Resource February 2012

Vol 14, No 1, February 2012

ISSN 1680-4902 R35.00 (incl VAT)

The official journal of the Institute of Waste Management of Southern Africa

Promoting integrated resources management

TRANSLIFT AND OMB WASTE GROUPA new acquisition P6

COP 17 and the Kyoto ProtocolThe effect on business

Pikitup’s strategyEradicating excess waste in Joburg

Recycling villages Community sustainability

Panel discussionLandfill disposal, rehabilitation and extraction

www.3smedia.co.za

is printed on 100% recycled paper

RéSource February 2012 – 1

Cover story6 Translift and OMB Waste Group – a

new acquisition

Regulars

3 President’s comment

5 Editor’s comment

60 IWMSA news

Solid waste

8 Pikitup’s new strategy: eradicating excess waste in Joburg

Recycling

11 Plastics recycling survey results revealed

14 Recycling villages boost local sustainability

16 Excellence in e-waste recycling

18 Consol celebrates official Nigel launch

Landfills

21 Exclusive panel discussion: Landfill disposal, rehabilitation and extraction

Waste to energy

33 Renewable heating technology

COP 17 feature

34 COP 17 and the Kyoto Protocol: expectations and outcomes

38 COP 17 image highlights

Air pollution / CDM

40 ‘Smart’ buildings reduce GHG emissions

42 Sasol: green washing or step in the right direction?

45 Who will pay the price of carbon tax?

Hazardous waste

46 2011 Responsible Care Report: the good and bad

Medical waste

49 Case study: hazardous waste minimisation at medical schools

Wastewater management

54 HybridICE: chemical-free toxic

water treatment system

56 WWTW upgrade lowers carbon

emissions

Plant & equipment

57 Mercedes-Benz: raising the bar on

waste collection

59 Pilot Crushtec: the ‘pilot’ of asphalt recycling

Vol 14, No 1, February 2012

ISSN 1680-4902 R35.00 (incl VAT)

The official journal of the Institute of Waste Management of Southern Africa

Promoting integrated resources management

TRANSLIFT AND OMB WASTE GROUPA new acquisition P6

COP 17 and the Kyoto ProtocolThe effect on business

Pikitup’s strategyEradicating excess waste in Joburg

Recycling villages Community sustainability

Panel discussionLandfill disposal, rehabilitation and extraction

www.3smedia.co.za

is printed on 100% recycled paper

contentswww.3smedia.co.za ISSN 1680-4902, Volume 14, Number 1, February 2012

11

34

54

42

The RéSource team stands firmly behind environmental preservation. As such, RéSource magazine is printed on 100% recycled paper and uses no dyes or varnishes. The magazine is saddle-stitched to ensure that no glues are required in the binding process.

140litre

We are excited to introduce our

NEWwheelie binThis product is in line with the waste minimization strategy, as

result of recycling initiatives.

Mpact Plastic ContainersNeil Hare Road, Atlantis, South Africa 9 Piet Pretorius Street, Brits, South AfricaPO Box 1551, Dassenberg, 7350 Tel: +27 (0) 21 573 9400/ 0861 672 444 Email: [email protected] www.mpcsa.co.za

1009 mm

200 mm

482 mm587 mm

resistant

easy to handle

reliable

made from HDPE suitable for selective collection


President's comment

Patron members of the IWMSA

I trust that all our members have enjoyed

a safe holiday season and have returned

to face the New Year with renewed en-

ergy and vigour to tackle the challenges that

lie ahead this year!

One of the major challenges we face is

that of procurement in local government,

especially in waste management. It is heart-

ening to see that government is now taking

active steps and intervening at provincial

level in an attempt to address the various

issues that are bedeviling procurement and

proper financial management of provinces

and ultimately, local authorities.

Another interesting trend is that a number

of municipalities are experiencing challeng-

es relating to landfill sites where airspace

is running out and they will soon be faced

with a lack of airspace. It is also becom-

ing difficult to find and develop new landfill

sites due to the lack of planning, budgeting

and political will. It is thus with this in mind,

that a number of local authorities have

turned to “waste to energy” as a solution to

their problems. In some cases municipali-

ties succumb to the advances of commer-

cial companies who offer to take over all

their waste management woes and promise

the earth in terms of what to do with their

waste, all at “no cost”!

It should be remem-

bered that there are no

“free lunches” in this

world and any service

that is provided comes

at a cost somewhere

down the line. I trust

that municipalities will follow the proper

procurement procedures in terms of the leg-

islation and look no further than the many

local waste management service providers,

both consultants, contractors and vendors,

that are available. They will be surprised to

see the wealth of expertise and knowledge

that is available.

The Eastern Cape branch, with the assis-

tance of the IWMSA head office, is well

advanced with the organising of WasteCon

2012 to be held in East London later

this year. A new look WasteCon is on the

cards as we are in discussions with the

Department of Environmental Affairs to

integrate the annual Waste Khoro

with WasteCon. This will allow the

many municipal delegates attend-

ing the Waste Khoro the opportu-

nity to attend WasteCon and the

attendant exhibition. This will afford

our exhibitors the opportunity to get

exposure to the many munici-

palities that will be attend-

ing. Details of the new look

WasteCon programme will

be released shortly once

the arrangements have

been finalised.

A further call for papers for WasteCon

has gone out. Please support your flag-

ship conference and get busy with those

abstracts. This is the ideal opportunity to

showcase the expertise out there which is

so vitally needed within our municipalities

and especially in addressing the theme of

“Wrestling with Waste”. For those compa-

nies still pondering on whether they wish to

exhibit, please note that only 20 stands are

left. This is the best response we have had

in many years when it comes to the sale of

exhibition stands! So don’t delay, book now!

Finally, we are in an election year again

and it will soon be time for those nomina-

tions for branch committees and

vice-president. Please make yourself

available to get involved in the

affairs of the IWMSA, particularly

at branch level which is the heart

of the IWMSA. All our new

members are particu-

larly encouraged to

get involved – make

yourself available

and contact your

local branch

or the IWMSA

head office.

We need to get

“new blood”

with dynamic

ideas and lots

of energy to

take this institute

forward in the right

direction.

It’s time for WasteCon 2012

A new look WasteCon is on the cards as we are in discussions with the Department of Environmental Affairs” Stan Jewaskiewitz, President, IWMSA


No words can describe the feeling

of being a delegate at COP 17.

Never have I been surrounded by

individuals who exude such concern for the

environment and the planet as a whole.

The talks were electrifying. The passion,

contagious! Despite the language barrier,

the colour of your skin, or your native coun-

try, there was one focus and one focus

only – to act now against climate change

while we still have the chance. Heads of

state and government officials descended

on one particular conference room at the

ICC, while throughout the

venue and Durban metro

various other press confer-

ences, launches and talks

were being held. Despite

the negativity prior the

event, good news prevailed

with the Kyoto Protocol

being reinstated. For more

insight into COP 17, the Kyoto Protocol

and image highlights from the event, look

out for the special RéSource COP 17

feature inside this issue.

On a different note though, the

tyre industry has been hit by a new

levy. For those who haven’t yet heard,

an Integrated Industry Waste Tyre

Management Plan has been approved

by Environmental Affairs Minister, Edna

Molewa, and will be implemented and

managed by the Recycling and Economic

Development Initiative of South Africa

(REDISA) – a not-for-

profit organisation.

The South African tyre

industry produces

more than 10 million

scrap tyres every year

and it is estimated

that anything between

60 and 100 million

scrap tyres are stock-

piled in the country.

Hence the new law is

intended not only to

support the creation

of a sustainable recy-

cling industry deal with

a major waste prod-

uct, but also to create

jobs and foster small and medium-sized

businesses in communities throughout

the country. A levy of R2.30 per kilogram

will apply to all tyres either manufactured

or imported on or after 1 February 2012.

Tyres already in stock will not be affected.

When the plastic bag levy was initi-

ated in 2003, the South African Revenue

Services (SARS) pocketed handsomely

from the collections, ringing in R61 385

000 for the 2005/06 financial year.

However, SARS collected no plastic bag

tax for the 2003/04 financial year and it

is not clear where

the money from

the tax went to

in the initial year.

Let’s hope that

the tyre industry

doesn’t encounter

the same ‘X-files’

scenario.

Rattling on about COP 17 and the tyre

levy, I completely forgot to welcome every-

one to the start of a brand new year and I

am sure that 2012 is going to be a great

one! To kick start the year, RéSource has

a brand new line-up of the best reads in

the waste industry including an insight

into Pikitup’s waste management strategy,

a panel discussion based on landfill dis-

posal, rehabilitation and extraction, and

a revolutionary chemical-free toxic water

treatment system called HybridICE. This

issue also features some interesting recy-

cling stories and news on

WasteCon 2012 – yep, it’s

time for the biggest waste

industry event again!

RéSource welcomes all

editorial submissions so

please send your copy to

[email protected] or

drop me an email and we

can meet and discuss.

Happy reading!

ReSource is endorsed by:

Editor's comment

Nothing beats a front row seat

Publisher: Elizabeth ShortenEditor: Candice Landie Tel: +27 (0)11 233 2600, [email protected] chief executive: Frédérick DantonSub-editor: Patience GumboProduction manager: Antois-Leigh BotmaFinancial manager: Andrew Lobban Marketing: Martin HillerSubscriptions sales: Nomsa MasinaAdministrator: Tonya HebentonDistribution coordinator: Nomsa MasinaPrinters: United Litho JohannesburgTel: +27 (0)11 402 0571

Advertising sales: Christine PretoriusTel: +27 (0)11 465 8255 [email protected]

Publisher: MEDIA

No.4, 5th Avenue Rivonia, 2191PO Box 92026, Norwood 2117Tel: +27 (0)11 233 2600Share Call: 086 003 3300 Fax: +27 (0)11 234 7274/5www.3smedia.co.za

Annual subscription: R195.00 (incl VAT) South Africa ISSN 1680-4902

The Institute of Waste Management of Southern AfricaTel: +27 (0)11 675 3462E-mail: [email protected]

All material herein RéSource is copyright-protected and may not be reproduced either in whole or in part without the prior written permission of the publisher. The views and opinions expressed in the magazine do not necessarily re-flect those of the publisher or editor, but those of the author or other contributors under whose name contributions may ap-pear, unless a contributor expresses a viewpoint or opinion in his or her capacity as an elected office bearer of a company, group or association.

© Copyright 2012. All rights reserved.

Editor

When the plastic bag levy was initiated, SARS pocketed handsomely from the collections

TRANSLIFT AND OMB WASTE GROUP

Translift Netherlands recently became a major stakeholder in OMB Waste Group of companies, South Africa, with the acquisition of the local shareholding early in 2011. Translift is now in the process of establishing a new and revised management structure, which includes the introduction of a fully-participating BEE component.

Cover story

ACTS slide-on frame (fi tt ed to existi ng or new containers)ACTACTACAAACCACACCTCTCCCTACTACTACTACAAACACCCTCTTTTACTACTAAACTCTTACAACCCCTTTCTACTACTAAAACCCTTTTTACTAAAAAACCCCCCTCTTTACTACTACAAACCCCCTTTACTACCCCTTTACTACTAACCACCACCTACTACTACTACCCCCACACTAACCCCACTACCCACACCCCACCTCCACCCCCACCCCCCCCAACCCCACCCTCACCAACCAC SS sS lidde-e-o-o-oooooooooooooooooooooooooooooooooooooooooooonnnnnnnn n ffnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn rame ((((((e ((((((((e ((((((((((((((((((((fi ttfifififi ttfifififififififififififififififififififififi ededededeededededededdedededddd tototototototototototooootooto exexexexexxxexexexexexxexe istiistiistitiistiististiistiisstisistitistististititititititititinnnngnngngnggngnggggggngngnnngngngngggggnggngnnngnnng oooroooororororroooooooororrooorooorororrrrroorooorrorororoooorrooorooooroooorrrroorrorrooooorororroorrrrorrrooroorrrrr neneneneneneneneeneneneeeeeneennennneenenenenennnnnnnnnnn w cww cw cw cw cw cw cw cw cccw cw ccwwwww cwwwwww ccw cccccwww cw cccccccw cw onttontontontontttontttontonttontontonontnnttonttontontontontonttooononontnntonttntontntntonttonnttnntonttntaainainainainainainnainainaainainaaaaininiainainina nainiininnaainiainaaa nnnnnaaaainnnnnnnnnnnnnainnnnerserseeersersersersrsereersrsersererseerrerrsserseeeerrrsrsrsersrserersereeerseeeeeeersseeeerserseeeeeeeersrsee ))))))))))))))))))))))))))))))

International expertise meets local business

be applied to all products manufactured both

locally and abroad for use within and beyond

South African borders. Wherever practical,

parts will be manufactured for the interna-

tional market now that the local entity forms

a larger part of the Translift operation.

The local manufacture initiative opens new

employment opportunities and potential

export markets for production and spare

parts required locally and elsewhere in the

world where Translift has manufacturing and

service requirements. The company has rec-

ognised the need for a greater participation

in the social upliftment of local inhabitants of

the country and is eager to share its knowl-

edge and experience with the South African

related industry. This proactive approach

creates the opportunity for expansion into

other African countries, and the intention is

to replicate the initiative in other develop-

ing countries outside of Africa where the

need for environmentally-related commercial

initiatives serve a dual purpose by targeting

Towards the end of last year, after serv-

ing in a mandatory executive position,

Les Penny stood down from his posi-

tion as director at OMB Waste Group.

Penny is currently consulting for the com-

pany specifically in the area of technical

innovation and marketing of the product

range, particularly active in other developing

and emerging areas. He will concentrate on

community upliftment in the waste industry

and consult in the structure, selection and

implementation of the product. Product devel-

opment will also form part of his function for

the industry.

Translift is in the process of establishing

a new and revised management structure,

which includes the introduction of a fully

participating BEE component. The intention

is that training and upliftment form the cor-

nerstone of operations in South Africa, both

in the administrative and technical areas of

the business. Local manufacture has already

commenced and a South African flavour will

appropriate

waste

handling

issues and,

in doing

so, create

entrepre-

neurial

opportuni-

ties for

individuals in

local communities.

The Translift rangeConsidering the range of equipment in the

Translift portfolio, the fabrication of large

components and finished goods for local

and neighbouring countries makes perfect

sense. Given the immensity of transportation

costs from abroad, Translift has seen the

requirement as an opportunity to become

an integral part of the waste equipment and

systems industry in the region.

6 – RéSource February 2012

Les Penny

Cover story

Bulk containers for use with Translift’s own

range of waste collection/transportation and

handling equipment should provide a practi-

cal base for the extrapolation of the specific

product into similar but otherwise applied

containers, also found in the region. Rear

loader bodies, which are also somewhat

costly to ship from abroad, are also a part of

the parcel.

Manufactured components for new equip-

ment destined for the Translift international

market may consist of bin lifter components,

compactor components, prefabricated con-

tainer lifting components and a variety of

other similar parts for the bulk container lift-

ing mechanisms. Translift has progressively

upgraded its own main manufacturing facility

in Dronten, Holland, and will aim to apply the

experience and expertise that was gained

and applied during the course of the progres-

sive approach.

The locally-manufactured spare parts

meant for local consumption will be kept

in Pretoria for distribution alongside parts

imported from elsewhere in the world, such

as hydraulic components and PLC products

where appropriate. The hardware, being

only a part of the bigger picture, sees that

an on-going technical support programme

is in place whereby the experienced techni-

cal team from Holland combined with the

newly structured technical team in South

Africa, will be available to train and assist

their own maintenance personnel, as well as

individuals recognised as suitably positioned

to undertake whatever service and mainte-

nance activities that may arise from time

to time. What is more, Translift will become

more actively engaged with supporting waste

handling initiatives aimed especially at com-

munity level. The variety of options available

to the community are numerous and the

company has several models from which to

select – all of which are aimed at addressing

employment opportunities within the collec-

tion and transportation component as well

as with waste separation initiatives. Their

projects will invariably require a degree of

funding and that is where Translift is likely to

be on top of the game with potential options.

It was once said that the ‘extra mile’ is not

too busy, simply because not too many peo-

ple attempt it. Sadly, this is not a very well

supported concept but, that too, is because

not too many are thus inclined.

Community involvementThe principle of community-based waste col-

lection presents the opportunity to engage

the community in the process of waste col-

lection. Primarily the focus is on less affluent

areas where unemployment is usually at its

highest. Simple arithmetic will demonstrate

that less sophisticated equipment is required

for waste collection when including the com-

munity in sustainable waste management

initiatives. The consolidation method has

been , and is being used with positive effect

but the need for the expansion of the con-

cept appears to have eluded the industry, in

all likelihood because first world principles

are applied in the areas in question. This is

not to say that these principles and related

equipment are not applicable in metropolitan

areas and affluent society but the fact is

that the majority of the population do not fall

within that category. For this reason, Translift

is focusing on the underprivileged in the con-

text of community involvement. The concept

of community based waste collection requir-

ing less capital equipment is fundamental

where consolidation is maximised. If a col-

lection vehicle, particularly a large compactor

type, is compelled to collect at every house-

hold, the time required to load the vehicle

is determined by factors such as traffic

congestion, accessibility, road conditions and

more. On the other hand if the waste were

to be collected by the community in a man-

aged fashion and consolidated, the collection

vehicle would find itself completing a route in

half the time otherwise required.

Considering the capital and operational

cost savings by optimising the operation

of the garbage compactor, the available

saving is amortised and applied to the

RéSource offers advertisers an ideal platform to ensure maximum exposure of their brand. Companies are afforded the opportunity of publishing a cover story and a cover picture to promote their products and services to an appropriate audience. Please call Christine Pretorius on +27 (0)11 465 6273 to secure your booking. The article does not represent the views of the Institute of Waste Management of Southern Africa, or those of the publisher.

The locally-manufactured spare parts meant for local consumption will be kept in Pretoria for distribution alongside parts imported from elsewhere in the world


remuneration of the individuals within the

community that are collecting and con-

solidating the waste. This principle may

be applied to the suburban and CBD in a

modified format and Translift has the meth-

odology and experience to apply these con-

cepts. When distance to disposal becomes

a problem the concept kicks into overdrive

and provides further entrepreneurial oppor-

tunities than ever.

ConclusionNaturally each area is different and for

this reason Translift would evaluate the

requirement with a view to determination of

the range and type of equipment required,

whilst endeavouring to preserve what col-

lection infrastructure there is in order not to

disrupt the existing operation, but rather to

optimise it. With the vast number of options

and tweaks that can be applied to the waste

collection process, Translift is poised to

embrace the challenges of community-based

waste collection, recycling at source and

environmental stability. Last but not least,

all of the Translift concepts and equipment

implementation have a significantly positive

effect on the reduction of carbon emissions.

With quantifiable studies having been per-

formed, Translift is in a unique position to

assist in developing systems that ensure the

whole community benefits from these low-

ered carbon emissions.

t +27(0)12 460 1973

ABOVE ACTS turntables on a flatbed rail wagon


15%

Waste minimisation through separation at source, composting,

crusher plants, centres of excellence

30%

Waste to energy plant construction and initiation

General WasteLegislation. Funding. Recycling. Collection

55%

Additional landfill space

Solid waste

reducing the waste that is produced by resi-

dents, businesses and individuals so that we

have less to dispose of at landfills.” This is

in line with the National Waste Management

Strategy, which cabinet approved on 10

November 2011. The strategy reveals trends

on minimising waste and therefore reducing

the negative impacts on the environment.

The ultimate objective is to change Pikitup’s

current value chain from ‘collect, transport

and dispose’ to ‘rethink, reduce, reuse and

recycle’. “Even though we encourage people

to reduce waste creation, we must accept

that, realistically, there will always be some

level of waste generated,” says Mpungose.

Critical to this process is changing the

public’s mindset and attitude towards the

creation and management of waste. Pikitup

will bolster its education and awareness

drive so that Johannesburg citizens can

understand what the company is trying to

achieve as not much can be achieved with-

out public support and active par ticipation.

Manufacturers must take back Pikitup is looking to divert at least 33% of

waste from landfills through a combination

of product stewardship (take-back) pro-

grammes where manufacturers take back

their own packaging and other recyclable

products, and the development of facili-

ties which promote re-use, recycling and

The City of Johannesburg’s solid

waste management service provider

and the biggest waste manage-

ment company in Africa unveiled its waste

minimisation plan for the city – placing

sustainability at the forefront of its opera-

tions. “Landfill space is fast depleting and

is impacting the environment negatively at

an alarming pace, mostly because of the

rapid population growth in the City of Johan-

nesburg (CoJ),” says Zandile Mpungose,

Pikitup’s executive: Legal Environment

Compliance and Safety. “That, in turn, links

directly to excessive waste production.”

Speaking at the annual 2011 EnviroCon

Conference, targeted at environmental

managers and specialists from large or-

ganisations around South Africa and aiming

to present solutions and opportunities to

the environmental issues which the country

faces, Mpungose stressed the importance

of waste reduction as “we simply do not

have the space to accommodate the con-

tinuously increasing levels of waste being

“We have at least eight years

to go before we run out of

landfi ll space in the City of

Johannesburg.” Lawrence Boya, MD of Pikitup

Eradicating excessive waste production PIKITUP’S WASTE STRATEGY

CITY OF JOHANNESBURG AND PIKITUP

• Total area of 1 625 km² • Home to 3.8 million people• Pikitup responsible for transporting,

collecting and disposing of domestic refuse• Pikitup provides commercial services to

some 17 000 businesses• Litter picks and sweeps approximately

9 000 km of streets• CoJ generates a total of 1.6 million tonnes

of waste per annum• What is takes to keep CoJ clean• Over 4 000 employees in 11 depots• Fleet of around 500 vehicles• Four landfill sites• 44 garden refuse sites• 472 000 new 240ℓ wheelie bins delivered

generated as more people move into the

city”.

The CoJ’s population is growing at a rate

of 9% annually. More than a space issue,

the local environment cannot withstand the

sustained impact. As the city’s constitu-

tionally mandated solid waste management

company, Pikitup needs to find a meaning-

ful and sustainable way of reducing the

levels of waste generated and ultimately

disposed of at landfill.

The plan moving forwardLooking at what constitutes waste, how it is

generated and ultimately managed, Pikitup’s

plan, moving forward, is to drastically cut

down on waste produced in order to reduce

what needs to be disposed of down the

line. Mpungose explains: “We’re looking at

FIGURE 1 CoJ’s intentions on waste minimisation

Solid waste

composting. These initiatives will, in turn,

increase CoJ residents’ participation in recy-

cling and support the roll out of infrastruc-

ture for waste diversion, such as materials

recovery facilities, composting plants, waste

transfer stations, builder’s rubble plants

and through extensive city-wide education

and awareness outreach programmes.

Pikitup has already embarked on a num-

ber of initiatives which contribute towards

the CoJ’s goal of emitting less carbon

emmissions. “We presently run the Clean

City Campaign, the highlight of which is the

annual Clean-up Day. It also incorporates

the Illegal Dumping Programme, which is

about combatting the problem of illicitly

discarding waste in any open space around

the city. In 2012, we will expand the

A FEW PIKITUP INITIATIVES

Clean City Campaign

Illegal Dumping Programme to combat the problem of illicitly discarding waste in any open space around the city.Clean-up Day an annual event galvanising Johannesburg residents to actively clean up.

Eco Rangers Pilot phase: creating a generation of environmentally-aware warriors.

Separation at source

Education drive to get households to separate their refuse from home to help minimise what ends up at landfill sites.

WASTE DIVERSION TACTICS

• Source reduction strategies look at diverting waste from waste streams before any collections.• Waste separated at source reused and/or recycled by residents.• Dry recyclables and e-waste exchanged amongst residents.• Home composting (worm farming strategies) of green and wet waste, facilitating food security as

the compost is a critical component of vegetable gardening.• Residents’ training on home composting and assisted implementation.• Community outreach programmes for mindset changes.• By-law enforcement and penalties as a last resort.• Enhancing the role of reclaimers.• Reusing, recycling and composting: the strategy seeks the attainment of 33% waste diversion

from landfills through a combination of the following:• Product stewardship (take-back) programmes, whereby manufacturers take back their own

packaging and other products.• Development of facilities that promote reuse, recycling and composting.• Increasing residents’ recycling rate participation.• Roll out of builder’s rubble plants.• Extensive city wide education and awareness outreach programmes. • Conversion technologies provide the biggest chunk of recyclables that can be diverted from

landfills• The strategy projects 40% diversion of waste from landfills to conversion technologies by 2040.• This methodology not only assists in waste diversion but is a significant contributor to electricity

and heat generation that will provide long-term financial sustainability for the city and Pikitup.

Traditional Waste Hierarchy

Potential Paradigm shift for CoJ / Pikitup

Today Proposed Strategy

0%

7%

0%

93%

20%

33%

40%

7%

INTERIM MEASURES TO IMPLEMENT (12 MONTHS)

• Focus on short-term gains in the Waterval area and prepare for roll out to other areas. i.e. Randburg, Selby, Southdale and Roodepoort depot areas.

• Investigate the viability of the Robinson material recovery facility (MRF).• Initiate feasibility studies for the MRF at Linbro Park transfer station.• Upgrade two garden sites to centres of excellence (subject to feasibility studies).

LONG-TERM MEASURES TO IMPLEMENT (TWO TO FIVE YEARS)

• Mobile buy back centres.• Buy banks – flats and townhouse complexes.• Make recycling facilities available at all 44 garden sites (two new sites established).• Establish 100 tonnes per day clean MRF at Marie Louise landfill site, based on

recommendations of feasibility study.• Complete the construction of a MRF at the transfer station at Linbro Park landfill site.• Review business operations of Pikitup to support waste minimisation strategy.• Five year target is to recycle 160 000 tonnes of recyclable waste generated in the CoJ

per annum.

FIGURE 2 (above) Pikitup’s waste minimisation objectives FIGURE 2 (above) Pikitup’s waste minimisation objectives

Traditional waste hierarchy

Potential paradigm shift for COJ Pikitup

Separation at Source initiative to include

more suburbs, and this will feature an

education drive to get more households to

separate their refuse from home to help

minimise what ends up at the landfill site,”

Mpungose concludes.


Let’s recycle our way to a better future.

We at Pikitup Johannesburg (Pty) Ltd. aspire to be the leading integrated waste management company in Africa. It’s why we’ve made it our mission to provide sustainable and innovative waste management solutions that exceed stakeholders’ expectations time and time again. Our service offering includes Round Collected refuse, Business Waste, Hazardous Waste, Special Waste, Landfill Sites, Garden Sites and Green Waste Recycling; just some more ways we’re working toward a better, greener South Africa.

70469B

Recycling

Plastics get the spotlight in this edition of RéSource. We take a look at the plastics

recycling survey results and Plastics SA’s achievement at The Green Expo.

Plastics – too valuable to wastePLASTICS RECYCLING SURVEY

Fulfilling its mandate of promoting the

responsible and sustainable use of

plastics as a material, Plastics SA

conducts annual surveys into the state of

plastics recycling in the country. A complete

survey of the plastics recycling industry in

South Africa was concluded in 2009, with

the updated estimates for 2010 recently

released. According to the updated recycling

figures released by Plastics SA, the recycling

of plastics in the country has shown a

steady increase during 2010. There were

194 recyclers operating in 2010, who have

managed to:

• recycle 241 853 tonnes of plastics

• provide 4 800 jobs

• create 35 000 indirect jobs with an annual

payroll of R240 million.

Tonnages recycled“The most significant impacts of plastics

recycling were job creation, the reduction

of carbon footprints and the re-use of non-

renewable resources,” says Anton Hanekom,

executive director of Plastics SA. According

to Hanekom, the most recent survey reveals

that the recycling rate of plastics (all plastics

converted) has increased to 18%. “These

statistics clearly show that there is a growing

demand for recycled plastics that has proven

it to be versatile, economic and reliable,”

he says. Similarly, the growth in virgin mate-

rial consumption showed a 4.7% increase

(from 1 280 000 tonnes to 1 340 000) dur-

ing the same period.

Plastics packagingOut of the 241 853 tonnes of plastics that

were recycled, 182 032 was plastics packag-

ing. This is an increase of 6% which is main-

ly due to the increased recycling rates for

PE-LD/LLD (for example,pallet wrap, shrink

wrap, shrouds, liners, bags, form-fill and

seal packaging, general flexible packaging,

protective wrapping, bubble wrap, etc) and

PET beverage bottles. The total amount of

plastics packaging in the waste stream was

recorded as 605 000 tonnes in 2010. The

2009 2010

Total tonnes converted

1 280 000 1 340 000

Total tonnes recycled

228 057 241 853

Recycling rate

17.8% 18.0%

TABLE 1 Tonnages recycled

derived recycling rate for plastics packaging

is therefore 30.1%.

Plastics packaging recycling rates will be

even higher, thanks to Tiger Brands’ deci-

sion to stop using oxo-biodegradable bread

bags. The South African Plastics Recycling

Organisation (SAPRO) welcomes this decision

as all bread packaging can now be recycled,

a development which will improve the recy-

cling rates for PE-LD/LLD.

Provincial representationThe 2010 survey results indicate that the

average tonnage per recycler has increased

in Gauteng, Limpopo and Mpumalanga as

well as in the Eastern Cape and the Western

Cape. “The overall tonnage increased by 17%

from 2009 to 2010 in the Western Cape and

the tonnage per recycler with 10%. A number

of separation at source collection systems

are in place in the Western Cape and the

increased tonnage could be a result of more

recyclable material of improved quality that

became available in 2010. Similar initiatives

were also started towards the end of 2010

in Gauteng and it remains to be seen if the

recycled tonnage will increase as a result

of more and cleaner available recyclables,”

Hanekom explains.

Source of recyclable plasticsInterestingly, the survey also reveals a

definite change in the source of recyclable


Out of the 241 853 tonnes of plastics that were recycled in 2010, 182 032 tonnes was plastics packaging

12 Tungsten Road, Isando, Gauteng, South Africa • P.O.Box 746, Isando 1600, South Africa Tel:(011) 974-5660 • Fax: (011) 974-5143 • Email:[email protected]

Ottowaste.indd 1 2010/07/05 11:29:45 AM

plastics waste from 2009 to 2010. Pre-

consumer materials increased by 38% and

post-industrial by 44%, while post-consumer

and landfill materials dropped by 14%. “We

attribute this change to the 2010 economy,”

Hanekom says. “In an attempt to reduce

operating costs, recyclers sourced cleaner

materials to recycle, hence the increased

figures for post-industrial and preconsumer

materials.”

Hanekom said consumers, recyclers

and the industry as a whole have

a huge role to play in helping the

recycling statistics to increase. “We

believe that the largest growth

potential in recycling lies in post-

consumer, household recyclables.

However, the costs of washing and

drying are prohibiting recyclers

from sourcing more post-consumer

and landfill recyclables,” he

continues.

Other hindrances facing local recy-

cling operations include the high cost

of water and electricity, wages, transport,

repairs and maintenance required on the

recycling plant and its equipment.“Whilst

a number of larger recyclers were able to

overcome these obstacles by investing

heavily in their recycling plants in order to

improve efficiencies of their washing and

drying facilities, we need government’s

support and a collective effort to find more

energy efficient solutions in the years to

come.” The Packaging and Paper Industry

Waste Plan submitted to the Department of

Environmental Affairs early in 2011 stated

FIGURE 2 Guillotine used for the slicing of plastics into strips

FIGURE 3 Random mixture of plastic elements in soil for different reinforcement concentration

an overall plastics packaging recycling rate

of 35% by 2015. The last updated statistics

for 2010 indicate that this could be achieved

as long as the current growth rates are

maintained.

Enviropaedia Award for recyclingOn a different note, Plastics SA was

awarded the 2011 Enviropaedia Award for

Recycling, at the inaugural Eco-Logic Awards

ceremony which took place in Cape Town

in November 2011, in partnership with The

Green Expo. “We are honouring companies

and individuals who are helping us fight both

the symptoms and the causes of environ-

mental problems,” says David Parry-Davies,

editor of The Enviropaedia, South Africa’s

reference to the green revolution and the

driving force behind the awards.

The organisation impressed the judges

with its ongoing commitment to increase

public awareness about the importance

of plastic recycling through its various

Enviromark activities. Under the auspice of

its sustainability director, Douw Steyn, this

non-profit organisation has launched and

driven numerous annual activities through

the years, including initiatives such

as National Recycling Day, Clean-Up

South Africa Week and the interna-

tional Coastal Clean-Up Day, which

takes place in September every

year. The Enviromark and its team

of eco-warriors have also become

a familiar sight at large interna-

tional sporting events such as

the annual Cape Argus/Pick‘n Pay

Cycle Race and the Two Oceans

Marathon, where they pick up and

recycle the litter that gets left behind

by participants and supporters.

“Plastics are often unfairly blamed

for polluting the environment,” said

Steyn, after he received the award.

“However, we are trying to educate the

public that plastics don’t litter – people do.

Used plastic packaging or discarded plastic

products should not end up in landfills. We

have a thriving, innovative and successful

plastic recycling industry in South Africa

that creates new products from virtually

every type of plastic – whether it is used

water bottles, plastic shopping bags or

yoghurt tubs.”

LANDFILL COMPACTORS (FOR SALE)from R395,000 - R995,000Machines available in stock ex Durban (23 – 30 tons)

Regular imports of HANOMAG, BOMAG & CAT

(23 – 45 tons)

Machines repaired & serviced at our workshop

Hanomag parts agent

PTN PARTS & EQUIPMENT CC CONTACT STEVE 031 700 3907 CELL 083 226 6156


Plastics are typically polymers of high molecular mass and may contain other substances to improve performance and/or reduce production costs

Recycling


Recycling

An exciting recycling initiative was launched in the

Katorus and Greater Alberton areas, which will initially be

piloted by Monde School in Katlehong, and will provide

surrounding communities with the facilities to recycle.

Adding sustainability to local communities

RECYCLING VILLAGES

iWYZE valuables insurance, in partner-

ship with the Wildlands Conservation

Trust, launched this initiative on 17

October 2011, which will provide surrounding

communities with the facilities to recycle,

and reward the schools for recycling efforts.

Wildlands has successfully rolled out similar

projects in KwaZulu-Natal, and the insurance

company has now partnered with the non-

governmental organisation to make the first

Gauteng implementation possible. “The fact

that Wildlands is already running a success-

ful recycling programme in KwaZulu-Natal at

various schools and shopping centres encour-

ages us to believe that this project will do

just as well in Gauteng,” says Willem Smith,

chief executive of iWYZE. “Based on results

from Wildlands’ current projects, we hope to

roll it out to the broader community, starting

this year.”

Monde Primary School was a good fit for

the team as the school is already considered

an eco-school, with a multitude of eco-

projects already in place. The school has an

eco-council overseeing initiatives such as

bird watching clubs, a full vegetable garden

and the rehabilitation of indigenous trees in

the area – evident that the school is already

on route to becoming an ambassador for the

environment.

Instead of throwing away household waste

so that it ends up in a landfill, members of

the community will now be able to deposit

their waste at a central point. Recycling vil-

lages, comprising eight different types of

bins – each one labelled for a specific type

of waste material (including paper, polysty-

rene, plastic, cans and glass) – have been

set up at the pilot school. Parents, pupils

and members of the community will be

encouraged to separate their waste into the

different categories and deliver it to the recy-

cling village at the school.

Not only will this initiative help the commu-

nity with its recycling efforts but there is also

a direct benefit to the school itself. Each

school will receive a 40% rebate on the recy-

clables collected, valued according to weight.

This money can then be used to improve the

school’s facilities, which in turn will benefit

the children. FIGURE 1 Recycling villages at school will aid in increasing sustainability within local communities

There are two types of electronic waste

recyclers: informal and formal. Informal

collecting off landfill sites operating

without infrastructure, with no identified waste

streams and formal waste collection, process-

ing and recycling services are rendered to

electronic equipment importers, IT providers,

telecommunications industries, corporations,

government, educational and medical institu-

tions. In the context of excellence, truly excel-

lent recycling organisations are measured by

their ability to achieve and sustain outstanding

results for their stakeholders.

The approach to sustainable e-waste recy-

cling excellence is supported by the funda-

mental concept of excellence and requires

total management commitment and a man-

agement team with clearly identified waste

streams and a full understanding, and accept-

ance, of the eight fundamental concepts:

results orientation, customer focus, leader-

ship and constancy of purpose, management

by processes and facts, people develop-

ment and involvement, continuous learning,

improvement and innovation, partnership

development and public responsibility.

Once the concepts of excellence are

deployed, accepted and operational, we need

to answer the question: Where are we now

in relation to these concepts? At the start-up

phase, on the way or a mature level? Once

we have these answers, we will be able to

Recycling

In a mountainous world of e-waste, lists of legislation, ever-changing working processes,

e-waste recyclers need a structured approach to key processes and waste streams in

order to ensure sustainable e-waste recycling excellence.¹ By Pieter van der Merwe*

Excellence in e-waste recycling

assess and refine results to determine what

the real benefits of excellence and the influ-

ence on our e-waste footprint are.

Organisational maturity stagesStart-up

• All relevant stakeholders are identified.

• Customer satisfaction is assessed.

• Vision and mission are defined.

• Processes to achieve desired results are

defined.

• People accept ownership and responsibility

in terms of solving problems.

• Improvement opportunities are identified

and acted upon.

• A process exists for selecting and managing

suppliers.

• Legal and regulatory requirements are

understood and met.

On the way• Stakeholder needs are assessed in a struc-

tured way.

• Goals and targets are linked to customer

needs and expectations. Loyalty issues are

researched.

• Policy, people and processes are aligned. A

leadership model exists.

• Comparative data and information is used

to set challenging goals.

• People are innovative and creative in fur-

thering organisational objectives.

• Continuous improvement is an accepted

objective for every individual.

• Supplier improvement and achievements

are recognised and key external partners

have been identified.

• There is active involvement in ‘society’.

Mature• Transparent mechanisms exist to balance

stakeholder expectations.

• Customer satisfaction needs and loyalty

issues are understood, measured and

actioned.

• Shared values and ethical role models exist

at all organisational levels.

• Process capability is fully understood and

used to drive performance improvements.

• People are empowered to act and openly

share knowledge and experience.

• Successful innovation and improvement is

widespread and integrated.

• The organisation and its key partners

are interdependent. Plans and policies

are co-developed on the basis of shared

knowledge.

• Societal expectations are measured and

actioned.

Benefits of excellence and its influence on the e-waste footprintIn an industry where legislation and regula-

tory standards are increasing and becoming

Main Key Process - Dismantling

KEY Processes

Secondary Processes

Printer cartridges

Non-Ferrous Metals

Ferrous Metals Plas cs Cardboard & Paper

PVC Cable Monitors and CRT’s

Lead Acid Ba eries

E-Waste arrives at Desco and is weighed in on the weighbridge

E-Waste is forwarded to the Receiving Yard, where it is sorted and sec oned into bins

E-Waste dismantled & stripped on the Desco premises and sorted into speci c waste streams

E-Waste is loaded at customer premises and transported

PC Boards

FIGURE 1 Key and support processes



the norm, the main strategic target areas are

seen as being focused towards the environ-

ment, customers, society and people – all of

which are addressed through key processes,

secondary and support processes, all of

which linked to downstream vendors, ensuring

that reuse and recycling takes place with very

little or no landfill at all.

Waste Electrical and Electronic (WEEE) recy-

cling is becoming more and more regulated

and having structures and permits in place

will not have a noticeable influence on the

e-waste footprint should the necessary infra-

structure and waste streams not be in place

and monitored. To be ISO 14001 certified

and compliant would be commendable and

having a mature excellence system, which

involves applying excellence concepts, would

be priceless.

Identifying key and secondary support processes in e-waste recyclingIdentifying e-waste streams

To identify waste streams and downstream

vendors, taking shared responsibility to pro-

cess and recycle further is to be seen as a

prerequisite to the e-waste recycling busi-

ness as no single recycler would be able to

handle the waste streams economically and

completely. Typical waste stream related to

e-waste would be:

• plastics

• cardboard and paper

• ferrous metals

• non-ferrous metals

• PVC cable

• monitors and CRT glass

• lead acid batteries

• printer cartridges

• precious metals.

Desco processes

Collection, sorting, dismantling and shredding

processes ensure controlled, sustainable one-

stop recycling of e-waste.

Minimising e-waste to landfill: Very little

landfill, or none at all, will take place should

all e-waste recyclers segregate and sort

e-waste for allocation to selected downstream

recyclers.

Recyclers then pass on fractions to one

another, ensuring further processing such as

smelting, precious metal extracting, plastic

converting and final disposing.

ConclusionHaving the necessary infrastructure in place,

working in accordance with set procedures

and processes and keeping the fundamental

concepts of excellence operational will prove

that excellence is not just a theory. It is the

achievement of tangible levels of results in

key areas that are ‘best in class’ and instilling

confidence that these results can be main-

tained, thus leading to sustainable e-waste

recycling excellence.

1 Collection of e-waste 2 Weighing of e-waste 3 Sorting the first level waste streams 4 Dismantling and further sorting into the relevant waste streams 5 Segregation of ferrous and non-ferrous metals 6 Shredding of PC boards

1

3 4

2

5

6

ACKNOWLEDGEMENTS: Costa and Desiree Airaga at Desco Electronic Recyclers for their e-waste vision, commitment and dedication.*Management Systems manager, Desco Electronic Recyclers. ¹Excellence as defined by the European Foundation for Quality Management (EFQM) is defined as outstanding practice in managing the organisation and achieving results based on a set of eight funda-mental concepts.

Recycling

Eighteen months ago, Consol Glass began construction of an

environmentally effi cient glass manufacturing plant in Nigel.

An incredible 1.2 million man-hours later, the fi rst phase of

the factory is complete, with the N1 furnace now operational.

Consol celebrates launch of new plantSUSTAINABILITY HAS A NEW HOME

Recycling

The new Nigel N1 furnace will contrib-

ute 110 000 tonnes of capacity to

the glass business, increasing its

production capacity by approximately 12%.

This equates to an estimated 530 million

glass containers per year. A site that is able

to facilitate up to six furnaces, Consol’s

second furnace will take less than nine

months to install and commission, and will

contribute a further 110 000 tonnes of

glass capacity annually.

Market demand will determine when this

second furnace will be brought online, and

like the first furnace, this too will have an

output of 400 tonnes per day. According

to Consol Group managing director, Mike

Arnold, the Nigel factory’s production capa-

bilities have been designed with flexibility in

mind, with the technology deployed capable

of producing the glass manufacturer’s com-

plete range of products.

Construction magnitudeThe enormity of the undertaking is unmis-

takable when reviewing the facts surround-

ing the project’s construction. To level

the terrain required moving enough soil

to fill 300 Olympic-size swimming pools.

Building was initiated using enough bricks

to build 30 three-bedroom houses; 16

Olympic pools’ worth of concrete, and

steel that weighed the equivalent of 2 000

medium-size cars was used. The cladding

of the structure utilised metal sheeting

which, if laid end-to-end, would form a line

80 km long.

In respect of investment in the area’s

upliftment, the new plant is already contrib-

uting towards development in the greater

Nigel area. Growth has been seen in infra-

structure, employment and community

development projects.


REUSE, RECOVER, RECYCLE

• Recycling remains a key internal focus on a group basis in order to minimise Consol’s demand for raw materials and to optimise energy efficiency. Accordingly, the Nigel factory includes a basic cullet processing facility to recycle all waste produced at the site.

• The master layout for Nigel includes provision for an external cullet processing plant as part of its future expansion programme.

• Initially the Nigel plant will be supplied with externally processed cullet from the existing Consol processing facility at its Clayville factory, as this plant currently has excess capacity following a recent investment

GOING LIVE

• The New IS machine, the first of its kind at Consol, was started on 5 September 2011 with the assistance of NTB in Japan. From that moment, the team worked tirelessly to fine tune the process essential for good glass.

• Just four weeks after the first trickle of glass the Nigel team achieved the first 90% pack to melt, and only a week after the startup of the last machine the first load of bottles left the gates of Nigel, headed for customer selling lines.

THE GREEN IN GREENFIELD

• The largest energy consumer on site is the furnace. However, it is foreseen that the chosen furnace design will yield a total energy saving of up to 20% when compared to older furnaces.

• Compressed air and cooling fans are the second largest electricity consumers at the plant. The chosen forming machines consume less compressed air and cooling wind, and will contribute to electricity savings on the fans, compressors and other greenfield site infrastructure.

• Annealing ovens also have significant energy consumption levels and Consol have invested in the most energy efficient gas-fired units that are available today. Gas-fired units are not only more efficient with the delivery of the energy, but are also much lower in carbon footprint.

• As a rule, all electrical motors were specified as high efficiency units and several hundred variable speed drives were installed throughout the plant where they can offer energy benefits.

LEFT The brand new Consol glass plant in NigelBELOW First glass production at the Nigel plant

Johannes Schuback & Sons(S.A.) PTY Limited, Johannesburg / RSAPhone: +27 11 7062270, Fax: +27 11 7069236

[email protected]

AMANDUS KAHL GmbH & Co. KGDieselstrasse 5, D-21465 Reinbek / Hamburg, GermanyPhone: +49 (0)40 727 71-0, Fax: +49 (0)40 727 71-100

[email protected] www.akahl.de

■ Most Advanced Technology ■ Most Efficient ■ Most Professional ■ Less Maintenance

■ Less Energy ■ Less Spare Parts ■ Integrated Rubber Granu late Production

Waste Tire Recycling PlantsWaste Tire Recycling Plants

“We have injected an estimated economic

contribution of R50 million directly into the

greater Nigel area. Though an impressive

figure, this is not where the impact of this

facility ends. The real impact on the Nigel

community will be felt in the positive impact

on the rest of the community so that those

who have not been directly involved will also

benefit,” says Arnold.

Commitment to the environmentIn keeping with the recently announced

African Green City Index which ranks

Johannesburg as South Africa’s green-

est city, Consol, as part of its commit-

ment to the environment, investigated

the most appropriate Energy Efficient (EE)

design for its Nigel Plant. EE design and

construction considerations were applied

to the entire plant, as well as the admin-

istration block, hence the construction

of the factory complied with the National

Environmental Management Act (NEMA)

environmental prescriptions.

“Our commitment to the environment is

widely recognised, a fact that has again

manifested during this project and the site

planning. Throughout the construction pro-

cess, an external environmental practitioner

monitored the project with regards to the

agreed Environmental Management Plan

(EMP) and we are very proud that the fac-

tory has achieved a clean bill of health.”

Recycling remains a key internal focus on

a group basis to minimise the glass manu-

facturer’s demand for raw materials and

to optimise energy efficiency. Accordingly

the Nigel factory includes a basic cullet

processing facility to recycle all waste pro-

duced at the site.

In addition, the master layout for Nigel

includes provision for an external cullet

processing plant as part of its future expan-

sion programme. Initially the Nigel plant will

be supplied with externally processed cullet

from the existing processing facility at the

Clayville factory, as this plant currently has

excess capacity following a recent invest-

ment. Construction of the Nigel cullet plant

will begin when recoveries from the waste

stream exceed the currently installed pro-

cessing capacity.

A look inside Consol’s new state-of-the-art facility


Landfills

Integrated Waste Management PlansWaste Disposal StrategiesIdentification and permitting of landfill sitesDesign of General and Hazardous Waste sitesDesign of Solid Waste Transfer StationsDesign of Material Recovery FacilitiesOptimisation of Waste Collection SystemsAuditing of Waste Management FacilitiesDevelopment of Operational PlansClosure and Rehabilitation of LandfillsQuality Assurance on Synthetic LinersWaste Recycling Plans

Specialist Waste Management ConsultantsSustainable and appropriate engineering solutions with integrity and professionalism.

Jan Palm Consulting EngineersTel +27 21 982 6570 / Fax +27 21 981 0868 / E-mail [email protected] / www.jpce.co.za

Gansbaai Recycling Centre

Velddrif Transfer Station

Botrivier Drop-off

Hermanus Materials Recovery Facility

Kupferberg Landfill

Stanford Drop-off


LandfillsDisposal, rehabilitation and extraction

PANEL DISCUSSION

Coupled with this and other shocking

statistics, municipalities countrywide

are undertaking to find meaning-

ful and sustainable ways of reducing their

waste impacts through the roll out of infra-

structure for waste diversion, such as mate-

rials recycling facilities (MRFs), composting

With the City of Johannesburg’s population growing at a

steady 9% per annum, the city has about eight years to

go before it runs out of landfi ll space.

plants, and waste transfer stations. But

significant waste minimisation efforts will

only be achieved if the regulations governing

domestic separation at source are properly

enforced. In the interim, landfills are a huge

source of gas to energy projects and still

require remediation and rehabilitation; whilst

the landfill layers need to be constructed

out of impermeable geosynthetics in order

to prevent leachate contamination.

In addition, sustainable drainage tech-

niques that have been developed to col-

lect, store and clean runoff before releas-

ing it into the environment, are essential.

Candice Landie facilitates this panel discussion, drawing attention to landfill sites holistically including the durability of geosynthetic linings, waste-to-energy projects, and consultancy and/ or engineering services offered in terms of landfill remediation/rehabilitation.

People Planet

Progress

40 years of better solutions

Kaytech has provided revolutionary improvements in geosynthetic solutions in South Africa for 40 years. With continuous technological innovation and a specialist support team of 20 professionals, you can rely on Kaytech for the complete solution.

Ongoing technological innovation includes:

professional support and consultation job creation through local manufacture 100% recycled bidim geotextile environmentally protective construction and

waste management solutions

For more information, call us onJohannesburg 011 922 3300East London 043 727 1057Cape Town 021 531 8110Durban 031 717 2300Or contact us on-line at www.kaytech.co.za oc

tarin

e 30

82


Landfills

R With regard to landfill rehabilitation and extrac-tion, what services are offered by Kaytech?GJ We manufacture and sup-

ply geosynthetic products to

the waste industry and also

provide technical support and

advice to consultants, regula-

tors, owners and clients. Our

products for new landfills extend

to protecting the immediate

environment from contamina-

tion from landfill waste – a vital

factor in making a landfill site

successful – by providing lining

and drainage solutions. Our

reinforcement products are also

used extensively in landfills in

hilly terrain as well as capping

systems in the rehabilitation

and closure of landfills. We are

the only local manufacturer of

geosynthetic clay liners (GCLs)

which offer the low permeability

properties required for general

waste and piggy-back landfills.

Our EnviroFix GCLs help prevent

ground water contamination

especially when laid in conjunc-

tion with a geomembrane to

form a composite liner in more

hazardous landfills. Many land-

fills have to be constructed in

areas with significant topogra-

phy resulting in the design of

liners on relatively steep slopes

and our Rockgrid reinforcement

grids are utilised in the design

to relieve the stresses imposed

on the liner by the overlying

drainage system and waste.

Depending on the type of waste

in the relevant landfill, extra

prevention of contamination by

leachate may be required and

depending on the lay of the land-

fill, any of our Zipcore, Zipdrain,

Geopipe and Flownet products

can be used in the leachate

PANEL DISCUSSION Garth James, marketing director, Kaytech

detection systems under the

geomembrane lining or in the

leachate collection systems

above the liner to drain away

excess contaminated water.

With geosynthetics being an important factor in help-ing to minimise leachate contamination, what are the quality factors that Kaytech looks for when selecting geo-synthetic layers? Our business is manufacturing

and supplying geosynthetics

and we

have been

providing

solutions to

successful

projects

for 40

years. Our

factory is based in Atlantis

in the Cape and among the

products, bidim, specifically, is

manufactured from 100% recy-

cled polyester. The polyester is

derived from plastic cool-drink

bottles sourced prior to disposal

or directly from landfillsorting

areas or transfer stations.

Regarding quality, the process

of creating bidim as a nonwoven

needle punched continuous fila-

ment geotextile means it has a

high tensile strength and comes

in thick, heavy grades. Its den-

sity renders it highly resistant

to abrasion and piercing. Both

the density and strength make it

the ideal cushioning protection

above or below geomembrane

liners as used in landfills.

Another important factor, from a

contractor’s perspective, is the

efficient and easy installation

that this product offers com-

pared to layers of sand, stone

or natural clay.

Can you give me examples of the drainage techniques used by Kaytech to collect, store and clean run off on landfills?Our drainage products supplied

to landfill sites assist in the

detection and/or collection of

contaminated water in the form

of leachate. Depending on the

type of waste in the relevant

landfill, extra prevention of

leachate contamination may be

required and depending on the

lay of the landfill, any of our

products mentioned in question

1 can be used above or below

the geomembrane lining to col-

lect and drain away excess con-

taminated water. Geosynthetic

products, besides offering

volume

savings,

are light

and easy

to install

on slopes

particularly.

Their

drainage properties are dimen-

sioned to fulfill the require-

ments of the drainage systems

within the landfill. Generally

water run-off is collected, stored

and treated in other more

conventional ways. However

run-off from a capped landfill

slope can cause damage to the

soil cover layer and different

geosynthetic products may be

used to prevent soil erosion.

These include the Multi-cell

geocell system which is filled

with soil that cannot migrate

down the slope because of the

confining nature of the cellular

structure. The slope could also

be covered with a geojute open

mesh structure called SoilSaver,

which prevents erosion but

also facilitates vegetal growth.

We also have erosion control

blankets which are more dense

in structure but have a greater

resistance to surface flow on

slopes up to 1:1.

By what percentage do landfill remediations / reha-bilitations extend the life of a site?Rehabilitation of a landfill refers

to a site which has reached the

end of its design life and thus

no longer has the capacity for

waste. It is then closed and as

previously mentioned may be

converted into a sports field or

recreation area, for example.

The life of a waste disposal site

cannot be extended per se but

the land usage may be extend-

ed for other activities. The con-

tentious issue of creating more

landfills for our waste prevails

and the need for recycling is

paramount.

The polyester is derived from plastic cool-drink bottles sourced prior to disposal

RIGHT TOP Bidim used as liner protection. Vissershok South and North Waste Disposal Site, Cape Town

RIGHT BOTTOM Laying Envirofix ( geosynthetic clay liner) to prevent leachate contamination: Bellville Waste Management Facility, Western Cape


Landfills

Conference & Exhibition6 - 8 November 2012

Sandton Convention CentreJohannesburg, Republic of South Africa

www.powergenafrica.com

Owned and Produced by: Presented by:

IMPORTANT NEW POWER EVENT COMING SOON TO AFRICA

About POWER-GEN Africa

The inaugural POWER-GEN Africa event will provide comprehensive coverage of the power needs, resources, and issues facing the electricity industries across Sub-Saharan Africa.

Global attention is being paid to Africa’s power requirements as the continent continues to experience rapid growth and development, driving the need for more widespread and reliable electricity.

With POWER-GEN Africa’s conference and exhibition focusing on all aspects of the power industry and bringing together the world’s leading power equipment suppliers with those developing power infrastructure in this dynamic region of the world, this is a new event you cannot afford to miss.

FOR FURTHER INFORMATION PLEASE VISIT WWW.POWERGENAFRICA.COM

GLOBAL TECHNOLOGY FORLOCAL SOLUTIONS

R With regard to landfill rehabilitation and extraction, what services are offered by Envitech?SJ Envitech offers the full

range of landfill engineering ser-

vices, from design of the facility

through to closure and rehabilita-

tion of the landfill. Included in

these services are the design

and installation of landfill gas

extraction systems, both during

the construction and operation

of the landfill, and after the clo-

sure of a landfill.

Can you cite two gas-to-energy projects under-taken by Envitech in the past three years?The eThekweni Metro – instal-

lation of landfill gas to electric-

ity systems on three landfills,

Stan Jewaskiewitz, director, Envitech Solutions

namely: Mariannhill, La Mercy

and Bisasar Road (gas engines

only). These projects are CDM

projects, which means that

landfill gas (a greenhouse gas)

is destroyed, thereby having a

positive effect on the environ-

ment and at the same time earn-

ing Carbon Emission Reduction

(CER)

credits for

the metro.

Other ben-

efits for

the metro

include

reduced environmental impact of

the landfills (less odour and gas

emitted), stabilising effect on

landfills through biodegradation

of organic materials and settle-

ment, which results in additional

airspace; and generation of

electricity for own use in the

local grid.

The Ekurhuleni Metro – instal-

lation of landfill gas extrac-

tion systems on four landfill

sites, namely: Simmer & Jack,

Rooikraal, Weltevreden and

Rietfontein. The next phase will

include the installation of gas

engines for

the genera-

tion of elec-

tricity. These

projects are

CDM pro-

jects, which

means that landfill gas (a green-

house gas) is destroyed thereby

having a positive effect on the

environment and at the same

time earning CER credits for the

metro. Other benefits include

reduced environmental impact of

the landfills (less odour and gas

emitted), stabilising effect on

landfills through biodegradation

of organic materials and settle-

ment, which result in additional

airspace; and when the gas

engines are installed, generation

of electricity for own use in the

local grid. Another current pro-

ject is located on the Kupferberg

Landfill in Windhoek, Namibia.

This turnkey project was recently

awarded and is currently in the

design phase.

What are the quality factors that Envitech looks for when selecting geosynthetic layers? Geosynthetic liners are used at

the bottom of landfills to prevent

Benefits for the metro include reduced

environmental impact of the landfills

PANEL DISCUSSION

Landfills

the seepage of leachate

into the surrounding ground

and underlying ground water

body. Geosynthetic liners

are normally referred to as

geomembranes and can be

made from various materi-

als. However, the preferred

choice of materials is high

density polyethylene (HDPE).

Some of the properties of

the geomembrane, which

impact on the quality of the

liner include:

• the geomembrane liner

must be impermeable

• the density of the liner

• tensile properties

• tear resistance

• stress crack resistance

During construction or instal-

lation of the liner, we also

look at appropriate installa-

tion procedures, leak detec-

tion using electric scanning

procedures, testing of weld-

ing seams and we take sam-

ples for testing in an inde-

pendent laboratory to confirm

that the specifications for

the geomembrane liner have

been complied with.

Can you give me examples of the drainage techniques used by Envitech to col-lect, store and clean run off on landfills?There are two types of run-

off, namely: clean storm

water runoff and contaminat-

ed runoff. The clean storm

water runoff should normally

be diverted around or away

from the landfill to prevent it

from becoming contaminated


and or infiltrating the landfill

and then becoming leachate.

This runoff is diverted

through the use of catch

water drains consisting of a

lined drain and earth berm

and the water is discharged

to the environment as it is

considered to be uncontami-

nated. This type of drainage

is also implemented on sec-

tions of the landfill that have

been closed and rehabilitated

in order to minimise the

amount of water entering the

contaminated water system.

All contaminated water runoff

arises from the operational

areas of the landfill includ-

ing the operational landfilling

face. All contaminated runoff

water is collected in lined

drains and channeled to a

contaminated water pond or

dam to prevent any uncon-

trolled release to the envi-

ronment. The contaminated

water dam is also used as an

evaporation dam to reduce

the volume of contaminated

water. Dependant on the

quality of the water, it can

also be used for dust sup-

pression on the landfill itself.

By what percentage does landfill remediation /reha-bilitation extend the life of a site?Landfill rehabilitation in itself

does not extend the life of a

landfill. However, biodegrada-

tion (sometimes referred to

as bioremediation) of the

organic materials, which can

range from 30% to 45% of

the waste stream, gives rise

to the production of landfill

gas, water and carbon. This

process in itself reduces the

mass and hence volume of

the landfill through settle-

ment which results from the

overlying landfilled materials

compressing the lower biode-

graded materials. Case stud-

ies have shown that up to

30% settlement of the landfill

can be attained during the

life of a landfill. This means

therefore that some 30% air-

space can be recovered and

hence the life of the landfill

can be extended by that

amount. This process can be

stimulated through the pro-

cess of landfill gas extraction

which helps to speed up the

process of biodegradation

and hence results in a faster

settlement process. The

amount of settlement that

can be achieved depends on

a number of factors, includ-

ing, waste quality, waste

types, organic fraction,

compaction and the pres-

ence of moisture amongst

other things.

What are your thoughts on domestic separa-tion at source and waste

minimisation? Domestic separation at

source and waste minimisa-

tion are essential if we are

ever going to reach a stage

of being able to “save”

our landfills! Many of our

municipal and even the large

Metro landfills are reaching

the end of their lives and it

is becoming more difficult to

find and develop new landfill

sites. This is because of the

“unpopularity” of landfills

near communities, the lack

of adequate planning and the

lack of funding. We there-

fore need to engineer and

manage our landfill sites in

such a way as to extend the

lifespan of landfill into the

foreseeable future.

HDPE Geomembrane deployment on landfill site in Qatar

21 – 24 May 2012 Expo Centre, Johannesburg, South Africa

RENEWABLES LARGE INDUSTRY

INFRASTRUCTUREINVESTMENT

T&D /SMART GRIDS

GENERATION WASTE MANAGEMENT

METERING WATER

Waste and landfill management, recycling and sustainability

African Utility Week - Waste aims to create a culture of waste minimisation throughout the continent by presenting case studies from countries who have managed their waste effectively and who have, enforced responsible attitudes and behaviours toward waste management.

www.african-utility-week.com

Special offer for ReSource Magazine readers: 10% off your registration fee. Quote reference RES01.

RENEWABLES LARGE INDUSTRY

INFRASTRUCTUREINVESTMENT

T&D /SMART GRIDS

GENERATION WASTE MANAGEMENT

METERING WATER

Follow us:@AfricaUtilities

Media partner:

Africa’s all encompassing event for municipalities, utilities and large industrial end users

Waste Management

With regard to landfill reha-bilitation and extraction, what services are offered by WorleyParsons?CL WorleyParsons has a team

of waste engineers and waste

specialists that, inter alia,

deals with professional services

for landfill rehabilitation. This

includes rehabilitation closure

designs, costing for closure and

rehabilitation, and the waste

management licence applica-

tion for closed or to be closed

landfills in terms of the National

Environmental Management

Waste Act (NEMWA), 2008.

Can you cite two landfill remediation projects under-taken by WorleyParsons in the past three years and how these projects have benefited

PANEL DISCUSSION Chris Liebenberg, business unit manager, WorleyParsons RSA

the relevant municipalities/cities?WorleyParsons have dealt with

the professional services to

close and rehabilitate the exist-

ing Vryburg and Goedemoed

Prison landfills during the past

three years. Contracts to supply

the services for

closure, con-

struction and

rehabilitation for

these sites are

in the process

now. We have

rehabilitated the

Zuurfontein landfill in Emfuleni

Local Municipality adjacent to

a mall in Vanderbijlpark, and it

aesthetically looks appealing,

especially for the people visiting

the mall. WorleyParsons also did

the rehabilitation and extension

of the Karwyderskraal landfill

in Cape Town, as well as the

rehabilitation of the Standerton

landfill. The closure and reha-

bilitation of the landfill site will

result in complying with legisla-

tion with regard to responsible

waste management and for the

landfill to

have a final-

end-use,for

example,

being used

as a sports

field.

What are the quality factors that WorleyParsons looks for when selecting geosynthetic layers? The quality parameters of the

supplier are scrutinised to

ascertain if sufficient quality

testing has taken place for the

specific conditions on site that

would include leachate chemical

characteristics. The geosynthetic

contractor/installer in these

instances issues a guarantee or

warrantee with the supply and

installation of their products to

ensure peace of mind of the

engineer and client.

Can you give me examples of the drainage techniques used by WorleyParsons to collect, store and clean run off on landfills?Surface drains, for example,

hearing bone drain systems,

We have rehabilitated the

Zuurfontein landfill in Emfuleni Local

Municipality.


Landfills

cut-off drains, toe drains, carpet

drains, storm water cut-off chan-

nels, storm water cut-off berms,

and sub-surface cut-off drains

are some of the methods, but

not limited to, for transport-

ing run-off in a legal manner,

that is, into the environment

if it complies with standards

or contained in collection

dams. Collection dams can be

constructed and lined by various

means ranging from concrete to

geosynthetic liners. Treatment

options vary depending on budg-

et, chemical characteristics and

treatment standards required,

for example, reverse osmosis,

settling tanks, physical and

chemical treatment options.

By what percentage do land-fill remediations/rehabilita-tions extend the life of a site?

Rehabilitation, for example, daily

compaction and covering, does

not extend the life of a landfill

but rather makes for good opera-

tions. This also reduces the cost

of the final rehabilitation.

What are your thoughts on domestic separa-tion at source and waste minimisation? No legislation is in place for sep-

aration at source, however some

municipalities do have by-laws

in place to minimise disposal

of waste to landfill. The current

legislation is moving towards the

polluter-pays principle whereby

this type of movement will be

introduced more and more, that

is, it will become more expen-

sive to dispose of waste there-

fore separation at source will

become more appealing.


Landfills

Solutions for demanding needsslow speed shredders

– UNIQUE VERSATILITY• Appropriate for most waste fractions, i.e. municipal waste,plastics, railway sleepers, tyres, mattresses, bulky waste, cables• Easily adjustable for production of different particle sizes• Simple to operate and to monitor• Advanced control system with an optional remote access• Wide selection of models

compactors

– CRUSHING FORCE• Maximum compaction with minimum time• Unique design• Advanced control system with an optional remote access• Maximized cost-efficiency of operations• Five models ranging from 26 to 52 tons in operating weight

Landfill Equipment cc P O Box 159, 51 Isando Road, Isando 1600Tel: +27119748874 e-mail: [email protected]

With regard to landfill reha-bilitation and extraction, what services are offered by Aquatan?PM Aquatan has, for the past

46 years, provided the on-site

service of supply, installa-

tion and testing of a variety

of geosynthetic materials to

store liquid and prevent pollu-

tion/contamination of soil and

sub-surface water resources.

Aquatan works to a strict qual-

ity control programme to meet

the design parameters of the

engineer. Geosynthetics include:

geomembranes such as HDPE,

LLDPE and RFPP, amongst oth-

ers; geotextiles which include

woven and non-woven protection

and filter material; geosynthetic

clay liners; and geodrains such

as cuspated sheets and geonets

PANEL DISCUSSION Piet Meyer, managing director: Aquatan

and other geosynthetics not

necessarily installed by Aquatan.

The installations are done by

professional teams of contract

managers who look after the

site installation teams most of

whom have international certi-

fications as welders. Liners are

installed using the latest avail-

able installation equipment.

The geomembranes are

installed under strict quality

control procedures which are

continuously verified during

construction by testing every

seam non-destructively, and

selected seams destructively

during construction. Aquatan

is equipped to also apply

Electric Leak Detection and

spark testing on completion of

a project. The lining operation

is recorded and controlled from

start to finish using the unique

electronic Aquatan project

manager system.

Can you cite two gas to energy projects OR landfill rehabilitation projects (or one of each) undertaken by Aquatan in the past three years and how these projects have benefited the relevant municipalities/cities?We install geosynthetic liner

systems in many landfill sites,

both for leachate collection in

the base of the landfill and for

leachate storage in the leachate

collection ponds. We also do

landfill covers of filled landfill

sites. Sites include Holfontein,

Bisasar Road Landfill,

Shongweni, Vissershok in Cape

Town and many more.

On the gas to energy side, we

supplied and installed the liner

and floating cover to a

reservoir for a large farming

group where manure is kept and

methane gas collected. The gas

is used to generate power and

heat (heat exchangers) to pro-

vide heating to the pig sties.

With geosynthetics being an important factor in help-ing to minimise leachate contamination, what are the quality factors that Aquatan looks for when selecting geo-synthetic layers?You will be aware that only 1%


Landfills

For your geomembrane lining requirements please contact : T F atan.com, Website: www.aquatan.com

Hazardous and toxic waste, raw water, potable

and turnkey solutions for liquid containment, based on state-of-the-art geomembrane lining technology.

Single linings and multiple composite lining systems for hazardous liquid storage, solid

sewage ponds, linings to tunnels and canals for infrastructural development, bund areas, raw and return water dams, tank linings for industry, dams for agriculture and aquaculture,

ornamental lake and water features. Clean water dams, slimes dams and clear water dams.

AQUATAN – an SABS ISO 9001 company

LINING SYSTEMSAQUATA

of the world’s fresh water is

suitable for human usage. The

Business Day reported that

amendments to environmental

laws could see polluters fac-

ing fines and/or imprisonment.

The Bill further states that

“no person may unlawfully and

intentionally or negligently”

pollute or degrade the envi-

ronment through an act or

omission. South Africa has a

National Waste Management

Strategy dated November

2011, in place, which outlines

government’s intentions.

In view of the above, Aquatan

considers its responsibility

to implement the engineers’

designs in addition to applying

our 46 years experience very

seriously. Given our track record

in the industry and coming from

a manufacturing background,

we are very conscious of the

manufacturing requirements to

produce a functional geomem-

brane that will last the 100

years expected life under chal-

lenging conditions. This very

much depends on the quality of

the polymer used, the ingredi-

ents of the Masterbatch, which

protects the polymer from the

ultraviolet and heat of the sun,

the manufacturing method and

the production machine’s ability

(smooth, textured or embossed

properties) to produce a

decent product.

The integrity of the substrate

(earthworks or concrete) on

which the liner is installed,

design of penetrating pipes and

structures to which the liner

is to be sealed, the anchor

mechanism and many other

factors have a major influence

on the long-term performance

of the selected geomembrane.

The SABS, together with stake-

holders (users, authorities,

manufacturers and installation

contractors) are continuously

working on the improvement

of existing geomembrane

specifications and installation

Code of Practice. When the

structure details are accept-

able to receive the liner, factors

such as deployment method

and direction of deployment,

and seaming methods and

control thereof, play a major

part in the long-term survival of

selected membranes.

Can you give me examples of the drainage techniques used by Aquatan to collect, store and clean run-off on landfills?The drainage of a landfill site

is part of the design phase.

From the liner’s point of view,

it is critical that subsequent

activities on top of the liner are

executed such that the liner/

liner system is not damaged. In

order to achieve this, synthetic

drainage layers such as cuspat-

ed drains are often preferred to

protect the geomembrane from

subsequent, potentially harmful,

activities. Leachate is collected

and channelled to leachate col-

lection ponds which often, due

to the hazardous nature of the

leachate, are lined with double

composite liners including a

leakage detection layer. The

leakage detection layer is meant

to intercept leakage that may

develop in the relatively thin

geomembrane to prevent the

hazardous liquids from reaching

the environment. Maximum

leakage rates are prescribed in

legislation, which if exceeded,

require action to be taken.


Landfills

G E O S Y N T H E T I C S & G E O M E M B R A N E S

S I M P L I C I T Y = P E R F E C T I O N

GAST is the premier provider of geosynthetic products and installation services. We provide complete service and support for any geosynthetic requirement.

GAST offers extensive experience and superior quality, innovative products. Detail drawings, as well as extensive technical and estimating support can be provided to assist with designs for the most economical and constructible configuration which meets the project requirements.

7 9 9 4 Q M S 0 0 1

With regard to the installa-tion of linings, what lining sites has Gast worked on locally? KG GAST has been involved

with numerous projects locally

and abroad, with some of our

flagship projects including a

2 000 000 m² geosynthetic

lining for the Medupi Power

Station, 800 000 m² for Ghana

Goldfields, and more recently,

4 000 000 m² for the Kusile

Power Station.

Why are HDPE liners popu-lar for use on landfill sites?High density polyethylene liners

or geomembranes are a crucial

component for environmental

safety including that of waste

encapsulation. Unprotected and

protected landfill sites pose

an environmental threat. This

threat risk is mitigated by the

use of environmental liners

and more so by HDPE. These

membranes have the capability

to ensure that the majority of

contaminants are largely kept

safe and under control. This is

achieved via the highly sought

after properties of HDPE

namely lifespan, crystallinity,

goodchemical resistance and

exceptional UV resistance.

How many layers of lin-ings is a landfill site com-posed of and what are the important quality factors that Gast looks for when selecting landfill linings for installation? Landfill site designs are deter-

mined by the type of content

to be discharged in the landfill

as well as the geotechnical

and morphological (soil) con-

ditions of the chosen site.

These include sanitary waste,

municipal solid waste, con-

struction waste and industrial

waste. Each type of landfill site

therefore requires different

needs and systems; however

K Gast, MD (Division 7): The Gast Group

the most standard systems are

either HDPE or geosynthetic

clay liners, in some cases both

systems are used in conjunc-

tion with one another. The most

important objectives of any

landfill site are the control of

pollutants into ground water

and the release of gasses into

the atmosphere.

Is there anything that Gast does differently with regard to linings installation?Since GAST’s inception in

1961,

we have

been firm

believers

of a sin-

gle point

respon-

sibility

philosophy.This means that our

clients have a single por t of

call and we assume and accept

responsibility for our clients’

designs objectives. We achieve

this through our award winning

quality assurance and quality

control plans. Our quality con-

trol systems and materials are

backed by a 10 year warranty.

A fur ther cornerstone of our

success has been attributed

to a transparent procurement,

quality and installation system

that is communicated almost

daily to our clients regarding

their projects.

Q.How does the efficient installation of linings aid in the overall lifespan of a landfill site? A.The procurement of high qual-

ity materials is of paramount

importance as cer tain materi-

als only have a 10 year lifes-

pan whereas the higher quality

products can last anywhere

from 20 – 50 years. The instal-

lation of HDPE is a techno-

logically orientated market with

very few true specialists still in

existence today, not to mention

the fact that the installation

process demands improvement

through modernisation with

more effective systems being

developed regularly. If a lin-

ings contractor has a rigorous

quality control system in place

with highly skilled personnel

the achieved result should

meet the designed expecta-

tions. Failing to achieve this

will result in leachate permeat-

ing ground water or aquifers.

Proper closure of landfill sites

(capping) obviously reduces

the risk of air

pollution but

has a poten-

tial spin-off

of capturing

methane if

so designed.

What is the difference between geomembrane lin-ings and geosynthetic clay linings, and is there a dif-ference in the installation process? A geosynthetic clay lining (GCL)

is a woven fabric-like material

which incorporates a sodium

bentonite basis or other forms

of clay, which have low hydrau-

lic conductivity. The lower the

hydraulic conductivity the more

effective the GCL will be at

retaining seepage inside of the

landfill thus lowering the rate

of seepage out of the landfill.

Geomembranes are normally

manufactured from a ‘plastic’

polymer called polyethylene and

can vary from 0.5 mm to 5 mm

in thickness. The geomembrane

itself impervious n ormally acts

as a seal and protection layer.

The installation of both these

products vary dramatically

whereas a GCL is installed

using more conventional meth-

ods, the installation of HDPE is

far more technically challeng-

ing. Geomembranes installa-

tions utilise a state of the ar t

plastic welding machine that

thermally fuses the geomem-

brane sheets together.

Any additional comments you would like to make in relation to Gast and the work the company does on landfills?Over the last 50 years GAST

has been at the forefront of

technological advances in the

environmental and water relat-

ed industries with over 10 000

projects completed success-

fully in 24 countries. Our busi-

ness model has been refined

to provide our customers with

a hassle free service and

exceptional quality standards.

Hence our motto has always

been simplicity equals per fec-

tion.

We achieve this through our award

winning quality control plans

PANEL DISCUSSION


Landfills

Waste to energy

Domestic space and water heating contributes to a

signifi cant amount of an average home’s CO2 emissions.

In order to reduce these CO2 emissions, we need to fi nd

new, more effective means of heating homes.

Renewable heating technologyECODAN HEAT PUMP

The drive to reduce energy consump-

tion and the impact it has on the

environment is crucial and should

be increasingly important to us all. Energy

efficiency has long driven Mitsubishi Electric

to spend millions of rands and huge amounts

of resource on researching and developing

solutions for the future.

The company claims that, by simply using

the Ecodan air source heat pump to provide

domestic space heating and hot water, it is

possible to greatly reduce Carbon dioxide

(CO2) emissions and ultimately your home’s

running costs. Using proven heat pump tech-

nology used in the heating and cooling indus-

try, the system upgrades naturally-occurring

energy from the air and uses it to provide

domestic space heating and hot water.

TABLE 1 Electricity cost comparison

Electricity rate: R0.89

Number of people: 4

Litres/person/day: 90

Water temperature in: 15°C

Water temperature out: 55°C

Input power (KW) Output power (KW)Standing loss/24hr

(KW)kW/hour per month Running cost (R) Saving/month R/%

ELECTRICAL GEYSER 3 3 1.96 569.1 506.46 -

ECODAN HEAT PUMP 1.95 kW* 5 kW** 1.96 kW 221.9 197.52 308.94/61

Domestic applicationHeat pump technology has been used around

the world for decades and Mitsubishi Electric

has developed this technology for domestic

application to produce Ecodan. Air source

heat pumps are easy to install and suitable

for a wide variety of properties, from apart-

ments to houses. The air source heat pump

system consists of an external box which is

fitted to an outside wall – harvesting renew-

able, low grade energy from the outdoor air

and upgrading it into useful heat to supply a

home with hot water and heating. For every

1 kW of electricity fed into an Ecodan heat

pump unit, that is, the outdoor part of the

heating system, you can get at least 3 kW

of heating energy. The overall system effi-

ciency and energy savings will depend on

the comparison with a home’s current heat-

ing system, satisfactory system design and

installation, and operational settings, i.e.

how the heating system is used. The heat

pump unit (the outdoor part of the heating

system) can work all year round, even if the

ECODAN HECODAN H

outdoor temperature drops as low as -15°C.

Benefits of the system include a 30% reduc-

tion in CO2 emissions, saving up to 60% on

the electricity cost of heating water, and the

fact that it is a self-contained, easy to install

unit which only requires water and electri-

cal connections. The system also utilises a

closed loop circuit, which means less risk of

contamination between water and refriger-

ant, as well as a prolonged equipment life

expectancy.

5 BEDROOM REFURBISHMENT

The Ecodan system installed in a large five bedroom house near Newcastle delivered an average winter COP of 3.25, with an average ambient outdoor temperature of 4°C. The 14 kW Ecodan system has been retrofitted to the property and supplies both combined space heating and all hot water requirements for the detached house, which houses a family of four, including two young children. Over the winter period, the owners reported savings in running costs of between half to two thirds when compared to the previous LPG boiler.

• Number of bedrooms: Five• Age of property: 1999• Previous heating system: 22 kW-rated LPG boiler• Replaced with Ecodan: 14 kW unit• Average: COP 3.25• Average outdoor temperature: 4°C• Running cost reduction: 50 – 66%• CO2 reduction: 50%

3 BEDROOM NEW BUILD

5 kW Ecodan system installed in this new three bedroom end-of-terraced property in Langford, Hertfordshire, achieved an average COP 3.25 over the winter against an average ambient temperature of 7°C. The family of three has a new baby and the home is heated by traditional radiators, with the smallest of the Ecodan range (5 kW) providing all heating and hot water requirements.

• Number of bedrooms: Three• Age of property: 2008• Previous heating system: None• Replaced with Ecodan: 5 kW unit• Radiator upgrade: Uncharged• Average: COP 3.25• Average outdoor temperature: 7°C


COP 17 feature

The recent Conference of Parties (COP17) meeting in Durban was its usual rollercoaster

ride, ending with a surprise commitment by most of the 200 countries which took part

to continue the Kyoto Protocol, along with a raft of other climate change agreements.

While the outcome has signalled a breakthrough for a political consensus on climate

change, the outcome for business is only just becoming clear. by Yvo de Boer*

The expectations, outcomes, and effect on business

COP 17 AND THE KYOTO PROTOCOL

A t one point, the COP17 meeting in

Durban looked as if it was heading

for disaster. Now that it is over, it

is clear that the world is still heading in the

right direction in terms of its approach to

dealing with climate change and is more

firmly committed to a low carbon path

than it was before the meeting. The United

Nations Framework Convention on Climate

Change (UNFCCC) process, although slow

and beset with challenges, is moving

forward. Expectations for Durban were very

low, but in spite of this, the conference led

to a significant breakthrough that will have

important consequences for businesses

around the world (see Table 1).

Slowly but surely, like it or not, the world

is moving forward on climate change, with

business now able to seriously calculate

the implications of a low carbon economy.

The Kyoto Protocol has been given a

second lease of life and will now operate

within the context of

a broader approach

to tackling climate

change that will,

for the first

time, include

all the major

emitters. This

is a crucial

point which will

impact many of the largest business opera-

tors around the world and many smaller

businesses fur ther down the supply chain.

There will be a second commitment period

to star t from 2013, meaning that all of the

treaty’s rules, mechanisms and markets

will remain in force.

Business can be confi-

dent that market-based

mechanisms such as

the Clean Development

Mechanism (CDM) will

continue. But more

importantly, there is a

commitment to a new

legal, global instrument


2° c is the amount by which the planet will be allowed to warm. Leaders of the world's eight richest economies have agreed to the historic deal

setting this maximum limit on global temperature rise


to be approved by 2015 and planned

to take effect by 2020. As a result, an

international agreement for global action

on climate change is within our reach and

should therefore be considered within

every forward looking business strategy.

2015 and beyondWith a pinch of luck, by 2015 the current

economic crisis will be behind us, creating

a more benign climate for governments

to make commitments the world needs in

order to tackle climate change effectively

and make business survive and prosper.

In addition, the 2015 deal will take place

against the background of a new assess-

ment by the scientific community to be

published in 2014, which is likely to deliver

a wake-up call for us all. While the rhetoric

has been very impressive, our concrete

actions have not taken us anywhere near

where we need to be to keep tempera-

ture rises to below 2ºC.

The Durban conference means that

the deadlines for approval and imple-

mentation of the agreement have been

settled, but its exact nature remains

open to interpretation. The new working

group created to formulate the agree-

ment therefore has a crucial role to play

in building on the solid advances that

emerged from the conference. We need

urgent clarity on the legal nature of the

outcome and the targets that will be

involved for the various par ties.

Important progress was also made on

the establishment of the Green Climate

Fund which aims to mobilise US$100 bil-

lion annually to help developing nations

reduce emissions and adapt to the

effects of a warming climate. Prior to

the conference it was unclear what role

business would play in the fund- the worry

was that the private sector would be side-

lined. Thankfully, Durban saw confirmation

that the Fund will have a facility to support

private sector initiatives. It will seek active-

ly to promote business involvement and

catalyse fur ther public and private money.

This approach could see public-private

par tnerships in developing nations acting

as vehicles for sustainable growth. Such

initiatives would have the potential to build

green industries, create jobs, alleviate pov-

er ty and improve infrastructure as well as

tackle climate change.

A less publicly noted success to come

out of the COP 17 at Durban was the com-

mitment to develop a common system

The third phase of the European Union (EU)

Emissions Trading Scheme runs from 2013

to 2020, which may influence how long the

period lasts, not least since the commit-

ment of Russia, Japan and Canada before

the meeting not to sign up to a second

commitment period remains in force.

The main impact of the extension will be

on the EU, which makes up the bulk of the

Annex 1 countries that have committed to

reduce their emissions – and on carbon

markets because the Kyoto Protocol’s

accounting rules, mechanisms and markets

all remain in action as effective tools to

leverage global climate action and models

to inform future agreements.

A new legal instrument will be developed

for ratification by 2015 and implementation

by 2020, with a “raised level of ambition”.

The instrument will be applicable to all

for measuring, reporting and verifying

emissions reduction. This is a key foun-

dation for progress especially because

lending from the Green Climate Fund may

be results-based. If the private sector is

to invest at scale, then there must be a

robust and internationally accepted frame-

work for evaluating achievement.

The impact of Kyoto’s extensionThe Kyoto Protocol was widely expected

to wither away at the end of its first com-

mitment period in December 2012. But

agreements on a new deal that will, for the

first time, commit the United States, China

and India to cut emissions facilitated the

extension of the Kyoto Protocol. A second

commitment period will run from 2013,

for either five or eight years, with the final

duration to be decided at the end of 2012.

KYOTO PROTOCOL AND COP17 – THE OUTCOME

• The world’s climate change community travelled to Durban for the COP17 climate conference with expectations set very low. The prospects for the Kyoto Protocol looked bleak, and as a result there was great uncertainty over the future of the CDM and Joint Implementation carbon markets.

• Key players seemed set on apparently irreconcilable positions, with many developing countries insisting that Kyoto must continue at all costs, while countries such as Russia, Japan and Canada were equally adamant that they would not get involved in a second commitment period.

• The two largest emitters, China and the United States, seemed as far apart as ever, while the key cheerleader for the process, the European Union, appeared absorbed by its internal financial problems and was still smarting from the disappointments of Copenhagen.

• The whole UNFCCC process was in danger of becoming an irrelevant sideshow. Yet as Durban headed into the final weekend, rumours started to circulate that a deal would happen – and a significant one at that. And finally, some 36 hours after the conference was due to end, and after a few heads had been metaphorically knocked together, an agreement was reached.

• The Kyoto Protocol has been given a second lease on life and it will now operate within the context of a broader approach to tackling climate change that will, for the first time, include all the major emitters. There will be a second commitment period, to start from 2013, meaning that all of the treaty’s rules, mechanisms and markets will remain in force.

• Business can have confidence that market-based mechanisms such as the CDM will continue.

COP 17 feature

500 1000 1500 2000

100

200

300

Required on Site (days/year)

Used

2 h

ours

/day

Rental

Cat C

ertif

ied

Used

4 h

ours

/day

New10 hours/day

20 hours/day

8 hours/

day

6 hou

rs/d

ay

Utilisation: (hours/year)

parties – not just the developed nations

that signed up to Kyoto. It means that for

the first time, the United States, China and

India have committed to a legally-binding

global agreement to reduce their emis-

sions, albeit not for almost a decade. In

addition, the ‘devil is in the detail’ and not

only is there a lot of detail but working it

out has been postponed to future years.

However, COP17 could have resulted in the

international climate change process falling

in a heap and the major emitters walking

away and going it alone. So there is cause

for cautious optimism and a clear signal

that no government wants to be seen as

the wrecker of the climate change process.

It is also significant that the process has

moved into the 21st century and climate

change is no longer being seen as an

issue that is up to the developed world

to fix alone. The new legal instrument will

Mills & Otten ccEnvironmental Consultants

1998/46338/23 Johannesburg Cape Town Tel: (011) 486 0062 Tel: (021) 671 7107 Fax: (086) 554 6573 Fax: (021) 671 7107 Contact: Charles Mills / Kirstin Otten Contact: Stephanie de Beer

Independent Environmental Consultants specialising in:

Environmental Impact Assessments Environmental Management Systems Environmental Audits

Contaminated Land Assessment Environmental Management Plans Waste License Applications

[email protected] www.millsandotten.co.za

apply to all par ties.

ConclusionPolitically, it was interesting to see in

Durban the emergence of a strong coali-

tion between the EU and a large number

of developing countries, combining for a

strong outcome in the shape of a new and

all-encompassing legally binding instru-

ment. Another significant advance was the

indication that major developing countries

including China (so important to a United

States agreement) will consider signing up

to a legally-binding obligation in the context

of a post-2020 framework.

Business can see from Durban a clear

signal that the international community is

committed to taking the climate change

agenda forward, that market-based mecha-

nisms will continue and that there will be

clear reporting guidelines. The climate

agenda may have taken a large step for-

ward but the ‘devil’s in the detail’ and

business will soon be calling for clarity.

The ‘devil’s in the detail’ and business will soon be calling for clarity


* ABOUT THE AUTHORYvo de Boer is responsible for thought leadership on strategy development, driving the development of KPMG’s Sustainability Service as a global ambassador for the company. Prior to

joining KPMG, De Boer was executive secretary of the UNFCCC.He has been involved in climate change policies since 1994- he helped to

prepare the position of the EU in the lead-up to the negotiations on the Kyoto Protocol; assisted in the design of the internal burden sharing of

the EU and has since led delegations to the UNFCCC negotiations. De Boer launched an international dialogue on the clean development

mechanism and has partnered international discussions with the World Business Council on Sustainable Development, aimed at increasing private sector involvement

development of KPMG s Sjoining KP

He hpreKyo

th

*KPMG’s Special Global Advisor, Climate Change and Sustainability

COP 17 feature

At the very heart of the response to cli-

mate change, however, lies the need

to reduce emissions. In 2010, govern-

ments agreed that emissions need to be

reduced so that global temperature increases

are limited to below 2°C. The negotiating

process on climate change revolves around

the sessions of the Conference of the Parties

(COP) to the United Nations Framework Con-

vention on Climate Change (UNFCCC), which

meets every year to review the implementa-

tion of the Convention, with the 17th COP held

in Durban in December 2011.

Successive decisions taken by the COP

make up a detailed set of rules for practi-

cal and effective implementation of the

Highlights from COP 17 which was held in Durban in December 2011

LEFT and ABOVE Climate change activists held a mass protest action march in the streets of Durban on 3 December 2011


COP 17 feature

Convention. The COP serves as the meeting

of the Parties to the Kyoto Protocol (CMP),

which also adopts decisions and resolutions

on the implementation of its provision.

Thousands of participants including govern-

ment representatives and observer organisa-

tions have attended previous climate change

conferences.

In 1992, countries joined an international

treaty, the UNFCCC, to cooperatively consider

what they could do to limit average global

temperature increases and the resulting

climate change, and to cope with whatever

impacts were, by then, inevitable. By 1995,

countries realised that emission reduc-

tions provisions in the Convention were

inadequate. They launched negotiations to

strengthen the global response to climate

change, and, two years later, adopted the

Kyoto Protocol. The Kyoto Protocol legally

binds developed countries to emission reduc-

tion targets. The Protocol’s first commitment

period started in 2008 and ends in 2012.

At the start of the conference, South

African President Jacob Zuma pointed to the

climate impacts in Africa as a reason for

all governments to take action. “We have

experienced unusual and severe flooding in

coastal areas in recent times, impacting on

people directly as they lose their homes,

jobs and livelihoods. Given the urgency,

governments need to strive to find solutions

here in Durban. Change and solutions are

always possible, and Durban must take us

many steps forward towards a solution that

saves tomorrow today,” he said.

TOP LEFT United Nations Secretary General, Ban-Ki Moon, with South African Minister of International Relations and Cooperation and COP 17 president, Maite Nkoana-Mashabane

TOP RIGHT On 7 December, members of the global TckTckTck campaign joined 2 000 Durban students in creating the world’s largest human lion on South Beach. Their goal was to urge leaders at COP 17 to have the courage to create a breakthrough agreement that will ensure a safe future for young Africans and people all over the world. The stars of the event were more than 2 000 students from the following Durban primary schools: Addington, Hartley, Wembley, Vumukhule, Embonini, Tholisu and Sawela . TckTckTck board chairman and Greenpeace chief, Kumi Naidoo, attended the gathering and made a short speech, while international aerial artist John Quigley photographed the lion from a helicopter above Addington Beach.

ABOVE Protestors tried to push their way through the COP 17 negotiations. Both local and international law enforcement were deployed during the event

LEFT COP 17 was held at the Durban International Convention Centre from 28 November to 9 December 2011


COP 17 feature

Part X was promulgated on 9 Novem-

ber 2011, from which date building

plans for all new buildings, as well as

plans for extensions of or additions to exist-

ing buildings, must comply.

The stated purpose of Part X is to ensure

that contributions are made towards the

reduction of greenhouse gases. Since build-

ings do not themselves emit greenhouse

gases, the reference is obviously to the

gases which the occupants may cause to be

emitted by the operation of facilities located

within the buildings.

The regulations apply only to those build-

ings which fall within one of the specified

categories of building or building occupancy.

The basic criteria to be adhered to are that:

(a) The buildings must be capable of using

energy efficiently while still fulfilling user

needs in regard to vertical transport

(lifts) thermal comfort (primarily air-con-

ditioning) lighting and hot water.

(b) The buildings must each have a “build-

ing envelope’ and services which facili-

tate the efficient use of energy compat-

ibly with their intended function and

A considerable amount of interest has been generated by the recently published

amendment to the National Building Regulations, which introduces a new Part X dealing

with energy usage in buildings. By Michael Hands*

Building smart to reduce greenhouse emissions

BUILDING GREEN

use, their geographic location and their

internal environment.

Of importance is the fact that the plant

and equipment which are necessary for the

proper functioning of a building have been

excluded from the operation of Part X. By

this, it is presumably meant that the core

functionality of a building should not be

restricted in any way by the imposition of

the new requirements, so that it is only the

building itself and the incidental processes

which are affected.

A ‘building envelope’ is defined as “the

elements of a building that separate a habit-

able room from the exterior of a building, or

garage or storage area”. It is submitted that

this definition seems to frown upon the use

of light and heat reflecting exterior sur faces

and encourages the use of heat absorption

and retention, thus reducing reliance on

artificial heating for thermal comfort.

The regulation also states that its require-

ments may be satisfied by adherence to

SANS 10400 Part XA. This section of SANS

10400 is fairly lengthy and detailed, and

space does not permit a detailed analysis

of its requirements. A brief summary of its

more important aspects is, however, pos-

sible. For further information, the inquisitive

reader is referred to SANS10400 on the

website.

Various forms of apparatus are recom-

mended for installation or use, including

guarded-hot-plate apparatus for steady state

heat flux requirements, heat flow meter

apparatus for steady-state thermal transmis-

sion properties and hot-box apparatus as

a standard test method for thermal perfor-

mance of building materials and envelope

assemblies.

The mechanical per formance criteria of

fenestration products, domestic solar water

heaters, calculation methods for thermal

resistance and thermal transmittance of

building components and elements and

water supply installations for buildings are

canvassed. So too is the installation of

fixed electric storage water heating systems

and various existing regulations dealing

with general principles, walls, lighting and

ventilation.

Construction standardsAlthough most construction industry profes-

sionals will be aware of, and in all prob-

ability observe, best practice in relation

to building orientation, in future this will

assume increased importance and be used

as a tool to determine whether a building

complies with Part XA. SANS 204 is invoked

in this regard. Such varied aspects as roof

assembly construction, under-floor heating

and external walls are also discussed.

Building orientation science in the south-

ern hemisphere encourages the presenta-

tion of the major façade behind which the

primary areas of occupancy occur to the

north in order to take advantage of heat

absorption and retention for those areas


With sustainability being the current buzzword, more and more businesses and individuals are converting buildings to be more energy efficient

Air pollution/CDM

in winter months. By the

same token, less fre-

quently occupied areas,

such as kitchens and

bathrooms, should be

located on the southern

side of the building.

An important require-

ment of the regulation

is that at least 50% (by

volume) of the annual

average hot water heat-

ing requirement has to

be provided by means other than electrical

resistance heating, which includes, but is

not limited to, solar heating, heat pumps,

heat recovery from other systems and the

use of renewable combustible fuel.

A ‘competent person’ (by definition one

who by education, training and experience is

able to make a determination regarding the

performance of a building) must certify the

building’s compliance with the regulations.

Table 2 to SANS 10400-XA:2011 catego-

rises buildings according to ‘climatic zone’

and specifies a maximum energy demand

NEWSLETTERBRINGS YOU ALL THE LATEST NEWSEVENT INFOJOB LISTINGS-FOR FREE

The ReSource weekly newsletter provides an instant summary of the latest news, events and developments in the resources and waste management industry. It is delivered directly to your inbox.

TO SUBSCRIBE [email protected]

TO [email protected]

FOR EDITORIAL [email protected]

THE

MEDIA

for each type,

where sufficient

collected data on

building energy

performance are

available. There

are seven such

categories, exclud-

ing purely resi-

dential buildings,

and they range

from places of

entertainment

and public assembly to hotels.

Approved thermal calculation software is

required to be used to calculate the energy

efficiency of buildings, although what con-

stitutes such software is not immediately

apparent. No doubt the SABS or CSIR will

have more information on this subject.

What the regulations do not appear to

adequately address is the way in which they

will be applied to extensions and additions

to existing buildings. A prime example is

the difficulty in applying the requirement

for 50% hot water heating requirements

through alternative energy sources. If a 60

room hotel is to be extended by the addi-

tion of 20 new rooms, will this mean that

20 of the ‘old’ rooms will have to be linked

to a solar heating system, or possibly even

more if they are to compensate for the lack

of alternative energy sources for use in the

kitchen and the laundry?

The intention behind the regulation is laud-

able and should be supported, but there will

undoubtedly be interpretation difficulties as

the regulation is tested against real world

experience and issues. We should not be

surprised if the regulation undergoes

some fairly extensive surgery over the next

few years.

* ABOUT THE AUTHORMichael Hands is senior attorney and a consultant to Garlicke & Bousfield (Umhlanga, Durban), where he is head of the Planning and Environmental Unit.

The intention behind the regulation is laudable and should be supported


Air pollution/CDM


A petrochemicals group involved in affordable housing made from mining and

manufacturing by-products, as well as an Eco Industrial Park in the hub of the Free

State? Could the world’s largest maker of motor fuels from coal and one of South

Africa’s largest polluters be on the right path to sustainability? Compiled by Candice Landie

‘Green washing’ or a step in the right direction?

SASOL’S SUSTAINABILITY INITIATIVES

According to the country’s 2009 Car-

bon Disclosure Project (CDP) report,

petrochemicals group Sasol topped

the list of South Africa’s largest polluters

(along with Eskom). The group is the world’s

largest maker of motor fuels from coal and

spewed some 70.4 million tonnes of carbon

dioxide (CO2) into the South African atmos-

phere in 2010 alone. Energy and material

sectors remain South Africa’s largest emitting

industries, collectively contributing more than

90% of the country’s emissions as they are

affected by our

country’s heavy

reliance on coal-

fired power plants.

Moves to diversify

the country’s energy

mix away from coal

have been slow,

especially as Eskom

struggles to meet the fast-rising demand in

Africa’s biggest economy, but that is a topic

on its own.

Launched in 2000, the Carbon Disclosure

Project has, on behalf of institutional inves-

tors, challenged the world’s largest com-

panies to measure and report their carbon

emissions. The green issue is at the forefront

of both the corporate and public mind, with

big business having recognised the impor-

tance and commercial expediency of sustain-

able business practices. But sustainability

means more than corporate responsibility – it

is now a bottom line issue that big business

needs to integrate into its strategy.

Media statements issued in mid-2011

stated that Sasol is to build South Africa’s

largest gas power plant in Sasolburg in the

Free State. It is reported that the R1.8 bil-

lion facility, which will produce electricity from

natural gas, will have a capacity of 140MW

and will supply energy to Sasol’s operations.

One of the main reasons that Sasol currently

holds the title of being one of the country’s

largest emitters

is its dependence

on power derived

from the burning of

coal and, accord-

ing to the group,

electricity produced

from natural gas

rather than coal will

result in fewer emissions. In an article on

mediaclubsouthafrica.com, Henri Loubser,

MD of Sasol’s New Energy department, was

quoted as saying: “This project will produce

50% less greenhouse gases compared

to a conventional coal-fired power station

of equivalent capacity.” He says the Gas

Engine Power Plant project should facilitate a

reduction of close to one million tonnes per

annum of CO2 once the complete project is

rolled out. The project also falls in line with

Sasol’s aim to increase the energy efficiency

of its South African utilities by 15% per unit

of production by 2015. Construction of the

plant was due to start in July 2011 and it is

expected to start producing electricity by the

end of 2012.

Green housesThe petrochemicals group is not just invest-

ing in the new gas plant- smaller sustainable

projects are also on the cards. For instance,

First National Bank and Sasol have joined

forces to develop new, affordable housing

made from mining and manufacturing by-

products. Designed and built using technol-

ogy developed by Tower Technologies, the

walls and roof of an 85 m² house takes just

five days to assemble, thereby bringing about

significant savings in both construction costs

and energy use. According to Marius Marais,

CEO of FNB Housing Finance, conventional

building methods are becoming increasingly

expensive and impact directly on the ability

of banks and developers to meet the need

for affordable housing. “Because of this, and

continued increases in labour costs, we have

been compelled to consider alternative tech-

nologies that will enable us to deliver afford-

able quality houses to the emerging middle

class,” he adds.

The first three housing units have been

built in Cosmo City, where market accept-

ance has been very high, and are made

with pre-built panels derived from waste

The project also falls in line with Sasol’s aim to increase

energy efficiency of its utilities by 15% per unit of

production

Air pollution/CDM

As the largest maker of motor fuels from coal, Sasol topped the list of South Africa’s largest polluters along with Eskom. Pictured is the refinery in Secunda


streams – fly ash and gypsum. Fly ash is a

by-product of Sasol’s power production and

gypsum a by-product of industries such as

paper making, fertiliser production, desalina-

tion of acid mine water, etc. Mike Symons,

CEO of Tower Technologies, commented that

the Tower Technologies Building System has

the look and feel of traditional brick and

mortar, with many superior attributes in that

the walls are guaranteed straight, solid and

incombustible. The panels are factory manu-

factured to ensure consistent quality and

render an 80% weight saving to conventional

building methods, which makes it logistically

efficient. The panels are manufactured from

waste streams and therefore ensure a low

carbon footprint and have been fully SABS

tested and Agrément certified. In addition,

this building system ensures a cost saving of

between 10% and 30% to conventional build-

ing systems, depending on locality, and is in

the process of being licensed to prospective

manufacturers, countrywide.

Economic and commercial viabilityWhen asked what the actual cost savings are

in rand terms when comparing the construc-

tion of traditional brick and mortar houses to

fly-ash and gypsum houses, the answer was

very straight-forward: the bondable houses

are 10 to 20% cheaper than conventional

housing, yet still deliver on quality and meet

all building accreditation criteria (SABS,

Agrément and NHBRC). Detailed costings are

compiled in accordance with each interested

investor’s requirements and are dependent

on site location for panel factory manufac-

turing, as well as the application of these

panels according to architectural design.

Dependent on these known inputs, a panel

costing is given. The typical Cosmo saving for

the end consumer was 20%, considering that

the land at Cosmo was pricey.

Similar building technologies have been

around for many years in the alternative mar-

ket but a large number of these are either

too expensive or not socially accepted by

the South African market. To have success

on both these fronts, with a national bank

providing 100% bonds for an alternative tech-

nology, is a great achievement for the project.

With the development of the green economy

and a rise in consciousness in terms of

reducing carbon footprints, there is definitely

a trend toward alternative (and green) build-

ing technologies.

Greener businessesSasol’s enterprise development vehicle,

Sasol ChemCity, together with the execu-

tive mayor of the Metsimaholo Municipality

and other key role-players, launched Phase

I of their Eco Industrial Park in Sasolburg in

October 2011. Situated in the industrial hub

of the Free State, the site will provide a reli-

able supply of utilities, support services and

infrastructure, in order to ensure an environ-

ment that is conducive to successful produc-

tion, logistics and marketing.

One of the primary attributes is the park’s

ability to minimise its carbon footprint with

a long-term strategy to implement carbon

reduction projects. Mechanisms are in place

for entrepreneurs to utilise alternate building

technologies, solar geysers, solar panels and

other eco-friendly tools. By bringing revolution-

ary thinking to the conventional buzz around

industrial parks, the project hopes to promote

a green building philosophy in other regions

in time to come.

Even with these and other green projects

underway, South Africa’s Carbon Chasm

report, compiled by KPMG, illustrates that

there is a gap between business carbon

emissions and South Africa’s commitment to

34% below the business as usual scenario

by 2020. However, many companies in the

South African market have stepped up to the

challenge of voluntarily reducing greenhouse

gas emissions by putting forward substantive

commitments that contribute to meeting the

country’s overall commitment. Although it is

encouraging to see the articulated voluntary

greenhouse gas (GHG) reduction emissions

targets in the private sector, it is only through

a collective effort that climate change can be

seriously addressed.

WASTE ASH is used in a revolutionary process to create a mixture that is foamed and held together by polymeric binder. The entire foamed mixture is encased in a steel frame structure and this comprises a panel that can be used for purpose building applications.

DIAGRAM 1 Technology and production. Sasol’s processes in South Africa

Ash houses: Sasol and FNB’s latest affordable housing development affordable using materials from mining and manufacturing by-products in the construction

Air pollution/CDM

15th annual

BOOK NOW! online www.terrapinn.com/powerafrica | email [email protected] | phone +27 (0)11 516 4060 | fax +27 (0)11 707 9960

Conference: 26 - 29 March 2012 l Exhibition: 27 - 28 March 2012Sandton Convention Centre, Johannesburg, South Africa

A15

501

264

www.terrapinn.com/powerafrica

Diamond partner:

Produced by:

Gold sponsors:

Other sponsors & partners:

Book now and

SAVEwww.terrapinn.com/

powerafrica

Hear from

Augusto de

Sousa Fernando

Board MemberElectricidade de

Mocambique

(EDM), Mozambique

Hon. Elizabeth

Dipuo Peters

Minister of EnergyDepartment of

Energy,

South Africa

Antonio Saide

National Directorateof New & Renewable

EnergiesMinistry of Energy,

Mozambique

Phindile Nzimande

Chief Executive Officer

NERSA,

South Africa

Paulinus Shilamba

Managing DirectorNamPower,

Namibia

Yves Muyange

Director GeneralEWSA,

Rwanda

Benoni Kofi Erskine

Director - EnergyDepartment of

Energy,

Botswana

Kweku A. Awotwi

Chief Executive OfficerVolta River Authority,

Ghana

Absalom

Themba Dlamini

ChairmanRoyal Swaziland

Sugar

Corporation

Henri Loubser

Managing DirectorSasol New Energy,

South Africa


Over and above assessing the direct carbon tax cost in South Africa once the verdict is

published by National Treasury in February 2012, the country must count the indirect

cost of the tax on the competitiveness of its logistics and supply chain sector and the

impact that it will have on consumers and end-users.

Who will pay the price of carbon tax?

LOGISTICS AND SUPPLY CHAIN

South Africa’s consistently high cost

of logistics, which came in at 13.5%

of Gross Domestic Product (GDP) in

2009, according to the 7th Annual State of

Logistics survey, will be negatively impacted

due to the proposed taxation levels. The

proposed carbon tax will, ac-

cording to Marius Swanepoel,

Imperial Logistics CEO, need to

be “counteracted with greener,

more efficient supply chains”.

Dr Jan Havenga, Head:

Centre for Supply Chain

Management at Stellenbosch

University, who projects the

total cost of logistics to be

approximately 15% of GDP

for 2010, comments that

in 2009 the transport and

communication sector paid

around R12 billion in company

taxes. “A carbon tax could

increase the effective tax rate

of the industry by at least

14.5%,” Havenga says. “This

would in all likelihood, make

South African logistics costs

much higher and would mean

that the competitiveness of

the country would be under

further threat.”

When assessed by the indus-

try, calculations indicate that

including the carbon tax, the

total transport industry bill

would increase by between

R1.8 and R6.0 billion per year

for the emission tax of transport only. In

essence, an increase of between 1.16%

and 3.86% on the transport bill is forecast-

ed depending on the final tax implemented.

Sharmini Naidoo, The Road Freight

Association’s CEO, believes that this

increase is a cost the road freight indus-

try can ill-afford. “Transport operators are

already faced with numerous rising costs

and the proposed carbon tax would have

a serious impact on the cost of logistics,

rendering road transport uneconomical,”

she says. Over

80% of freight

is currently

moved by road.

“Ironically it

is the SMMEs

who would be most severely impacted by the

tax – the very sector government aims to

support. Not only this, but the tax will also

impede economic growth and job creation.”

Swanepoel adds, “The industry is mov-

ing forward in greening supply chains

An increase of between 1.16% and 3.86% on the transport bill is forecasted

Air pollution/CDM

through innovative thinking and investment.

Examples include South Africa’s first Euro

5 specification fleets on our roads, cutting

carbon emissions and increasing efficien-

cies through ‘extra distance’ studies and

network redesign, as well as application of

renewable energy sources.”

Governments globally have

tended to introduce carbon

taxation first, followed by

emissions trading as a sec-

ondary means to curb carbon

emissions. He says many

countries including Finland,

the Netherlands and United

Kingdom have tended to

offset the increase in car-

bon taxes with decreases

in other taxes or use of rev-

enue for climate mitigation

programmes.

“In South Africa, there is

currently no middle road

planned. Some, such as cli-

mate change economist and

World Bank advisor, Michael

Toman, view the country’s

serious examination of

carbon tax to be “commend-

able, particularly given that

the step is ‘unique’ among

emerging-market economies.” Others view

the anticipated tax as a fur ther burden to

be borne by business.

Swanepoel concludes: “Even at the lower

R72 per tonne rate, the estimated R100

billion likely to be generated from carbon

tax e quates to between 12% and 13% of

Treasury’s total tax take. This revenue

must be channeled into our country’s pur-

suit for finding sustainable, innovative solu-

tions for cleaner energy that is accessible

to all.”

The 2011 Responsible Care Per for-

mance Report, which was published

toward the end of the year, is the

fifth in a series issued by the Chemical and

Allied Industries Association (CAIA). Every

year, the report is timed to include the

previous year’s per formance in terms of

the implementation of Responsible Care by

the chemical industry and its associates.

One of its main objectives is to increase

transparency on the per formance of the

South African chemical industry.

For 2011, the CAIA presented an extend-

ed report covering additional aspects of

Responsible Care implementation. These

included the three annual workshops held

in Johannesburg and Durban (where most

of its members are situated), the CAIA

new brand promotion, the various working

forums and some examples of member

projects, achievements, activities and pub-

lic signings of Responsible Care.

The good and the bad2011 RESPONSIBLE CARE PERFORMANCE REPORT

“Of great concern is the number of

fatalities and the rising number of

storage incidents. On the positive side,

our members are maintaining levels

of electricity consumption, using less

water and demonstrating a steady

decrease in chemical oxygen demand in

effl uent.” Joaquin Schoch, chairman of the CAIA

Sub headingAt the launch, emphasis was placed on the

responsibility of the chemical industry to

ensure that chemicals are manufactured

and used safely. Introduction of cleaner

and more efficient technologies results in

reductions in the quantities of emissions

and waste generated, as well as the use of

less water and energy.

Progress in meeting this

requirement is reported

for these parameters in

the report.

According to Joaquin

Schoch, chairman of the CAIA, the latest

report reflects both pleasing and disap-

pointing results. While transport incidents

have declined, “of greatest concern is the

number of fatalities and the rising num-

ber of storage incidents,” says Schoch.

“On the positive side, our members are

maintaining levels of electricity consump-

tion, using less water and demonstrating

a steady decrease in chemical oxygen

demand in effluent. Air emissions and

waste generated have now plateaued.”

Karen Marx, 2010 chairperson of the

Voluntary Advisory Forum (VAF), says that

continuous sustainable improvement,

whilst having a positive effect on a com-

pany’s bottom line, is expected from all

stakeholders. “Pollution prevention through

cleaner production technology and evalu-

ating and improving the sustainability of

product supply chains and vendors plays

an increasingly important role,” she con-

tinues. “Business in general and the basic

chemical sector (accounting for about

31% of the chemicals produced in South

Africa) have a significant role to play in

addressing issues like climate change, job

creation, the elimination of pover ty and

product innovation. Chemical companies

are expected to set priorities for environ-

mentally-sustainable production, ensure

energy and water efficiency and improve

production processes by considering the

more efficient use of resources,” Marx reit-

erates. The VAF of

the CAIA provides

a forum that

facilitates dialogue

between various

organisations

and interest groups in the country and

communicates public concerns on health,

safety and environmental issues to the

association.

Product stewardshipThe Global Product Strategy (GPS) of

GRAPH 1 Although the total waste has significantly decreased since 2009, it is important to maintain these levels into the future and continue focusing on reducing hazardous waste generated

GRAPH 2 The Chemical Oxygen Demand (COD) of effluent provides an indication of organic load discharged in liquid effluent into municipal sewers, rivers, dams and oceans. The tonnes of COD per 1000 tonnes of production are shown in this graph

Air emissions and waste generated have now plateaued


Hazardous waste

Sika

Roof

Completely seamlessCold appliedElastomeric and durableRoot resistant waterproofing membraneEasy to repair if puncturedCan be applied in damp conditionsQuick and easy to applyIncreases thermal performance

Advanced waterproofing technology for Africa – Sikalastic MTC®

the International Council of Chemical

Associations addresses the product stew-

ardship components of Responsible Care.

Product stewardship is the chemical indus-

try’s key mechanism for managing the

health, safety and environmental aspects

of chemical products throughout the value

chain and promotes the safe use of chemi-

cals in their manufacturing, use, recycling

and disposal. Product stewardship and its

implementation through GPS are seen as a

key pillar of the Responsible Care initiative.

The key components of the GPS include:

Guidelines for product stewardship,

including ways to make relevant product

stewardship information more accessible.

At the end of 2010, 100 hauliers had been SA SQAS audited, of which 89 attained preferred supplier status (meeting 90% of the criteria) and 11 attained provisional supplier status (meeting 60% of the criteria). Twenty eight hauliers were signatories to Responsible Care

GRAPH 3 This graph depicts emissions of greenhouse gases per tonne of production from 2006

GRAPH 4 Other air emissions arising from chemical production that don’t lead to global warming are depicted in this graph for sulphur dioxide (SO2), carbon monoxide (CO) and nitrogen oxide (NOx)

Hazardous waste



Call 0860 123 341 www.fleetcall.co.za

Can you afford not to be in touch?Get unlimited voice communication on Altech Fleetcall’s national network for less than R399* per month.

*Terms and Conditions apply

Is the cost of communicating getting you down?

A tiered process for completing risk char-

acterisation and management actions for

chemicals in commerce.

Product stewardship performance by down-

stream customers of the chemical industry.

The association has developed a GPS

Implementation Plan, which includes a num-

ber of elements to support product steward-

ship activities and one of the initial respons-

es is the development of

two guidance documents

to assist members in

the implementation of

the Responsible Care

Management Practice

Standards for Product

Stewardship. The guideline documents aim

to assist companies design and implement

product stewardship programmes.

In 2010, the CAIA moved to the Inter-

governmental Panel on Climate Change

(IPPC) Guideline method of calculating the

greenhouse gases resulting from specific

plant processes. This has been undertaken

to prepare companies for the mandatory

reporting which is expected to be intro-

duced by 2014. The association continues

to recognise the achievement of excel-

lence in Responsible Care with the annual

Responsible Care Award. Sasol Solvents,

Secunda, was

the recipient

of the 2011

Responsible

Care Award.

2011 also saw

the introduction

of the Responsible Care Haulier Award, of

which Manline Energy was the recipient.

More than half of CAIA’s signatories

report that they are now operating commu-

nity advisory committees. 94% have estab-

lished a complaints procedure and 98%

have emergency response plans in place.

75% of signatories have also now devel-

oped a waste management programme.

More than half of CAIA’s signatories are now operating community advisory committees

Business in general, and the basic chemical sector, which accounts for about 31% of the chemicals produced in SA, has a significant role to play in addressing issues such as climate change

Hazardous waste

Air pollutionMedical waste

Waste minimisation is more

important than recycling,

in particular with regard

to hazardous waste. The

study below looks at a

waste minimisation plan at

the medical and chemical

engineering schools at the

University of KwaZulu-Natal.

By N Matete* and R Mahomed

Identifying opportunities for hazardous waste minimisation

MEDICAL AND CHEMICAL CASE STUDY

The purpose of this paper is to present

results of a preliminary investiga-

tion into implementing a hazardous

waste minimisation plan at the University of

KwaZulu-Natal (UKZN), using medical and

chemical engineering schools as case stud-

ies. The status quo of the waste system at

both schools was established by interview-

ing relevant university staff. A waste minimi-

sation plan was then proposed based on the

interview results, and waste minimisation

plans in operation at local and international

universities. A survey was then carried out

to assess students’ current waste manage-

ment behaviour and their willingness to

participate in the implementation of the pro-

posed plan. The results

of the survey showed

that at least 72% of the

students understood

that waste minimisation

was more important

than recycling. Also,

more than 90% of the students were willing

to participate in the implementation of

the proposed waste minimisation plan if

more information on waste minimisation

was provided.

IntroductionAt the moment, UKZN does not have a

waste minimisation plan for any of the three

main waste categories: hazardous, general

and inert. Hazardous waste means “any

waste that contains organic or inorganic

elements or compounds that may, owing

to inherent physical, chemical or toxicologi-

cal characteristics of that waste, have a

detrimental impact on health and the envi-

ronment” (Republic of South Africa, 2008).

Due to the nature of hazardous waste, it

“cannot be released into the environment

or be added to sewage or be stored in a

situation which is either open to air or from

which aqueous leachate could emanate”

(Department of

Environmental

Affairs and Tourism,

2008). This preced-

ing point under-

scores the need

for reduction of the

amount of hazardous waste that is gener-

ated at UKZN, hence the purpose of this

preliminary investigation.

Waste minimisation, on the other hand, is

defined as “any activity that is undertaken

by the generator of waste to prevent or

reduce the volume and/or environmental

impact of waste that is generated, treated,

stored or disposed of” (Department of

Environmental Affairs and Tourism, 2000).

This definition has now been incorpo-

rated into the National Environmental

Management: Waste Act, 2008 (Act 59

of 2008) albeit in a slightly revised form

(Republic of South Africa, 2008). In terms

of the waste minimisation scheme, the main

goal will be to reduce the volume of the

waste generated and also reduce its envi-

ronmental impact or toxicity. Due to the fact

that hazardous waste has many streams,

the waste minimisation scheme will focus

on chemical and bio-hazardous waste. The

scheme is based primarily on schemes that

are in operation at international universities

such as the University of Miami and the

University of California – Santa Barbara, and

locally, the University of Stellenbosch.

Methodology The objectives of the preliminary investiga-

tion were three-fold: to determine the sta-

tus-quo for hazardous waste management

at UKZN using case study schools; develop

a plan and identify the opportunities for

waste minimisation, and to assess the will-

ingness of students to engage in hazardous

waste minimisation. This section outlines

the process that was followed in carrying

out the investigation.

In order to establish the status quo of haz-

ardous waste management practice at the

chemical engineering and medical schools,

UKZN does not have a waste minimisation plan for any of the three waste categories



Medical waste

staff members responsible for hazardous

waste management were interviewed. The

main information requested was the types

of waste generated, the volumes/amounts

for each stream, and how each stream was

being managed – classification and storage

of the generated waste and ultimately, the

disposal of the waste. A literature review

was conducted on the waste minimisation

schemes operational in other universities.

The outcomes of the interviews were then

compared with the outcome of the literature

review, from which a waste minimisation

plan for the case study schools was then

proposed.

Following the proposal of a waste minimi-

sation plan, a survey was conducted at both

schools to determine the basic understand-

ing of students with regard to hazardous

waste management and also to determine

the willingness of the students to partici-

pate in and to promote the waste minimi-

sation scheme. Since not all the students

could be surveyed, a representative sample

was determined for each school using sta-

tistical methods. The sample size for each

school was determined using Equation 1 as

a basis. However, the actual sample size

was calculated using readily available sam-

ple size calculators on the internet (Survey

Systems, 2009); which take into account

the population size of each school. A self-

administered questionnaire was applied in

both areas using con-

venience sampling given

the fact that this was a

preliminary investigation.

The results were then

analysed using Microsoft

Excel. The results from

the staff interviews and

the student survey were

then used to gauge

whether there was suf-

ficient scope and oppor-

tunities for the implementation of separate

hazardous waste minimisation schemes in

both schools. These results are presented

in the next section.

ResultsStatus quo

In the medical school, the interviews yielded

the following results:

Purchasing of chemicals is done by the

user who has to follow a procedure set up

by the Procurement Department: Users

can only purchase the chemicals once

approval has been given by the Procurement

Department. This process eliminates the

scenario of users just randomly purchas-

ing chemicals, and allows the Procurement

Department to keep track of the chemicals

purchased and to manage funds for this

process appropriately.

Storage facilities for the waste are based

on safety aspects that take into considera-

tion the incompatibility of certain chemicals.

For example, separate storage facilities are

provided for chlorinated and non-chlorinated

waste. The onus is on the waste producer

to decant their waste into appropriate

drums.

Hazardous waste is separated into

chemical and bio-hazardous streams.

The chemical waste is then separated

into chlorinated and

non-chlorinated waste.

Bio-hazardous waste

is separated into solid

waste, sharps, human

tissue and pharmaceuti-

cals. Both major streams

of waste are collected

as the need arises and

disposed of by specialist

contractors using appro-

priate disposal methods

for each waste stream.

The only problem with the present system

is that the volumes or quantities of waste

generated are not measured and recorded,

or where the information is available, it is

considered confidential. As a result, it is not

clear how much waste is being generated

and how much is being disposed of.

In the chemical engineering school, the

LCA yielded the following results:

Purchasing of chemicals is done by the

school and most of the chemicals are

brought from or through the same company.

A similar purchasing procedure to the one in

medical school is followed.

Similar to medical school, separate stor-

age facilities are provided, but this time for

solvents and dry chemicals. Also, acids and

bases are stored in the same room as the

solvents, but in a clearly segregated section

of the store room. It is important to note

that a completely separate storage room for

acids and bases is being constructed at the

moment.

The generated waste is separated into

chlorinated and non-chlorinated solvents

and various redundant chemicals. After

classification, the storage drums are clearly

marked, but the onus still remains on the

waste generator to dispose of their waste

in the appropriate drum. Collection and dis-

posal of the waste is done by an appointed

contractor, with collection taking place when

the need arises and disposal taking place

at an appropriate disposal facility. Similar to

medical school, there is no record keeping

for the volumes/quantities of waste pro-

duced and disposed of.

Waste minimisation planThe waste minimisation plan is based on

international best practices and involves

three main steps:

• the classification of the generated waste

• the reduction of the volume of waste

generated

• the reduction in the toxicity of the

ISSUE SCHOOLRESPONSE (%)

RECYCLE RE-USE UNSURE

What approach is the best way to reduce the amount of hazardous waste produced?

Medical 22 2 76

Chemical 26 2 72

Is it safe to discard chemicals down the drain?

Medical 1 99

Chemical 4 96

Were you taught about the impacts of waste in 1st year?

Medical 86 14

Chemical 63 37

DAILY WEEKLY MONTHLY

How often do you produce hazardous waste in lab sessions?

Medical 27 52 21

Chemical 38 43 19

34 T63 #$34

2

2 )1(e

ppzn

where: n = sample size p = value used to represent the

population proportione = desired margin of errorz = critical value from the

standard normal table

generated waste.

Classification will be carried out using the

present method of identifying character-

istics as set out in SANS 10228. Source

reduction will utilise an effective purchasing

strategy, where chemicals are procured for

specific purposes rather than buying in bulk

for an extended period. When the chemicals

are being used, good house keeping meth-

ods will be adopted to reduce the volume of

waste generated. For example, hazardous

and non-hazardous waste will be kept sepa-

rate so that there is no contamination of

non-hazardous waste, which would increase

the volume of hazardous waste needing

disposal. Recycling of the waste could take

place through re-distillation of solvents,

where possible, and chemical exchange pro-

grammes for generated waste. The latter is

already happening in industry; hence it can

be scaled down to fit a university setting.

For reducing toxicity of the waste, chemical

substitution should be utilised.

Chemical substitution is a strategy where

current chemicals used in projects and

practicals are replaced with less toxic ones.

For example, Acetamide can be substituted

with Stearic acid for freezing point depres-

sion or Formaldehyde can be substituted

with Ethanol for specimen storage (Florida

Atlantic University, 2002). The success of

such a plan depends on the corporation and

participation of staff and students respec-

tively. The next section will focus on the

results of the survey to determine the basic

understanding of students with regard to

hazardous waste management and their will-

ingness to participate in the proposed plan.

Student surveyUsing Equation 1 and population sizes of

1 500 for the medical school and 386 for

chemical engineering, the sample sizes

were calculated as 173 and 130 students

respectively. For both schools, p = 0.5,

which maximised the sample size and a 7%

margin of error at 95% level of confidence

were used. Due to the timing of the survey,

final year students in both schools were not

interviewed, so the results are representa-

tive of lower levels of the undergraduate

programme students in both schools.

The results for the survey in medical

school and chemical engineering are shown

in Tables 1 and 2. Table 1 shows the stu-

dents’ current understanding of hazardous

waste management, while Table 2 shows

the willingness of students to participate in

the implementation of the proposed waste

minimisation plan.

From Table 1, it can

be seen that students

in the medical and

chemical engineering

schools understand

the basic application

of the waste hierarchy

albeit without under-

standing that reuse is

higher priority waste

minimisation goal com-

pared with recycling.

The students also

have basic understanding that unsafe dis-

posal of hazardous waste can have a nega-

tive impact on the environment as shown

by their response to the issue of discarding

waste down the drain. However, such under-

standing is probably intuitive rather than a

result of the first year

laboratory induction pro-

grammes as indicated

by the marked difference

in responses between

the medical (86%) and

chemical engineering

schools (63%). Finally, it is clear that haz-

ardous waste is being generated regularly

in both schools, with at least 79% of the

students indicating that they generate waste

weekly.

It can be seen from Table 2 that at least

69% of the students are not sure whether

waste minimisation is being implemented

at UKZN. Despite this uncertainty, most of

the students in the medical school (91%)

and the chemical engineering school (79%)

are willing to participate in waste minimisa-

tion. The lower waste minimisation willing-

ness rate for chemical engineering could be

attributed to the fact that fewer students in

the school, compared with medical school,

were taught about the impacts of hazardous

waste in their first year of study as shown

in Table 1. This difference in knowledge may

not be critical given the fact that more than

90% of students in both schools still require

more information about waste minimisation

before they can participate in it.

Discussion and conclusionIn this section, the information presented

in the results section will be evaluated

with the aim of

categorising it as

an opportunity or

challenge for imple-

menting hazardous

waste minimisation

at the two schools.

The evaluation will focus on the current

hazardous waste management system in

terms of the processes being used and the

perceptions of the primary waste generators

– the students. Conclusions will then be

drawn on the research based on the evalua-

tion process.

The fact that protocols are followed in the

purchasing of chemicals in both schools

presents an opportunity for waste mini-

misation as the process allows tracking

of the types of chemicals that have been

purchased by the schools. This information

is important in that chemical substitution

can then be implemented where feasible

and thus reduce the toxicity of the waste

generated. However, chemical substitution

can only take place when both the types of

chemicals and their quantities are known.

The latter presents a challenge given that

ISSUE SCHOOLRESPONSE (%)

YES NO UNSURE

Waste minimisation currently implemented at UKZN?

Medical 24 1 75

Chemical 29 2 69

Willing to participate in hazardous waste minimisation?

Medical 91 9

Chemical 79 21

Do you need more info about waste minimisation before participating?

Medical 98 2

Chemical 92 8

79% of students indicate that they generate waste weekly



SUBSCRIBER CONTACT DETAILLS

Surname: __________________________________________________________

Name: ____________________________________________________________

_Designation:_______________________________________________________

Company:_________________________________________________________

Type of business:___________________________________________________

Address:___________________________________________________________

________________________________________________Code:______________

Tel:_________________________________ Fax:___________________________

Cell:_______________________________________________________________

E-mail:_____________________________________________________________

Subscriber VAT Reg. No:____________________________________________

media.co.za ISSN 1680-4902 R35.00 (incl VAT)

just got a facelift

Vol 13, No 2, Mayy 2011

RisRisinging coc ncernsrns veversurs s ecoecoeeeeeeeee nomic groowthwth

TheThe ef effecfects ts of of poopoor or operperatiation on andand ma managnagemeementnt

N t j t th i tNot just the environment – people matter too!Not just the environment – people matter too!

yy eeAA servAA servvice deice dece dece dedeliveryliveryeryliveryliverylivery iissueissuessuessue

S lSolarSolar Solar Solar SolarSolaSolaa power power power powererer er poweo er erer reereversusversusversusversuve coal bcoal-bcoalcoal-bcoal-bboal bcoal-bcoal-bcoal-bcoal-boal-bcoal-bacoacoal-bal-bal- aaasseasedased aelecelectrelectrelectrlectricityicityityiicity

wwww.3smedia.co.zco.za IISSN 1680-4902 R35.00 (incl VATAT)The official journal of the Institute ofWaste Management of Southern Africa

Vol 13, No 3, August 2011

wwwwww.3sm

Solid t ll ti nn jujuj s

SARand195*

SADCUS$40*

Int.US$60*

SUBSCRIPTIONS:

*

MEDIA

ReSource

PAYMENT OPTIONS EFT Deposit: Banking details

Nedbank

Acc. type: current

Mastercard Visa

Expiry date:_______ / _______

Credit Card Number

Signature:_____________________________

Date:_________________________________

Fax or e-mail proof of payment to activate your subscription. Your magazine will be mailed to you.

ORDINARYFURNACESCANBETRANSFORMED INTOENVIRONMENTALLYFRIENDLY, FUEL-EFFICIENTASSETS...HOWDEN KNOW-HOW

©Howden Africa Ltd. All rights reserved. 2009

Howden Africa1A Booysens Road, Booysens 2091 Johannesburg, South AfricaTel: +27 11 240 - 4090 Fax: +27 11 493 - 3861Email: [email protected]

Howden’s track record includes: Incineratorswith emission controlto international standards•Calcining ovens for automotive catalysts• Industrial furnaces• Process air heaters •Heavy duty ovens formould drying•Retrofits of furnaces and ovens.

Our customer-focused approach provides a comprehensive servicefrom initial proposal to long-term support. Howdenmakes furnaceand incinerator ownership and operation a viable investment.

Howden can convert furnaces and driers to give decades ofenvironmentally-friendly, efficient operation. Drawing on a vastreservoir of engineering experience, and considerable expertisein flue gas conditioning technology, EC&I and SCADA, we offerseamless design and development of turnkey systems.

Find out more:

howden.co.za

the purchasing department does not keep

track of the quantities of chemicals pur-

chased since order forms and disposal

forms are not kept for long – there is no

database or file where the forms are kept.

This challenge will need to be overcome if

implementation of the waste minimisation

plan is to become a reality. A possible solu-

tion would be to set up a database, housing

information on the amount of hazardous

waste that is generated and then analysing

the effectiveness of waste minimisation

measures in reducing waste quantities

needing disposal. Setting up the database

is a challenge because of the inefficient way

of keeping records that could be used for

comparison.

The separated storage of waste also pre-

sents an opportunity for waste minimisation

since segregation of waste reduces the risk

of hazardous waste contaminating general

waste. Also, segregation of the hazardous

waste itself is an opportunity for waste mini-

misation, given that the separated waste

could be used in a chemical exchange

programme with other schools. The lack of

waste data, however, is a challenge, since

quantities of generated waste will need to

be known in order to make the chemical

exchange programme feasible. This point

underscores the need for a waste database

in both schools.

Another opportunity for waste minimisa-

tion is presented by the willingness of the

students to implement the waste minimisa-

tion plan. This result is very important given

that the students are the primary genera-

tors of waste and are therefore responsible

for disposing it in the correct receptacles.

With the students practising source sepa-

ration, the benefits mentioned previously

will be realised. However, if the students

were not willing to separate their waste at

source, the benefits of reduced contamina-

tion and possibility of engaging in chemi-

cal exchange programmes would not take

place. Thus it is imperative that the stu-

dents are provided with the information that

they require in order for them to participate

in waste minimisation activities.

In conclusion, the research presented

in this paper has shown that there are

opportunities for implementing hazardous

waste minimisation at the medical and

chemical engineering schools at UKZN.

The proposed waste minimisation plan

is based on international best practice

and incorporates waste reduction and

recycling along with reduction in toxicity of

the generated waste. It has been shown

that present waste management methods

employed in both schools could be trans-

formed waste minimisation schemes. But

more importantly, the primary generators

of waste, who are the students, are willing

to par ticipate in waste minimisation if they

are provided with information that shows

them how.

* ABOUT THE AUTHORS*University of KwaZulu-Natal, Civil Engineering Programme, School of Civil Engineering, Surveying and Construction, Durban, KwaZulu-Natal, South Africa




Revolutionary chemical-free toxic water treatment system

CRYSTALLISATION TECHNOLOGY


Water scarcity (hydric stress) is an

imminent global challenge. The

demand for desalination technolo-

gies is increasing steadily. It is estimated

that half of all installed desalination capacity

worldwide is treated by reverse osmosis. The

waste brine streams from the application of

membrane technologies are classified as

industrial wastewater.

The hazardous streams, as a result of

reverse osmosis, are environmental threats

in the making as they are predominantly

being fed into evaporation ponds. The cur-

rent treatment processes are energy inten-

sive and extremely costly to operate. Simply

dumping or hiding theses brine streams is

no solution.

In a world first, a cost-effective, compre-

hensive solution for treating toxic wastewater

regardless of its chemical composition,

was launched at the Tshwane University for

Technology’s (TUT) Soshanguve campus

in November 2011. The HybridICE Freeze

Crystallisation technology is a sustainable

and cost effective method for treating haz-

ardous brine streams resulting from the

application of reverse osmosis. With the

The critical issue of how to deal effectively with the brine

streams resulting from the use of reverse osmosis as the

current methods are environmentally unacceptable.

HybridICE technology, the cost of treatment

can be reduced by up to ten-fold of the cost

of any other treatment method currently

available. This chemical-free water treatment

technology developed by Frederick Simon

Oosthuizen, is the only known comprehen-

sive solution for treating complex wastewa-

ters regardless of their chemical composi-

tion, which may include harmful endocrine

disruptors. “In developing the HybridICE, we

have successfully pio-

neered a unique method

to freeze out clean ice

crystals. In return, the

manipulation of the ice

crystal enables us to

recover pure water as a

usable product from any toxic brine stream,”

says Oosthuizen, who developed the technol-

ogy in collaboration with Professor Jannie

Maree, chairperson of the Rand Water Chair

of Water Utilisation at TUT.

The secret is in the freezeThe development of this technology started

in Germany in 2007 and is said to revolu-

tionise the water treatment industry through

the method of using refrigeration energy to

freeze out the water in a solution with dis-

solved chemicals. In this way, the waste

heat from the refrigeration process is used

to recover the contaminants as solids.

HybridICE is the first operational freeze crys-

tallisation plant ever realised in which the

water is completely separated from the toxic

waste as solid ice.

The first objective for the development

team was to deal with polluted and toxic

brine streams mainly produced by mem-

brane technologies, typically from reverse

osmosis and other industrial wastewaters,

through freeze desalination. This technology

enabled them to create water of the purest

quality, equivalent to glacier water quality.

But according to Oosthuizen, treating water

is not an art; dealing with the pollution cre-

ated as a result of water treatment is the

real engineering challenge. This has not yet

been achieved.

BackgroundOosthuizen met with Professor Maree

towards the end of 2008. “His activities

and engagement with the project contributed

positively towards the building of the first

commercialised 25 m³/day HybridICE Freeze

Crystallisation plant, which was installed

at TUT’s Soshanguve campus,” Oosthuizen

continues. According to the developer,

experts around the world have been work-

ing tirelessly for more than half a century

to understand and

realise such a tech-

nology, but without

success. “Until very

recently, this method

was not even

regarded as viable,”

Oosthuizen adds.

He explained why the technology is so

unique and cost-effective: “In principle, this

technology is a method of using refrigeration

energy to freeze out the water in a solution

containing dissolved chemicals. The water

component is frozen out from a contaminat-

ed aqueous stream that contains dissolved

chemicals and is recovered as pure ice. This

treatment process requires no addition of

Manipulation of the ice enables us to recover pure water


chemicals.” When a water solution freezes,

the ice crystals reject the solute. The dis-

solved substances increase in concentration,

allowing an operating factor ranging from 1

to 40 in the remaining water.

Commercial viabilityAccording to Oosthuizen, the commercial

applications of the HybridICE are unlimited

and will create thousands of job opportuni-

ties in South Africa. “I am committed to mak-

ing this an all-South African project in order

to benefit as many people as possible in our

communities. In 2012, we will start to build

a novel water-treatment technology system

for desalination and the treatment of acid

mine drainage. We aim to treat any industrial

wastewater at a cost of less than R7 per

m³, Oosthuizen says. “We will then apply our

already developed technology to deal with

the brine stream that is produced, making

this a truly comprehensive method for treat-

ing toxic waters.”

Interestingly, the team has already

achieved treatment cost of merely

R15 per m³ for industrial wastewater and

brine stream treatment, which is a factor 10

times cheaper than any other known method.

TUT’s role“Water scarcity is an imminent global chal-

lenge and TUT certainly has the expertise

to play a vital role in developing more cost-

effective, sustainable technical solutions to

solve this problem in South Africa,” says Dr

Prins Nevhutalu, TUT Deputy Vice-Chancellor

of Research and Innovation. Dr Nevhutalu

says TUT is one of the pioneers in water

treatment in the country, with a Water Care

course that was introduced as far back as

1996, adding that the university is proud

of its strengths and expertise in water

technology.

“Apart from the development of brine treat-

ment through the HybridICE technology, TUT

has also been involved in developing other

innovative solutions and patents for water

treatment. The limestone neutralisation of

free acid, a CSIR patent, has already been

fully implemented, while a TUT patent for the

removal of iron (II) with limestone is expect-

ed to reduce alkali cost in Gauteng from R94

to R49 million per year,” Dr Nevhutalu adds.

Professor Pieter Marais, Dean of the

Faculty of Science, says this project

represents the pinnacle of what a university

of technology should do. “We must find

effective, sustainable solutions to real-

world problems. With the steadily increasing

demand for desalination technologies, it is

estimated that half of all installed desalina-

tion capacity world-wide is treated by reverse

osmosis. The waste brine streams from

the application of membrane technologies

are classified as industrial wastewater. A

critical issue is how to deal effectively with

the brine streams resulting from the use of

reverse osmosis, as the current methods

are environmentally unacceptable. These

hazardous streams are environmental

threats in the making as they are predomi-

nantly being fed into evaporation ponds. The

current treatment processes are energy-

intensive and extremely costly to operate.

Simply dumping or hiding the brine streams

is no solution.”

BELOW Professor Jannie Maree (right) during his demonstration of the HybridICE Technology systemBELOW RIGHT Frederick Oosthuizen (right) checks the ice which is produced by the HybridICE Technology. In principle, it is the method of utilising refrigeration energy to freeze out the water in a solution with dissolved chemicals

HybridICE: the revolutionary chemical-free toxic water treatment system



Traditionally Anaerobic Digestion was

included as part of the overall waste-

water treatment process to reduce

total the organic load on the WasteWater

Treatment Plants (WWTP). Until now, the

biogas produced by the WWTW plants has

been used to fire boilers, which maintain

the temperature in the digesters. But due

to the escalation in the price of electricity, it

WWTW upgrade to lower carbon emissions

CHP PLANTS

Two biogas scrubbing and cogeneration – combined heat and power

(CHP) plants are scheduled for the Northern Wastewater Treatment

Works (NWWTW) and the Driefontein Wastewater Treatment Works.

now makes financial sense for the WWTW to

utilise the energy rich gas for onsite power

generation with heat recovery.

At an estimated cost of R76 787 001,

the design work started in September

2011 with the civil work on the first phase

of the project, NWWTW, scheduled to start

in February 2012. The first phase of the

NWWTW project is expected to be commis-

sioned by July 2012 and work on Driefontein

will commence. The project will generate

power and recover the heat from the gas

fired generators on site to run grid parallel

and supply the thermal energy required to

the digesters in order to maintain tempera-

tures. The plant will have the ability to supply

power to portions of the WWTP when the

utility supply falls away. The power plants will

be built adjacent to the digesters in order

to maximise thermal recovery, and will sup-

ply about 20% of the NWWTW’s power. As

Johannesburg Water invests in additional

digester capacity, the WWTP’s load on the

grid will be reduced accordingly. The most

environmental benefit of the project is the

reduced electrical demand on Eskom thereby

lowering carbon emissions. Thus far, no set-

backs have been identified.

ABOVE The site as it currently standsBELOW Computer-generated image of the Northern WWTW gas conditioning plant BELOW RIGHT SFGLD 240 with heat recovery will be installed at both project sites



Plant & equipment

Raising the bar on waste collectionMERCEDES-BENZ

The waste industry has been slow to react to market needs and hence new

developments in technology to facilitate the effi cient and economical removal of waste

have been ignored in some quarters. Some companies however, have risen to the

challenge and have gone the whole nine yards to ensure that they are equipped to meet

needs of expanding urban development.

The principle of waste management

is the collection, transporting and

processing or disposal of waste mate-

rial, a practice usually associated with human

activity and undertaken to reduce effects on

health in the environment in which we live.

Waste collection methods

vary greatly among differ-

ent countries and regions.

Domestic waste collection

services are often provided by

local government departments

or by private companies in the

industry.

Blue Anvil Bulk Logistics,

a Tshwane based company,

has since 2003 developed

its business around providing

the most up to date service in

waste removal. At the recent

handover of the first two of

a total of 14 Mercedes-Benz

Axor 3535 waste compac-

tors, company CEO Sandow

Rossouw, said, “I have been

associated with waste remov-

al transport since 1992 and

have built my business reputa-

tion on using the best com-

bination of equipment for the

job.” “The addition of these

new Axor 3535 fitted with the McNeilus 26

cu m compactor body is a continuation of

the tradition of using the Mercedes-Benz

product since 1997

which started with the

2624 Powerliner,” added

Rossouw.

Ideally suitedThe new Axor 3535 8X4

is ideally suited for this

medium-distance haulage and heavy duty

short distance distribution. Powered by the

well proven OM457LA six cylinder diesel

engine with an output of 260 Kw @ 1900

rpm and torque of 1850 Nm @ 1100 rpm,

the Axor 3535 provides a powerful, durable

and economical vehicle for the task. The

9-speed direct drive transmission enhances

the value of the vehicle for this applica-

tion as it allows effortless gear changes

and, thanks to the deep crawler gear and

reverse gear ratio, enables precise low-speed

manoeuvring

especially in the

confined urban

environment.

The whole

essence of the

Axor design has

been in weight

reduction wherever possible to achieve a

balance between robust design and high

payload. This enables the vehicle to endure

the rigours of the waste industry and thrive

under the most gruelling conditions to which

any vehicle can be subjected.

The McNeilus Extra Heavy Duty 26 cu

m compactor makes this combination the

‘Monster Crusher’ of the vehicle waste

industry due to its high compaction force.

According to Rossouw, this higher than aver-

age compaction capabilities of the McNeilus

enables the company to achieve a 50%

increase in the volume of waste per trip of

each vehicle. “This makes economic sense,

especially if the landfill site is far away and

we can reduce the number of trips per day,

explained Rossouw.

The Axor 3535 8X4 is suited for this medium-distance haulage

Blue Anvil Bulk Logistics have developed their business around providing the most up to date service in waste removal and rely on Mercedes-Benz trucks to get the job done


The pilot of asphalt recycling PILOT CRUSHTEC

More Asphalt has bought a Terex Finlay 683 mobile screen to extract even greater value

from its tar recycling operation.

The Cape Town-based asphalt producer

uses a Pilot Crushtec RubbleBuster

SR500 impact crusher to recycle

asphalt waste, as well as the waste product

generated in its production

process, into reusable raw

material. “By introducing

a screen into its process,

the asphalt producer has

gained increased efficien-

cies as it now has the

ability to produce a 15 mm product, which is

then blended back into the production cycle,”

says Pilot Crushtec director of sales, Graham

Kleinhans, adding that the Terex Finlay’s sec-

ondary function is to screen sand out of the

plant. According to plant manager, Franscois

Ruiters, reject asphalt is produced when the

plant starts

up or is shut

down, and

the use of

recycling

techniques

is generating

significant savings, not only in terms of raw

material costs, but in operational efficien-

cies. “Apart from the benefit of a greater

utilisation of our raw materials, recycling

means that we no longer have to carry the

cost of transporting and disposing of waste,”

says Ruiters. “What we are doing here is

normal practice in countries like Australia

and America, where asphalt waste is often

referred to as ‘black gold’.”

He adds that globally there is growing pres-

sure for the conservation of essential raw

materials and that it is only a matter of time

before local legislation to enforce a recycled

content of waste into asphalt production

comes into play. “Our RubbleBuster, which

we have operated for over three years, and

the new screen work well together and pro-

duce up to 60 tonnes of recycled product

per hour. We are only able to re-introduce

product at our main plant and the product is

currently re-introduced (blended back into the

product cycle) at 7% of our total output.”

The RubbleBuster produces up to 60 tonnes of recycled product per hour

More Asphalt has introduced a Terex Finlay 683 mobile screen which adds value to its tar recycling operation

Plant & equipment

INDEX TO ADVERTISERS

IWMSA news

Make your voice heard at WasteCon 2012

URGENT CALL FOR PAPERS

The Institute of Waste Management

of Southern Africa (IWMSA) is urging

all interested and suitably qualified

parties not to delay in submitting papers

for consideration in respect of original

content for this year’s WasteCon, sched-

uled to take place in East London from

08 – 12 October 2012.

WasteCon, which is held bi-annually under

the auspices of the IWMSA, focuses on criti-

cal issues faced by those involved in waste

management in South Africa. This year’s

conference is titled

‘Wrestling with

Waste, Employment,

Environment and

Engineering’. Steve

Kalule, WasteCon

2012 Chairman

says, “The word

‘Wrestling’ was

identified as

a key factor in describing the feel-

ing of difficulty and the challenges

experienced when managing waste

and related issues. This is

especially pronounced in

situations, municipalities

and communities with

limited resources.”

Kalule continues, “The

conference aims to

address the difficulties faced by the Eastern

Cape as one of the poorest regions in South

Africa, both in resources and knowledge,

and how municipalities and communities are

experimenting and succeeding in develop-

ing partnerships to create jobs and to use

waste as a resource: in other words to view

waste other than as a problem, but rather as

a potential resource.”

The WasteCon 2012 organising com-

mittee is hard at work to ensure that this

waste conference meets and exceeds all

expectations,

and whilst still

in the early

organisation

stages, the

committee is

now calling for

the submission

of abstracts for

original contri-

bution to the conference. All

submissions will go through

a peer-review process carried

out by a local review panel,

and each abstract will

appear in full form

in the abstract book

which will be handed

out at the conference.

Oral papers or posters

should be aligned to the theme ‘Wrestling

with Waste’, and encompassing the

three ‘E’s’, Employment, Environment

and Engineering, which include, but is

not exclusive to topics such as: waste

to wages, job creation, societal benefits,

recycling and reuse, the New Waste Act,

licensing, groundwater monitoring, land-

fills, waste transfer stations and disposal.

Abstracts must reach the conference sec-

retariat by 01 February 2012 through the

online abstract submission portal on the

WasteCon 2012 website. Those wishing

to submit abstracts can find full details

regarding WasteCon 2012, submissions

and themes at www.wastecon.co.za.

The IWMSA focuses on providing edu-

cation and training for its members,

facilitating interest groups who network

and exchange information with like-minded

individuals, as well as offering a forum to

assist in having voices heard in the formu-

lation of legislation.

The IWMSA is a non-profit organisation

comprising a body of dedicated profession-

als in their respective fields, who give freely

and voluntarily of their time and expertise

in order to effectively educate, promote

and further the science and practice of

waste management.

For more information, visit: www.iwmsa.

co.za

ribing the feel-

the challenges

managing waste

This is

ed in

lities

th

The

bution

submis

a peer-r

out by

w

o

O

“The committee is hard at work to ensure that the conference meets all expectations”Steve Kalule, Chairman, WasteCon 2012


African Utility Week 26

Afrisam 32

Amandus Kahl 19

Aquatan 29

Barloworld Equipment 15, 36

Duncanmec 20

EnviroServ Waste Management IFC

Envitech Solutions 25

Fleetcall 48

Gast International 30

Howden 53

Jan Palm Consulting Engineers 21

Kaytech 22

Landfill Equipment 28

Mills & Otten 37

Mpact Plastic Containers 2

MTM Bodies OBC

OMB Waste Logistics OFC

Otto Waste Systems 12

Pikitup Johannesburg 10

Pilot Crushtec 58

Plastic Federation of SA

Power Gen Africa 24

Power and Electricity

World Africa 2012 44

PTN Parts and Equipment 13

Rose Foundation 4

Sika 47

The Waste Group OBC

Worley Parsons 27

Resource February 2012

Documents

Transcript of Resource February 2012