(CANCER RESEARCH 48. 4578-4583, August 15. 1988]

Resistance of HeLa Cell Mitochondrial DNA to Mutagenesis by ChemicalCarcinogens1

Shiro Mita,2 Raymond J. Monnat, Jr., and Lawrence A. Loeb3

The Joseph Gottstein Memorial Cancer Research Laboratory, Department of Pathology SM-30, University of Washington, Seattle, Washington 98195

ABSTRACTThe mutagenic potentials of ethylmethane sulfonate, .V-nu-tliyl-.V'-

nitrosoguanidine, and benzo(a)pyrene diol-epoxide in human mitochondria were determined by cloning and nucleotide sequencing of mitochondria! (mt) DNA from HeLa cells treated with these mutagens. Mutagenconcentrations that reduced cell survival to approximately 0.1% of untreated cultures were used. Mitochondria! DNA was prepared 2 to 3weeks after mutagen treatment, at which time the treated cell populationhad regrown to 10 times the starting cell number. In one series ofexperiments, a portion of the D-loop region of mtDNA from treated orcontrol HeLa cells was cloned into the bacteriophage vector M13mpl9,and the nucleotide sequences of 102 independent clones were determined.Only a single G:C base pair deletion was observed in 1 of 12 clonesderived from HeLa cells treated 6 times with ethylmethane sulfonate.From benzo(a)pyrene diol-epoxide-treated HeLa cells, G:C base pairdeletions were found in 14 of 63 clones. All 14 of these G:C deletionmutations occurred at the same position in independent clones, however,and thus could be the progeny of a single mutational event. In a secondseries of experiments, a method for the selection of mtDNA mutants wasutilized. Mutations in an **uncloneable" fragment of human mtDNA

render the fragment cloneable and thus provide a selection for mutationsin this region of human mtDNA. No enhancement in the cloning efficiencyof this region of mtDNA was observed after exposure of cells to toxicconcentrations of either MNNG or benzo(a)pyrene diol-epoxide. Moreover, the site and types of nucleotide sequence alterations observed aftermutagen treatment were similar to those obtained in the absence of drugtreatment. The results of both types of experiments suggest that inula-genesis of human mtDNA is an infrequent event, even after extensivetreatment of HeLa cells with potent mutagens that can covalently modifymtDNA.

INTRODUCTION

It is important to know the types of mutations produced inhuman somatic cells by environmental mutagens and carcinogens, because these mutations may play an important role inthe genesis of many human neoplasms (1). In prokaryotes, thefrequency and spectrum (i.e., the type and site of occurrence)of mutations in specific genes have been extensively investigated. These data have provided clues to the mechanism bywhich alterations in cellular DNA result in mutagenesis (2, 3).Similar studies in human cells have been limited by the complexity of the human genome and the lack of powerful genetictechniques for the isolation and analysis of induced mutations.

We have used recombinant DNA techniques to determinethe spectrum of mutations produced in human mtDNA4 by the

alkylating agents EMS and MNNG, and by the polycyclicaromatic hydrocarbon BPDE which has been reported to damage mitochondria! DNA preferentially (4-8). Our strategy was

Received 12/18/87; revised 3/23/88; accepted 5/19/88.The costs of publication of this article were defrayed in part by the payment

of page charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1This work was supported by the NIH (R35-CA-39903, AG-07151) and theUnited States Environmental Protection Agency (R809-623-010).

2 Present address: Santen Pharmaceutical Co., Ltd., Osaka. Japan.3To whom requests for reprints should be addressed.4 The abbreviations used are: mtDNA, mitochondria! DNA; EMS, ethyl-

methane sulfonate; MNNG, iV-methyl-/V'-nitrosoguanidine; BPDE, (±)-r-7,f-8-dihydroxy-i-9,10-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (benzo(a)pyrenediol-epoxide].

to isolate mtDNA from mutagen-treated HeLa cells and determine the nucleotide sequence of independent recombinantclones containing the same portion of the mtDNA genome. Wehave chosen two adjacent regions of human mtDNA for thesestudies: the displacement (D-) loop region, a noncoding regioncontaining the origin of replication of the heavy (H-) strandand promoters for the transcription of both mtDNA strands(9); and an "uncloneable" fragment that spans nucleotides15,591-16,569 and contains the tRNAThr gene (10, 11). Mutants within the tRNAThr gene relax the "uncloneable pheno-type" and render it cloneable (11). Thus, the frequency at whichthe "uncloneable" fragment is recovered by cloning after treat

ment of cells with mutagens provides a sensitive assay fornucleotide sequence alterations in this region of the humanmitochondria! genome. After extensive treatment of HeLa cellswith known potent mutagens, we observed no enhancement ofmtDNA mutagenesis using either of these assays. Thus, cova-lent modifications of mtDNA are infrequently fixed as mutations in human mtDNA.

MATERIALS AND METHODS

Materials. HeLa cells were provided by Dr. Jacques Peschon (University of Washington). Cell culture media and serum were obtainedfrom GIBCO (Grand Island, NY). The M13mpl9 cloning vector, andthe Escherichia coli host strain JM 101 were gifts of Dr. JoachimMessing, University of Minnesota. EMS and MNNG were obtainedfrom Pfaitz and Bauer (Stamford, CT). [1,3-3H]BPDE (specific activity,

635 mCi/mmol) was obtained from Chemsyn Science Laboratories(Lenexa, KA). Restriction endonucleases, T4 DNA ligase, and an M1317-mer universal sequencing primer were obtained from Bethesda Research Laboratories (Gaithersburg, MD) or new England Biolabs (Beverly, MA). Deoxy- and dideoxynucleoside triphosphates and ATP wereproducts of Pharmacia P-L Biochemicals (Piscataway, NJ). Radioactivedeoxynucleotides and Gene Screen Plus were obtained from Du Pont-New England Nuclear (Boston, MA). Oligonucleotide probes andprimers were synthesized by P. S. H. Chou, Solid Phase SynthesisCenter, Howard Hughes Medical Institute, University of Washington.

Methods. HeLa cells were maintained in Dulbecco's modified minimal essential medium supplemented with 10% fetal calf serum at 37°Cin a 5% CO2 atmosphere. For treatment with mutagens, 1.2 x IO7HeLa cells were inoculated into three (100-mm-diameter) dishes andallowed to grow for 2 days in 30 ml of culture medium to a total ofapproximately 2 x IO7cells. EMS was added directly to the cell culturemedium followed by incubation at 37°Cfor 2 h. Two different treatment

protocols were used: cells were treated twice with 5 mM EMS, or threetimes each with 5 mM and with 10 mM EMS. In each protocol, the cellnumber was allowed to return to approximately 2x10* before subsequent mutagen treatment. In other experiments, HeLa cells (4.5 x IO7)

were treated with a single dose of BPDE or MNNG by replacing thecell culture medium with 2 ml of serum free medium and then addingthe desired concentration of mutagen dissolved in dimethyl sulfoxide.After the addition of BPDE or MNNG, cells were incubated at 37°C

for 2 h, washed twice with phosphate buffered saline, trypsinized, andreplated for the determination of cytotoxicity or regrown to 4 x IO8

cells.Isolation of mtDNA and Nuclear DNA. Covalently closed circular

mtDNA was isolated by a modification of the technique of Bogenhagenand Clayton (12, 13) from treated HeLa cells that had been allowed to

4578

Research. on January 14, 2021. © 1988 American Association for Cancercancerres.aacrjournals.org Downloaded from

MITOCHONDRIA!, DNA MUTAGENESIS

regrow to 2 x IO8 cells after mutagen treatment or from 2 x 10*

untreated control HeLa cells. Mitochondria were isolated by differentialsedimentation, and mtDNA was purified by CsCl-ethidium bromidedensity gradient centrifugation. Nuclear DNA was isolated by resus-pending the nuclear pellet obtained during mtDNA isolation in 10 HIMTris-HCl (pH 7.5)-l mM EDTA-0.5% sodium dodecyl sulfate and thenadding proteinase K to a final concentration of 100 Mg/ml. Afterincubation for l h at 37°C,the mixture was extracted with an equal

volume of phenol equilibrated with 50 mM Tris-HCl, pH 7.5, followedby extraction with an equal volume of chloroform:isoamyl alcohol (24:1,v/v). Nucleic acids were precipitated with ethanol and then digestedsequentially for l h at 37°Cwith 100 Mg/m' RNase A and for l h with

100 i!g/ml proteinase K in 10 mM Tris-HCl (pH 7.8) and 1 mM EDTA.The digestion mixture was extracted twice with an equal volume ofbuffer equilibrated phenol and once with an equal volume of chloro-fornrisoamyl alcohol. DNA was precipitated by the addition of ethanol.

Cloning the D-Loop Region. mtDNA was digested to completion withthe restriction endonuclease Taql, and the resulting fragments werefractionated by electrophoresis through a 0.7% low melting temperatureagarose gel (SeaPlaque; FMC Corp., Rockland, ME) in Tris-acetatebuffer (14). A 2828-base pair fragment containing the human mtDNAD-loop region was recovered from the gel by cutting out the regioncontaining the fragment and then mincing the gel slices in an equalvolume of phenol equilibrated with 50 mM Tris-HCl, pH 7.5. Theresulting mixture was frozen at —80°Cfor 20 min and then centrifuged

at 12,800 x g at room temperature for 5 min. The aqueous phase wasreextracted twice with equal volumes of phenol equilibrated with Tris-HCl, pH 7.5, and then precipitated by the addition of ethanol. Theresulting 2828-base pair D-loop fragment was digested sequentiallywith the restriction endonucleases Kpnl and .Vsrland ligated into thedouble stranded replicative form of M13mpl9 DNA that had beendigested previously with the restriction endonucleases Kpnl and Sstl.Restriction endonuclease digestions, ligations, JM 101 transformation,and the nucleotide sequence determination of independently isolatedMl3 clones containing the mitochondria! D-loop fragment were performed as described previously (15, 16).

Cloning the "Uncloneable" Fragment. The region of the human

mtDNA adjacent to the D-loop was first shown by Drouin (10) to beunderrepresented in collections of human mtDNA-pBR322 recombinant clones. We subsequently observed that mutations in this regionrelax the "uncloneable" phenotype and render this fragment cloneable(11). The "uncloneable" region of HeLa mtDNA was obtained by

digesting mtDNA to completion with the restriction endonucleasesKpnl and Xhol. The resulting fragments were fractionated by electrophoresis through a 0.7% low melting temperature agarose gel in Tris-acetate buffer and the fragment containing the uncloneable fragmentwas recovered by gel extraction. After digestion with Mbol, the resultingfragments were ligated into the double-stranded replicative form ofM13mpl8 or M13mpl9 DNA that had been previously digested withthe restriction endonucleases Kpnl and BamHl. Ligated DNA wastransformed into competent cells prepared from E. coli strain JM101(17). Colorless colonies containing different mtDNA inserts were identified by dot hybridization using four radiolabeled synthetic oligonucle-otide probes as described previously (11). Oligonucleotide hybridizationprobes were radiolabeled using [7-"P]ATP and T4 polynucleotidekinase (14). The DNA sequence of the L-strand of M13 clones containing the uncloneable fragment was determined with either a universal17-mer M13 primer (New England Biolabs) (15) or one of five syntheticprimers used in the direct sequence analysis of the "uncloneable"

fragment (11).

RESULTS

In order to analyze the types of mutations produced in themtDNA of human cells after exposure to mutagens, we determined the nucleotide sequence of multiple independently isolated recombinant DNA clones containing the same segmentof human mtDNA. The strategy used to isolate and determinethe nucleotide sequence of a portion of the D-loop region of

mtDNA cells is shown in Fig. \A. mtDNA was isolated fromuntreated control HeLa cells or from HeLa cells treated withEMS or BPDE. Purified HeLa mtDNA was digested into 29fragments using the restriction endonuclease Taql. The resulting fragments were separated on a low melting temperatureagarose gel. The 2828-base pair Taql fragment of mtDNAcontaining the D-loop region was isolated and then digestedsequentially with the restriction endonucleases Kpnl and Sstl.Only one of the four resulting fragments, the 476-base pairfragment spanning mtDNA nucleotide positions 16,134 to 41,has both a Kpnl and an Sstl end, allowing efficient ligation intothe cloning vector, M13mpl9 replicative fragment DNA, thathad been digested with Kpnl and Sstl. Single stranded recom-

D loop region

l2SrRNAgens

""\ f 'uoctonable' fragment

:yl b gene

Kpn I (K) - Xho I (X)digestion

Agarose gelPurification

Further RestrictionEnzyme Digestion

Moot

mt

Kpn It

UncloneableFragment

tXhol

Cloning inM13mp19

DNASequencing

A) D-loop B) UncloneableFragment

Fig. 1. Structure and cloning of HeLa mtDNA: A. For studies of the D-loopregion, mtDNA was digested with Taql and the 2828-base pair DNA fragment(human mitochondria! nucleotides. 14,957-1,216) containing the D-loop regionwas purified by agarose gel electrophoresis. This fragment was further digestedwith Kpnl and Ssll and cloned into M13mpl9. The nucleotide numbering andposition of segments is given in Ref. 9. DNA sequence determination on independently isolated clones was carried out as previously described (12, 13). lì.Forstudies on the "uncloneable" fragment, mtDNA was digested with Kpnl and Xhol.The 1097-base pair fragment was isolated on agarose gels, digested with Mbo\,and ligated to Ml 3mp 19 that had been digested previously with Kpnl and /(«millClones containing the Kpnl-Mbol fragment were identified by dot hybridizationand sequenced (see "Materials and Methods"), cyt, cytochrome.

4579

Research. on January 14, 2021. © 1988 American Association for Cancercancerres.aacrjournals.org Downloaded from

MITOCHONDRIA!. DNA MUTAGENESIS

binant M13 DNA was prepared from independent, plaquepurified recombinant clones and used as a template for nucleo-tidc sequence determination by the chain termination methodof Sanger étal.(18).

Mutations in the D-Loop Region

Studies with Kthylmethane Sulfonate. The effect of addingincreasing amounts of the direct acting mutagen EMS to cultures of exponentially growing HeLa cells is shown in Fig. 2.After exposure to 1.2 mM EMS for 2 h, cell survival was reducedto 37%. Exposure to 5 mM EMS reduced cell survival toapproximately 0.1%. In an initial attempt to produce mtDNAmutations, 2 x IO7 cells were treated three times sequentially

with 5 mivi EMS for 2 h; the treated starting cell populationwas allowed to regrow to 2 x 10" cells between each treatment.The nucleotide sequence of the L-strand of the mitochondria!D-loop inserts from EMS-treated HeLa cells was determinedfrom the Sstl site. No nucleotide sequence changes were observed in 635 nucleotides of sequence information derived from5 independently isolated clones containing the D-loop region(Table 1).

A more extensive procedure for mutagenesis yielded only asingle alteration in DNA sequence (Table 1, EMS x 6). Cellswere treated three times with 5 mM EMS for 2 h followed bythree treatments with 10 mM EMS for 2 h. The treated cellswere allowed to regrow to the starting cell number (2 x IO7

100c

10

>'>k_

co

0.11234

EMS (mM)Fig. 2. Toxicity of EMS to HeLa cells. The cells were treated with EMS as

described in "Materials and Methods" and trypsinized, and aliquots of 102-104cells were inoculated into 60-mm-diameter plastic dishes. After growing for 10days, the resulting colonies were fixed and stained with crystal violet. Cell survivalis expressed as a percentage of the plating efficiency of untreated HeLa cells. Theplating efficiency of control HeLa cells was 94%.

Table 1 Sequencing of mtDNA D-loop region from EMS-treated HeLa cells

HeLa cells were treated twice with 5 mM EMS (EMS x 2) or three times with5 mM and 10 mM (EMS x 6) for 2 h. The treated cell populations were regrownto the starting cell number (EMS x 6) or to lOx the starting cell number (EMSx 2) prior to subsequent treatment with mutagen.

Procedures for cloning and sequencing of mtDNA are given in "Materials andMethods."

TreatmentUntreatedEMSx2

EMSX6No.

ofclones

examined10

512Total

nucleotides

sequenced1306

6351784Nucleotide

sequencechangesL-strand

position16.488Typeof mu

tationNone

NoneG:C deletionNo.

ofclones1

cells) between each treatment. Only 1 of 12 D-loop clonesisolated from HeLa cells treated 6 times with EMS containeda mutation, the deletion of a G:C base pair at mtDNA nucleotide position 16,488.

Studies with BPDE. The effect of adding increasing amountsof BPDE to exponentially growing HeLa cells is shown in Fig.3. Treatment with 0.5 MMBPDE for 2 h reduced cell survivalto 37% ofthat observed in untreated HeLa cell cultures. Treatment with 10 /¿MBPDE for 2 h reduced cell survival toapproximately 0.1%. The covalent binding of BPDE to nuclearand mtDNA was determined after treatment of HeLa cells with\OfiM BPDE for 2 h, followed by the isolation of circularmtDNA. The amount of bound BPDE (specific activity, 635mCi/mmol) was 2075 dprn/^g of mtDNA and 485 dpm/^g ofnuclear DNA. Thus, the extent of binding to mtDNA was 4.3-fold greater than to nuclear DNA; these levels of bindingcorrespond to an average of 1 BPDE adduci per 1029 basepairs of mtDNA or 16.1 adducts per mtDNA molecule.

In two separate experiments, we determined the nucleotidesequence of M13 clones containing a portion of the D-loopregion of mtDNA from HeLa cells treated with 10 /*MBPDE(Table 2). A total of 10,809 nucleotides of sequence informationwas determined from 75 independent D-loop clones. In 1 of 2BPDE mutagenesis experiments, 14 of 63 D-loop clones contained the deletion of 1 G:C base pair from mtDNA positions34-36. The nucleotide sequence of positions 34-36 in controlHeLa cell mtDNA clones consisted of three G:C base pairs.Thus it is not possible to state which of the three G:C basepairs is deleted or whether the G:C base pair deleted in 14 of63 D-loop clones from BPDE-treated HeLa cells represents thedeletion of the same base pair in each clone. No mutations wereidentified in 12 clones obtained from a second experiment.

100

10

w 1

_CO

0.1

0.0110

BPDE (pM)

Fig. 3. Toxicity of BPDE to HeLa cells. The cells were treated with BPDE asdescribed in the legend to Fig. 2. The plating efficiency of control HeLa cells was94%.

Table 2 Sequence analysis of mtDNA D-loop region from BPDE-treatedHeLa cells

Cells were treated with a single dose of 10 jiM BPDE, as described in "Materialsand Methods."

Experiment 1Experiment 2No.

ofclones

examined6312Total

nucleotides

sequenced9009

1800Nucleotide

sequencechangesL-strand

position34Typeof

mutationG:C

deletionNoneNo.

ofclones14

4580

Research. on January 14, 2021. © 1988 American Association for Cancercancerres.aacrjournals.org Downloaded from

MITOCHONDRIAL DNA MUTAUENESIS

Mutations in the "Uncloneable" Fragment. In order to in

crease the sensitivity for scoring mutations in human mtDNA,we utilized a selective assay. The frequency of recovery ofrecombinant clones containing the DNA fragment that spanshuman mtDNA positions 15,591-16,053 is less than 1% ofclones containing other human mtDNA fragments of similarsize (10, 11). Mutations in the mt tRNAThr gene relax the"uncloneable" phenotype and allow the efficient recovery of

recombinant clones containing this fragment (11). The strategyfor detecting mutations in the "uncloneable" fragment of hu

man mtDNA is shown in Fig. IB. mtDNA was isolated fromcontrol HeLa cells or from HeLa cells treated with MNNG orBPDE. A Kpnl-Xhol fragment was isolated and then digestedwith Mbol. The Kpnl-Mbol fragments were ligated intoM13mpl9 that was predigested with Kpnl and Baml. Recombinant clones were screened for the presence of the "uncloneable" fragment by dot hybridization with an oligonucleotideprobe, homologous to a portion of the "uncloneable" fragment.

The frequency of recovery of the "uncloneable" fragment was

compared to that of a nearby mtDNA fragment for both untreated HeLa cells and for HeLa cells treated with MNNG orBPDE. In separate reactions, fragments with Mbol-Xhol termini were ligated to M13mpl9 that was previously digestedwith Baml-Sall. After transfection into E. coli JM101, thenumber of recombinant clones containing the different fragments was identified by dot hybridization with fragment-specific oligonucleotide probes. The recovery of fragment A (containing the "uncloneable" region) from untreated HeLa cell

mtDNA was approximately 1% of that observed for a nearbycontrol fragment (B), thus confirming the reduced cloningefficiency of this region of the human mt genome (Table 3) (10,11). MNNG treatment failed to increase the recovery of recombinant clones containing the "uncloneable" fragment, suggest

ing a lack of mtDNA mutation induction despite the decreasein cell survival (Table 3).

The nucleotide sequence of the "uncloneable" Kpnl-Mbol

fragment of mtDNA obtained from control and mutagen-treated HeLa cells is shown in Fig. 4. As previously reported(11) with mtDNA from control HeLa cells, all recovered clonescontained one or more nucleotide sequence differences withinthe tRNAThr gene of the "uncloneable" fragment (Fig. 4A ). The

majority of nucleotide sequence alterations were clustered intwo "hotspot" regions of the mt tRNAThr gene (Fig. 4B). Oneregion was a hexamer at H-strand positions 15,924-15,919encoding the anticodon loop of the human mt-tRNAThr. Theother was a pentamer at positions 15,900-15,896 encoding aportion of the tRNAThr D-stem. Each clone contained at least

one mutation within one of these two regions. Most important,

Table 3 Recovery of mtDNA fragments from untreated and MNNG-treatedHeLa cells

The Kpnl-Xhol fragment of mtDNA containing the "uncloneable" fragmentand an adjacent control fragment was isolated from untreated and MNNG-treatedcells, respectively. After digestion with Mbol to produce the "uncloneable" and

control fragments, 5 ng of the digest were ligated with 200 ng of M13mpl8replicative form DNA cut with Kpnl and BamHl and 1 ng of the digest with 40ng of M13mpl9 replicative form DNA cut with Sail and liumlll. After transfection into /;'. coli .IM 101 cells, aliquots of the resultant colorless colonies were

screened by dot hybridization with fragment-specific oligonucleotides. Valuesrepresent the number of "uncloneable" fragment-containing and control coloniesobtained from 1 ng of Kpnl-Xhol fragment.

No. of colonies containing Kpnl-Mbol "un

cloneable" fragment

(A)

No. of colonies containing Xhol-Mbol Ratio

control fragment (B) (A/B)

UntreatedMNNG-treated220 10017,400 14,8000.012 0.007

no changes were observed in the spectrum of nucleotide sequence alterations in this fragment after exposure of HeLa cellsto either MNNG (Fig. 4C) or BPDE (Fig. 4D).

DISCUSSION

We have analyzed the frequency and spectrum of mutationsin two regions of human mtDNA after exposing cells to agentsthat covalently modify DNA. The first region of the humanmtDNA genome we have studied is the noncoding D-loopregion. Previous restriction endonuclease mapping and DNAsequence studies have revealed considerable nucleotide sequence variability between the D-loop regions of unrelatedindividuals (15, 16, 19, 20). In contrast, very low levels ofnucleotide sequence variability exist within the D-loop ofmtDNA isolated from single individuals or from different tissues within an individual (15, 16). Thus mtDNA D-loop mutations induced in HeLa cells by treatment with mutagenswould be easy to detect against the low background of spontaneous mutations in this region of mtDNA within an individual.Extensive between-individual variability of the D-loop regionof human mtDNA also suggests that the D-loop region couldtolerate a greater number of induced mutations than the highlyconserved protein coding regions of human mtDNA.

The mutagens used for studies on the D-loop, EMS andBPDE, are direct acting and do not require metabolic activationto form covalent addition products on DNA. EMS is a potentmutagen and weak carcinogen that alkylates DNA by formingadducts primarily at the N-7 position of guanine and, to a lesserextent, at the 06 position of guanine and the N-3 position of

adenine (3). Because of the small size of EMS adducts and thediversity of addition products, replication of mtDNA altered byEMS could produce a broad spectrum of mutagenic alterations.BPDE is the most potent mutagenic and carcinogenic metabolite of benzo(a)pyrene (3,21 ). BPDE binds covalently to cellularDNA. The major stable adduct formed is linkage of position10 of the benzo(a)pyrene ring to the 2-amino group of guanineresidues (3, 22). BPDE-DNA adducts are persistent in vivo (23)and prevent DNA synthesis in vivo and in vitro (24, 25). In E.coli, BPDE specifically induces G:C —»T:A transversions, and,to a lesser extent, A:T —»T:A transversions (26). Yang et al.(27, 28) introduced into human cells a shuttle vector containingcovalently bound BPDE residues. The resulting mutations werepredominantly single-base substitutions, of which 45 of 61 wereG:C —»T:A transversions. These combined results are in accordwith the notion that BPDE mutagenesis occurs predominantlyat deoxyguanosine residues and involves either infrequent bypass of a blocking adduct (25) or depurination at the N7 position

followed by incorporation of deoxyadenosine (29).Backer and Weinstein (5, 7) have reported that, after treat

ment of cells with BPDE, the extent of covalent modificationof mtDNA was greater than that of nuclear DNA. They attributed this preferential attack of BPDE on mtDNA to the highsolubility of hydrophobic aromatic hydrocarbons in the lipid-rich environment presented by mitochondria. Our results confirm the observation of Backer and Weinstein and extend theirobservation to human cells.

In light of the ability of BPDE, and presumably EMS, toform covalent adducts with human mtDNA, it is surprising thatso few mutations were identified in the D-loop of mtDNA ofHeLa cells after mutagen treatment. The few mutations identified must represent the progeny of exceptionally rare eventsin light of the extensive mutagenesis protocols that were used.In experiments with EMS, HeLa cells were treated repeatedly

4581

Research. on January 14, 2021. © 1988 American Association for Cancercancerres.aacrjournals.org Downloaded from

MITOCHONDRIA!. DNA MUTAGENESIS

A)

16053

D-LOOPtRNAProIRNAThrCyt b

TTGTCCTTGGAAAAGGTTTTCATCTCCGGTTTACAAGACTGGTGTATTAGTTTATACTACAAGGAC15950 15930 15910 15890

-GI115800

88ceceC

CC©C©B)

UNTREATEDG©©C

CCC*CJ

C©CC©CC©CC©C

CG©CCG

©CCi; Gjè>© <g>©CC-ACA

-"7r'-ACA

CC

CCCC

CCCC

C)IMNNGI??

IGiAA©CT T TACA-A

-A- A CQT-AOc(C)

C

©C•~T~ '1-ATACT

D)BPDE1

1? iC

CCC

CfiTTT

AC AG

G?A

CCCCC

4TArT

®-i—C-~

-T

I+TGGTGTATTAGTTTAT)

Fig. 4. Spectrum of DNA sequence changes in the "uncloneable" fragment of HeLa mtDNA. The site and type of base substitution mutations are indicated above

and the site and extent of deletion mutations below the horizontal line. Circles indicate that at least one additional sequence alteration was present in a clone containingthe circled mutation.

with concentrations of EMS that reduced cell survival to approximately 0.1%. In one experiment in which HeLa cells weretreated sequentially 6 times with EMS, only I of 12 D-loopclones was found to contain a DNA sequence alteration. Thisnucleotide sequence alteration consisted of the deletion of aG:C basepair at nucleotide position 16,488. A similar low levelof D-loop mutagenesis was observed in experiments withBPDE. HeLa cells were treated once with 10 nM BPDE toreduce cell survival to less than 0.1%. This level of cell survivalcorresponded to the production of an average of 1 BPDE adductper 1029 base pairs or an average of 16.1 BPDE adducts permtDNA molecule. Fourteen of 63 D-loop clones isolated fromthe BPDE treated cells contained a G:C base pair deletion inthe G:C triplet at nucleotide positions 34-36 of HeLa cellmtDNA. However, the 14 D-loop clones containing the deletioncould be progeny of a single mutational event.

It is conceivable that BPDE adducts (of mtDNA) completelyblock DNA replication and that only cells containing at least

one mtDNA molecule lacking BPDE adducts are able to divide.If BPDE adducts are randomly distributed in the 2 x IO7 cells

initially exposed to BPDE, each containing approximately 8000mtDNA molecules (12), then on the basis of Poisson statisticsonly 1 in IO4cells would contain at least one mtDNA molecule

without a BPDE adduct. This value correlates closely, thoughperhaps fortuitously, with cell survival observed after BPDEtreatment. Avian cells containing few, or perhaps only one,mtDNA molecule per cell are able to grow and divide (30).Thus the mtDNA mutations we observed after BPDE treatmentcould have arisen from preexisting mutations in unmodifiedmtDNA molecules that were amplified following BPDE treatment.

We have used a second, more sensitive assay to detect andanalyze mtDNA mutations induced by mutagens. This assayuses a portion of mtDNA that overlaps with the D-loop regionas a target for mutagenesis. We have previously shown thatmutations in this region of human mtDNA relax its "unclone-

4582

Research. on January 14, 2021. © 1988 American Association for Cancercancerres.aacrjournals.org Downloaded from

MITOCHONDRIA!. DNA MUTAGENESIS

able" phenotype and thus provide a selection for mutations

occurring in this region of human mtDNA (11). The resultsshown in Table 3 indicate that, after treatment of HeLa cellswith MNNG, there is no increase in the frequency of mutationsthat relax the "uncloneable" phenotype. Our previous studies(11) indicated that relaxation of the "uncloneable" phenotype

is invariably associated with at least one mutation in one of tworegions of the tRNAThr gene that encodes the mt tRNAThranticodon loop (15,924-15,919) and D-stem (15,900-15,896).The DNA sequence of mutants obtained after treatment ofHeLa cells with either MNNG or BPDE are in accord withthese findings (Fig. 4). Even though mutations were observedafter treatment with MNNG (positions 16,017, 16,000, and15,941) and BPDE (positions 16,000 and 15,844) that have notbeen reported in untreated cells, there is no evidence that theseare induced by the mutagens.

Our studies suggest that covalent modifications of humanmtDNA are infrequently fixed as mutations. The apparent lackof mechanisms in mammalian cells for repair of bulky adductsin mtDNA and for mtDNA recombination (31, 32) suggeststhat mitochondrial DNA modifications are not excised. Furthermore, the retardation of replication of mtDNA followingtreatment of mammalian cells with UV suggests that bulkyadducts might prevent mtDNA replication. Thus, mitochondriawith unrepaired DNA damage might not replicate with eachcell division. An inducible mtDNAse could selectively degradedamaged mtDNA molecules prior to replication. Mammalianmitochondrial nucleases that could provide this type of suicidemechanism have been identified and purified (33, 34).

ACKNOWLEDGMENTS

We thank Chris Bjarke and Bruce Zellus for help with DNA sequencedeterminations and Mary Whiting for help with preparation of themanuscript.

REFERENCES

1. Monnat. R. M., Jr., and Loeb, L. A. Mechanisms of neoplastic transformation. Cancer Invest., /: 175-183, 1983.

2. Walker, G. C. Mutagenesis and inducible responses to deoxyribonucleic aciddamage in Escherichia coli. Microbiol. Rev., 48:60-93. 1984.

3. Singer, B., and Grunberger, D. Molecular Biology of Mutagens and Carcinogens. New York: Plenum Publishing Corp., 1983.

4. Wunderlich, V., Schutt, M., Bottger, M., and Graffi, A. Preferential alkyla-tion of mitochondrial deoxyribonucleic acid by /V-methyl-A'-nitrosourea.Biochem. J., 118: 99-109, 1970.

5. Backer, J. M., and Weinstein, I. B. Mitochondrial DNA is a major cellulartarget for a dihydrodiol-epoxide derivative of benzo[a]pyrene. Science (Wash.DC), 209: 297-299, 1980.

6. Allen, J. A., and Coombs, M. M. Covalent binding of polycyclic aromaticcompounds to mitochondrial and nuclear DNA. Nature (Lond.), 287: 244-245. 1980.

7. Backer, J. M., and Weinstein, I. B. Interaction of benzo[a]pyrene and itsdihydrodiol-epoxide derivative with nuclear and mitochondrial DNA inC3H10T/2 cell cultures. Cancer Res., 42: 2764-2769, 1982.

8. Niranjan, B. G., Bhat, N. K., and Avadhani, N. G. Preferential attack ofmitochondrial DNA by aflatoxin lì,during hepatocarcinogenesis. Science(Wash. DC), 215: 73-75, 1982.

9. Anderson. S., Bankier, A. T., Barrell. B. G., de Bruijn, M. H. L., Coulson,A. R., Drouin, J., Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger, F.,Schreier, P. H., Smith, A. J. H., Staden, R., and Young, 1. G. Sequence and

organization of the human mitochondrial genome. Nature (Lond.), 290:457-465, 1981.

10. Drouin, J. Cloning of human mitochondrial DNA in Escherichia coli. J. Mol.Biol., 140: 15-34, 1980.

11. Mita, S., Monnat, R. J., Jr., and Loeb, L. A. Direct selection of mutationsin the human mitochondrial tRNA11" gene: reversion of an "uncloneable"phenotype. Mutât.Res., 799: 183-190, 1988.

12. Bogenhagen, D., and Clayton, D. A. The number of mitochondrial deoxyribonucleic acid genomes in mouse L and human HeLa cells. J. Biol. Chem.,249:7991-7995, 1974.

13. Tapper, D. P., Van Etten, R. A., and Clayton, D. A. Isolation of mammalianmitochondrial DNA and RNA and cloning of the mitochondrial genome.Methods. Enzymol.. 97:426-434, 1983.

14. Maniatis, T., Fritsch, E. F., and Sambrook, J. Molecular Cloning: A Laboratory Manual, pp. 156-162. Cold Spring Harbor, NY: Cold Spring HarborLaboratory, 1982.

15. Monnat, R. J., Jr., and Loeb, L. A. Nucleotide sequence preservation ofhuman mitochondrial DNA. Proc. Nati. Acad. Sci. USA, 82: 2895-2899,1985.

16. Monnat, R. J., Jr., and Reay, D. T. Nucleotide sequence identity of mitochondrial DNA from different human tissues. Gene, 43: 205-211, 1986.

17. Hanahan, D. Studies on transformation of Escherichia coli with plasmids. J.Mol. Biol., 166: 557-580, 1983.

18. Sanger. F., Nicklen, S., and Coulson. A. R. DNA sequencing with chain-terminating inhibitors. Proc. Nati. Acad. Sci. USA, 74: 5463-5467, 1977.

19. Greenberg, B. D., Newbold, J. E., and Sugino, A. Intraspecific nucleotidesequence variability surrounding the origin of replication in human mitochondrial DNA. Gene, 21: 33-49, 1983.

20. Cann, R. L., Brown, W. M., and Wilson, A. C. Polymorphic sites and themechanism of evolution in human mitochondrial DNA. Genetics, 106:479-499, 1984.

21. Yang, S. K., McCourt, D. W., Roller. P. P., and Gelboin, H. V. Enzymaticconversion of benzo[a]pyrene leading predominantly to the diol-epoxide r-7,/-8-dihydroxy-/-9,10-epoxy-7,8,9,10-tetrahydrobenzo|a]pyrene through asingle enantiomer of r-7,/-8-dihydroxy-7,8-dihydrobenzo[a|pyrene. Proc.Nati. Acad. Sci. USA, 73: 2594-2598, 1976.

22. King, H. W. S., Osborne, M. R., and Brookes, P. The in vitro and in vivoreaction at the .V position of guanine of the ultimate carcinogen derivedfrom benzo[a]pyrene. Chem.-Biol. Interact., 24: 345-353, 1979.

23. Feldman, G., Remsen, J., Shinohara, K., and Cerutti, P. Excisability andpersistence of benzo(u)pyrene DNA adducts in epithelioid human lung cells.Nature (Lond.), 274: 796-798. 1978.

24. Hsu, W. T., Lin, E. J. S., Harvey, R. G., and Weiss, S. B. Mechanism ofphage 0X174 DNA inactivation by benzo[a|pyrene-7,8-dihydrodiol-9,10-epoxide. Proc. Nati. Acad. Sci. USA, 74: 3335-3339, 1977.

25. Larson, K. L., and Strauss, B. S. Influence of template strandedness on invitro replication of mutagen-damaged DNA. Biochemistry, 26: 2471-2479,1987.

26. Eisenstadt, E., Warren, A. J.. Porter, J., Atkins, D., and Miller, J. H.Carcinogenic epoxides of benzo[a]pyrene and cyclopenta[ro']pyrene induce

base substitutions via specific transversions. Proc. Nati. Acad. Sci. USA, 79:1945-1949,1982.

27. Yang, J., Mäher,V. M., and McCormick, J. M. Kinds of mutations formedwhen a shuttle vector containing adducts of (±)-7/3,8a-dihydroxy-9a,10a-epoxy-7,8,9,10-tetrahydrobenz[a)pyrene replicating in human cells. Proc.Nati. Acad. Sci. USA, 84: 3787-3791, 1987.

28. Yang, J., Mäher,V. M., and McCormick, J. M. Kinds of mutations formedwhen a shuttle vector containing adducts of benz[a]pyrene-7,8-diol-9,10-epoxide replicates in Cos7 cells. Mol. Cell. Biol., 7: 1267-1270, 1987.

29. Schaaper, R. M., Kunkel. T. A., and Loeb, L. A. Infidelity of DNA synthesisassociated with bypass of apurinic sites. Proc. Nati. Acad. Sci. USA, 80:487-491, 1983.

30. Desjardins, P., Frost, E., and Moráis,R. Ethidium bromide-induced loss ofmitochondrial DNA from primary chicken embryo fibroblasts. Mol. Cell.Biol., 5: 1163-1169, 1985.

31. Clayton, D. A., Doda, J. N., and Friedberg, E. C. The absence of a pyrimidinedimer repair mechanism in mammalian mitochondria. Proc. Nati. Acad. Sci.USA, 71: 2777-2781, 1974.

32. Clayton, D. A. Replication of animal mitochondrial DNA. Cell, 28: 693-705, 1982.

33. Durphy, M., Manley, P. N., and Friedberg, E. C. A demonstration of severaldeoxyribonuclease activities in mammalian cell mitochondria. J. Cell Biol.,«2:695-706, 1974.

34. Cummings, O. W., King, T. C, Holden, J. A., and Low, R. L. Purificationand characterization of the potent endonuclease in extracts of bovine heartmitochondria. J. Biol. Chem., 262: 2005-2015, 1987.

4583

Research. on January 14, 2021. © 1988 American Association for Cancercancerres.aacrjournals.org Downloaded from

1988;48:4578-4583. Cancer Res   Shiro Mita, Raymond J. Monnat, Jr. and Lawrence A. Loeb  Chemical CarcinogensResistance of HeLa Cell Mitochondrial DNA to Mutagenesis by

  Updated version

  http://cancerres.aacrjournals.org/content/48/16/4578

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/48/16/4578To request permission to re-use all or part of this article, use this link

Research. on January 14, 2021. © 1988 American Association for Cancercancerres.aacrjournals.org Downloaded from