman. 2000. Stat6

signaling promotes protective immunity againstTrichinella spiralis through amast cell- and T cell-dependent mechanism.J. Immunol. 164:2046.

32. Pan, P. Y., and P. Rothman. 1999. IL-4 receptor mutations.Curr. Opin. Immunol.11:615.

33. Leonard, W. J., and J. J. O’Shea. 1998. Jaks and STATs: biological implications.Annu. Rev. Immunol. 16:293.

34. Richards, M. L., and D. H. Katz. 1997. Analysis of the promoter elements nec-essary for IL-4 and anti-CD40 antibody induction of murine FceRII (CD23):comparison with the germlinee promoter.J. Immunol. 158:263.

35. Tinnell, S. B., S. M. Jacobs-Helber, E. Sterneck, S. T. Sawyer, and D. H. Conrad.1998. STAT6, NF-kB and C/EBP in CD23 expression and IgE production.Int.Immunol. 10:1529.

36. Delphin, S., and J. Stavnezer. 1995. Characterization of an interleukin 4 (IL-4)responsive region in the immunoglobulin heavy chain germlinee promoter: reg-ulation by NF-IL-4, a C/EBP family member and NF-kB/p50.J. Exp. Med. 181:181.

37. Mikita, T., D. Campbell, P. Wu, K. Williamson, and U. Schindler. 1996. Re-quirements for interleukin-4-induced gene expression and functional character-ization of Stat6.Mol. Cell. Biol. 16:5811.

38. Gupta, S., M. Jiang, A. Anthony, and A. B. Pernis. 1999. Lineage-specific mod-ulation of interleukin 4 signaling by interferon regulatory factor 4.J. Exp. Med.190:1837.

39. Krajci, P., D. Kvale, K. Tasken, and P. Brandtzaeg. 1992. Molecular cloning andexon-intron mapping of the gene encoding human transmembrane secretory com-ponent (the poly-Ig receptor).Eur. J. Immunol. 22:2309.

40. Kamogawa, Y., H. J. Lee, J. A. Johnston, M. McMahon, A. O’Garra, and N. Arai.1998. A conditionally active form of STAT6 can mimic certain effects of IL-4.J. Immunol. 161:1074.

41. Kvale, D., J. Bartek, L. M. Sollid, and P. Brandtzaeg. 1988. Rapid selection ofcultured cells with increased expression of a membrane marker (secretory com-ponent).Int. J. Cancer 42:638.

42. Prywes, R., and R. G. Roeder. 1986. Inducible binding of a factor to the c-fosenhancer.Cell 47:777.

43. Seidel, H. M., L. H. Milocco, P. Lamb, J. E. Darnell Jr., R. B. Stein, and J. Rosen.1995. Spacing of palindromic half sites as a determinant of selective STAT (sig-nal transducers and activators of transcription) DNA binding and transcriptionalactivity. Proc. Natl. Acad. Sci. USA 92:3041.

44. Schindler, U., P. Wu, M. Rothe, M. Brasseur, and S. L. McKnight. 1995. Com-ponents of a Stat recognition code: evidence for two layers of molecular selec-tivity. Immunity 2:689.

45. Quandt, K., K. Frech, H. Karas, E. Wingender, and T. Werner. 1995. MatInd andMatInspector: new fast and versatile tools for detection of consensus matches innucleotide sequence data.Nucleic Acids Res. 23:4878.

46. Lu, B., M. Reichel, D. A. Fisher, J. F. Smith, and P. Rothman. 1997. Identifi-cation of a STAT6 domain required for IL-4-induced activation of transcription.J. Immunol. 159:1255.

47. Muesing, M. A., D. H. Smith, and D. J. Capon. 1987. Regulation of mRNAaccumulation by a human immunodeficiency virustrans-activator protein.Cell48:691.

48. Marciniak, R. A., B. J. Calnan, A. D. Frankel, and P. A. Sharp. 1990. HIV-1 Tatprotein trans-activates transcription in vitro.Cell 63:791.

49. Mikita, T., M. Kurama, and U. Schindler. 1998. Synergistic activation of thegermlinee promoter mediated by Stat6 and C/EBPb. J. Immunol. 161:1822.

50. Jahnsen, F. L., R. Haye, E. Gran, P. Brandtzaeg, and F.-E. Johansen. 1999. Glo-cocorticosteroids inhibit mRNA expression for eotaxin, eotaxin-2, and monocyte-chemotactic protein-4 in human airway inflammation with eosinophilia.J. Im-munol. 163:1545.

3906 ROLE OF STAT6 IN IL-4-MEDIATED UP-REGULATION OF pIgR

by guest on April 12, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from