Hindawi Publishing CorporationBioMed Research InternationalVolume 2013 Article ID 248507 8 pageshttpdxdoiorg1011552013248507

Research ArticleViability Reduction and Rac1 Gene Downregulation ofHeterogeneous Ex-Vivo Glioma Acute Slice Infected by theOncolytic Newcastle Disease Virus Strain V4UPM

Zulkifli Mustafa1 Hilda Shazana Shamsuddin2 Aini Ideris3 Rohaya Ibrahim3

Hasnan Jaafar2 Abdul Manaf Ali4 and Jafri Malin Abdullah1

1 Department of Neurosciences School of Medical Sciences Universiti Sains Malaysia 16150 Kubang Kerian Kelantan Malaysia2 Department of Pathology School of Medical Sciences Universiti Sains Malaysia 16150 Kubang Kerian Kelantan Malaysia3 Department of Microbiology Faculty of Veterinary Universiti Putra Malaysia 43400 Serdang Selangor Malaysia4Department of Biotechnology Faculty of Agriculture and Biotechnology Universiti Sultan Zainal Abidin21300 Kuala Terengganu Malaysia

Correspondence should be addressed to Zulkifli Mustafa jeocity vetyahoocom

Received 8 July 2012 Accepted 24 February 2013

Academic Editor Aaron S Dumont

Copyright copy 2013 Zulkifli Mustafa et alThis is an open access article distributed under the Creative CommonsAttribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Oncolytic viruses have been extensively evaluated for anticancer therapy because this virus preferentially infects cancer cells withoutinterfering with normal cells Newcastle Disease Virus (NDV) is an avian virus and one of the intensively studied oncolytic virusesaffecting many types of cancer including glioma Nevertheless the capability of NDV infection on heterogeneous glioma tissue ina cerebrospinal fluid atmosphere has never been reported Recently Rac1 is reported to be required for efficient NDV replication inhuman cancer cells and established a link between tumourigenesis and sensitivity to NDV Rac1 is a member of the Rho GTPasesinvolved in the regulation of the cell migration and cell-cycle progression Rac1 knockdown leads to significant inhibition of viralreplication In this work we demonstrated that NDV treatment led to significant reduction of tumour tissue viability of freshlyisolated heterogeneous human brain tumour slice known as an ex vivo glioma acute slice (EGAS) Analysis of gene expressionindicated that reduced tissue viability was associated with downregulation of Rac1 However the viability reduction was notpersistent We conclude that NDV treatment induced EGAS viability suppression but subsequent downregulation of Rac1 genemay reduce the NDV replication and lead to regrowth of EGAS tissue

1 Introduction

Glioma is a tumour of the central nervous system cancerarising from glial cells and grade IV glioma is known asglioblastoma multiforme (GBM) GBM is the most commonadult primary brain tumour with relatively low incidencecompared to the other types of tumours In Malaysia theNational Cancer Council (MAKNA) reported the incidenceof brain and nervous system tumour to be 33 per 100 000people (CR) in 2006 Unfortunately GBM showed rapiddevelopment and sustained its median survival at only 12ndash15 months since 25 years ago with almost 100 mortality [1ndash3] Hence insights for novel treatments have focused notablyon the application of viruses commonly known as oncolyticviruses as antineoplastic agents

Oncolytic viruses have been extensively evaluatedbecause of their potential to infect cancer cells preferentiallywithout interfering with normal cells [1 4ndash6] NDV isone of the most intensively evaluated oncolytic virusesto affect many types of human cancer NDV is a single-stranded negative-sense avian RNA virus in the family ofParamyxovirus that inherits selective oncolytic properties[5 7ndash11] The virus encodes for 6 viral proteins in the orderof 31015840-NP-P-M-F-HN-L-51015840 and is divided into 3 pathotypesaccording to the pathogenicity in avian virus velogenicmesogenic and lentogenic [11] Two strains of NDV that arethe most widely evaluated in clinical trials and have beenpatented for antineoplastic purposes are HuJ and MTH-68Other strains of NDV that have been investigated are 73-T[12] PV-701 [13]Ulster [8] Beaudette C [9]AF2240 [14] and

2 BioMed Research International

V4UPM [15] In particular the V4UPM strain is a modifiedlentogenic or nonvirulent V4 strain that has been used asa thermostable feed pellet vaccine for poultry in MalaysiaNevertheless the fundamental mechanism that drives NDVinfection in tumourigenic cells remains to be elucidated

GBM cell proliferation is commonly accomplished viatwo signalling pathways (1) the RasRafERK-MAPKRbpathway and (2) the PI3KAKT pathway Currently thesepathways are attractive targets for many ongoing therapeutictrials because they are abnormally activated up to 60 inGBMs and 70 in all solid cancers [16 17] Example ofoncolytic viruses targeting these pathways includes reoviruson Ras-activated cells adenovirus on the retinoblastomapathway and vaccinia virus on EGFR [1]

In addition another pathway that is less emphasised buthas exhibited remarkable and important aberrations in GBMis the PI3KRac1 pathwayThis pathway controls proliferationand regulates autonomous behaviour in GBM [18 19] Rac1 isa Ras-related C3 botulism toxin substrate 1 and is a memberof the monomeric G-protein Rho GTPases This protein isinvolved in the regulation of the cell cytoskeleton and migra-tion gene transcription and G1 cell-cycle progression [1720ndash22] Gjoerup et al reported that in an embryonic mousefibroblast NIH3T3 cell line activated Rac promoted theinactivation of retinoblastoma (Rb) to allow E2F-mediatedtranscription [19] thus permitting the progression of G1 intoS phase of the cell cycle [23]

Recent study showed that Rac1 was required for NDVreplication in human cancer cells and this finding establisheda link between tumourigenesis and sensitivity to oncolyticvirus [24] In Puhlmann et al the dynamic siRNA approachusing the skin carcinoma HaCaT cell line and Rac1 knock-down with two different siRNAs led to significant inhibitionof viral replication thereby demonstrating that Rac1 proteinis an essential component of efficient replication of NDV intumorigenic cells

In this work using the NDV strain V4UPM we presentthe effects ofNDV treatment on tumour viability and theRac1gene expression of freshly isolated GBM slices obtained frompatient in the ex vivo atmosphere known as EGAS V4UPMhas been previously proven to induce apoptosis in GBM celllines [15] In the EGAS technique the GBM specimenwas cutinto round thin-slice-core andwasmaintained in the artificialcerebral spinal fluid (aCSF) with bubbling carbogen gasThismodel aims to recapitulate the heterogeneity of GBM and itsenvironment which is observed in patients

2 Materials and Methods

21 Virus Preparation NDV-V4UPM was propagated asdescribed in [25] and quantified by haemagglutination-agglutination unit (HAU) on freshly prepared young chickenred blood cells (RBC) as previously described [15]

22 Preparation of Artificial Cerebrospinal Fluid (aCSF)Prior to tissue collection of the surgical resected tumouraCSF was prepared according to Musshoff et al [26] all of

the elements NaCl (124mML) KCL (4mML) NaH2PO4

(124mML) MgCl2(13mML) NaH

2CO3(26mML) D-

Glucose (10mML) and CaCl2(1mML) were dissolved

in distilled water The salinity at pH 74 ranged from 290to 320mM as tested by an osmometer (Osmomat 030Genotec Germany)The aCSFwas later filtered with a 02 ummembrane to avoid contamination of the brain slice in theorganotypic cultureThe sterile aCSFwas later placed into thefreezer to ensure that it was partially ice cold

23 Ex Vivo Acute Slice of Human Glioma Isolation and Culti-vation Reported by Bordey and Sontheimer the applicationof the acute-slice glioma model in an aCSF had been usedinitially for electrophysiology analysis [27] In our modelsystem a human brain tumour was obtained from patientswho underwent tumour excision which was used for analysisof oncolytic viral infection All samples were collected aftera confirmed appropriate biopsy prior to surgery (ethicallyapproved by the Research and Ethics Committee of UniversitiSains Malaysia) Next collected tissues were immediatelyplaced into sterile ice-cold aCSF bubbling with a mixture of95O

2and 5 CO

2gases known as carbogenThe carbogen

was filtered through a 02 um filter Following collectionthe tissues were immediately transferred from the operatingroom to the laboratory with the carbogen being maintainedUnder the sterile conditions in Biohazard Class II the solidtissue was immersed in aCSF in a petri dish as shown inFigure 1 Several cores of the tissue were later collected by a5mm punch biopsy and further sectioned into a very thincore slice using a sterile blade Sectioned slice cores wereincubated for 1-hour recovery at 37∘C in aCSF with bubblingcarbogen in a 6-well platemounted on the dry bath incubator(Major Science USA) After recovery the cores are referredas EGAS Later the viability of the cores was assessed bythe PrestoBlue Cell Viability Reagent as described in thefollowing

24 Acute Oncolytic Infection on EGAS All collected coreswere divided into three groups which are Group 1 (freshlyisolated GBM and did not undergo EGAS protocol) Group 2(mock-infected control group) andGroup 3 (NDV treatmentgroup) Following the establishment of EGAS cultivation themethod was implemented for acute ex vivo treatment of theglioma cores with the oncolytic NDV strain V4UPM For thetreatment group (Group 3) the infection was initiated afterrecovery at 37∘C as shown in Figure 1(c) The infective dose(512HAUmL) of V4UPM for glioma [15] was mixed intothe aCSF and this treatment mixture was further incubatedfor another 6 hours The same experimental procedure withvirus vehicle was applied for the Group 2 At the end ofthe 6-hour infection part of the infected and control coreswere fixed in RNAlater (Ambion USA) for assessment of thequantitative expression of genes by the qRT-PCR methodTo analyse further the viral effects on treated EGAS viabilityanother core of the same groupwas subsequently cultivated inorganotypic culture as described in the following All resultswere compared to the viability of the Group 1

BioMed Research International 3

Surgical resectionof glioma

(a)

Glioma tissue in aCSF slice into slice core

Blade

95 O2 +

5 CO2

02 120583m filter

(b)

Cultivation of glioma coresin aCSF known as EGAS

95 O2 +

5 CO2

(c)

Figure 1The figure summarises the protocol for preparation of EGAS cores Surgical specimens obtained from patient (a) were immediatelytransferred to a petri dish containing ice-cold aCSF bubbling with filtered carbogen gas (b)The specimen was prepared by punch biopsy andsliced with a sterile blade to form rounded glioma cores (c) The cores were later placed into a 6-well plate for acute infection with NDV 2cores per group were collected from each patient (119899 = 5)

25 EGAS Tissue Viability Analysis and Organotypic CultureThe viability of EGAS cores was assessed according to themodified method reported by Diallo et al 2010 [28] usingthe PrestoBlue Cell Viability Reagent (Invitrogen USA)The reagent contains a cell-permeable blue compound thatis virtually nonfluorescent but is converted to highly redfluorescent compound by the viable cells This test is asensitive analysis for a short incubation as compared to otherviability assays After the assay the PrestoBlue tested tissueremains viable and can be further cultured for other assaysIn our study an EGAS core was placed in a 24-well platewith 360 uL Dulbelcorsquos Minimum Essentials Media (DMEM)culture medium Next 40 uL PrestoBlue was added to thewell and incubated for 30 minutes in a 37∘C incubator with5 CO

2 After incubation 3 samples of 100 120583L were collected

from the well and placed into 3 wells of a 96-well plate andabsorbance was read using the spectrophotometer at 570 nm(600 nm reference wavelength for normalisation) The rela-tive tissue viability graph was plotted according to formulaviability = EGAS absorbancefresh GBM absorbance lowast 100The EGAS core was transferred back into the 6-well plate forfurther cultivation in an organotypic culture After 24 48 and72 hours the same EGAS core viability was assessed againFor the organotypic culture the treated and mock-treatedEGAS was maintained in a 6-well plate containing 2mL highglucose DMEM culture medium (Sigma Aldrich USA) andincubated in the 37∘C incubator with 5 CO

2 The medium

was supplemented with 10 foetal bovine serum 1 pen-strep antibiotic 1 nonessential amino acid (NEAA) 1mMsodium pyruvate and 2mM L-glutamine and the mediumwas changed dailyThe coremorphologywas examinedunderan inverted microscope The organotypic culture of braintissues previously has been reported [29ndash32]

26 qRT-PCR for HN Gene of NDV-V4UPM-Infected EGASThe qRT-PCR of all samples was performed according tothe previously reported protocols [33 34] Briefly RNA wasextracted using the RNAqueous-Micro Kit (Ambion USA)according to themanufacturerrsquos instructions Total RNAyieldwas determined by a nanophotometer (Implen Germany)at absorbance of 260 nm to 280 nm and RNA integrity wasdetermined using 1 agarose gel electrophoresis

For reverse transcription single-strand cDNA synthesiswas performed using Superscript III First-strand SynthesisSupermix from the qRT-PCRkit (InvitrogenUSA)The qRT-PCR analyses were performed using a probe-based detectionby the ABI PRISM 7500 Sequence Detection System (AppliedBiosystems USA) and TaqMan Universal PCR Master Mixkit The TaqMan probe contained a reporter dye at the 51015840 end(FAM dye) of the probe and a quencher dye (NFQ) at the31015840 end of the probe Intron-spinning primers and probe forall genes were designed using Primer Express Software v310(Applied Biosystems Germany) and synthesised by AppliedBiosystems (USA) according to the GenBank entries listed in

4 BioMed Research International

Table 1 List of sequence and GenBank accession number

Gene GenBank accession number Primers sequence (51015840 to 31015840) Product size

Rac1 NM 0188903Forward TGGGATACAGCTGGACAAGA

125 bpReverse CCGATTGCCGATGTGTTProbe TATCCGCAAACAGTTGGAGAAACGT

Ras NM 1767953Forward CACCAAGTCTTTTGAGGACATCCA

70 bpReverse CACGTCATCCGAGTCCTTCACProbe ACAGGGAGCAGATCAA

V4UPM HN X859711Forward CAGCACACCTAGCGATCTTGTAG

79 bpReverse TGGAACCGAGTGCAGATGTAATCProbe CCGACTGCGATCTCT

Table 1 Negative controls without reverse transcriptase wereperformed to ensure sufficient removal of contaminatingDNA In addition a nontemplate control containing all reac-tion mixtures except the template was included to rule outcontamination of the reagents The commercially availablehuman ACTB (GenBank Accession number NM 0011012Applied BiosystemsUSA)with an amplicon size of 171 bpwasused as endogenous reference gene The relative expressionof mRNA transcripts standard errors and 119875 values forfold-expression differences were determined by the relativeexpression ratio method via the Relative Expression SoftwareTool-Multiple Condition Solver (REST-MCS) [35]

27 Statistical Analysis Differences of viability within exper-imental groups were determined by Mann-Whitney testIn addition the relative expression ratio of target mRNAtranscripts was analysed using REST-MCS software via PairWise Fixed Reallocation Randomisation Test Any result with119875 lt 005 was considered to be statistically significant Allstatistical analyses were performed using SPSS 16 software

3 Results

31 EGAS Core Viability Analysis by PrestoBlue Cell ViabilityReagent To validate the use of the EGAS as an NDV targetthe relative number of live cells after 7 hours of EGAScultivation was determined by a PrestoBlue cell viabilityassay in DMEM medium Compared to the viability of theGroup 1 the Group 2 at 7 hours (represented by 0 hourin Figure 2) did not show a significant decrease (119875 =005) in cell viability Thus it indicated that the post EGAStissue remains viable throughout the EGAS cultivation Todouble confirm the viability the same tissuewas subsequentlycultured as organotypic culture for other 24 48 and 72hours As expected the tissue viability gradually increased inthe relative number of viable cells following 72 hours in anorganotypic culture

In the Group 3 the viability of V4UPM-infected coresafter 6 hours treatment in EGAS atmosphere showed nonsignificant reduction which were equally observed as inGroup 2 Following subsequent culture the treated tissuealso showed non-significant change after 24 hours but wassignificantly lower at 48 hours (119875 = 0004) Nonetheless theviability of the infected cores was renewed after 72 hours

0

20

40

60

80

100

120

0 24 48 72

Rela

tive v

iabi

lity

()

Time in organotypic culture (hours)

Viability of post NDV infected EGAS versus mock infected maintained in organotypic culture

V4UPM treatedMock infected

lowastlowast

Figure 2 EGAS viability progression analysis and subsequentassessment in an organotypic culture following the excision from thepatient and maintenance as EGAS in aCSF for 7 hours (representedas 0 hour in organotypic culture) the NDV-V4UPM treated EGASshowed a significantlowastlowast reduction in the number of viable cells until48 hours but regrowth at 72 hours whilst mock-infected EGASshowed persistent growth with an increased number of viable cellsError bars represent the plusmnSE

In this regard the observation of more than 80 cell via-bility ofmock-infected (Group 2) and treated cores (Group 3)after 6 hours demonstrated that the EGAS protocolmaintainsGBM core viability However the equal level of cell viabilitybetween both groups indicated that a 6-hour treatment didnot exhibit the number of acutely dead cells Converselyobservation of reduced viability in organotypic culture oftreated cores at 24 and 48 hours demonstrated that infectivityhad occurred in an EGAS treatment atmosphere

The regrowth of treated EGAS cores (Group 3) at 72hours indicated that GBM replication has occurred whichcoincides with our previous findings in nude mice in whichtreated GBMs regrew following a single treatment of V4UPM[15] One relevant explanation of this discrepancy wasdescribed by McGinnes et al who explained that the secondgeneration of a nonvirulent NDV strain that proliferatedin mammalian cells is not infectious and was due to lackof furin recognition sequence of fusion (F) protein to be

BioMed Research International 5

(a) (b)

Figure 3 The microphotograph (10X) illustrates the infected and uninfected EGAS core after 48 hours in organotypic culture (a) shows thetreated EGAS broken into pieces and dead cells and (b) shows the viable cells from the GBM core losing their organotypic core featuresattached and spread on the culture well

proteolytically cleaved into disulphate-linked heterodimerF [25] thus forming inactive F protein Posttranslationalprocessing of the precursor protein F

0into infective F protein

cleaved by a specific protease only exists in avian cells [36]Therefore a single dose in our treatment kills only a portionof cells and new monocyclic V4UPM progeny producedduring infection in this tumourigenic mammalian cell is notinfectious Hence this treatment possibly has limited viralproliferation or a self-amplifying dose and led to regrowthof the tumours Nevertheless Puhlmann et al has reportedthat Rac1 protein is essential for efficient replication of NDVin tumourigenic cells which kindled the interest to study thegene expression of Rac1

32 Microscopy Morphology of EGAS in Organotypic CultureFollowing treatment in an EGAS atmosphere the cores weresubsequently cultivated in an organotypic culture Parallelto viability assay infection in Group 3 had occurred whereinfected cores exhibited a mix of live and dead morphologyfollowing 48 hours in culture Nonetheless the organotypicfeatures were lost and a number of live cells were alsoobserved to migrate away from the cores (Figure 3) Incontrast mock-infected cores (Group 2) showed cell attach-ment spread and continued to growth in the culture wellreflecting the increased cell progression observed in theviability analysis

33 Gene Expression of Rac1 V4UPM-HN and Ras Fromthe RNA extraction of the treated EGAS group (Group 3)the V4UPM-HN gene was expressed in all treated samplesindicating that the infection process had initiated in EGAScores during treatment The relative expression of mRNAtranscripts of all genes that had been normalised to humanbeta-actin (ACTB) to determine pairwise fold differences ingene expression were further analysed A previous reportshowed that NDV infection was a thousandfold better inRas-transformed cells [37] Ras is a downstreammediator of EGFthe pathway that is commonly activated in GBM and leadsto an increase in cell proliferation [17] Besides Rac1 we alsoanalysed the Ras expression in mock-infected (Group 2) andV4UPM-treated cores (Group 3)

Figure 4(a) illustrates the PCR products of humanACTBRac1 V4UPM-HN andRas genes in our analysis As shown inFigure 4(b) theRas genewas not significantly downregulatedat 0440-fold and 0447-fold in both Group 2 (119875 = 0938) andGroup 3 (119875 = 0944) respectively as compared to fresh GBM(Group 1) The Rac1 gene was significantly downregulated at0095-fold in Group 3 (119875 = 0001) but was not significantlychanged in Group 2 with 0390-fold changes (119875 = 0473)having been observed

4 Discussion

Despite the clinical results indicating that all oncolytic virusesin trials are safe for direct injection to the brain overall ithas fallen short of expectations [2] NDV was the subject ofrelatively little preclinical investigation before being testedin clinical trials [1] We address this issue to generate bettermodels to compare to the conventional in vitromodel becausethis incomplete achievement is associated with the shallowunderstanding of the barrier for oncolytic virus infectioncreated by the wild tumour and heterogeneous tumourbiology in human body

In this study we are first to demonstrate the use of anEGAS for GBM-NDV acute interaction studies The modelwas used to recapitulate heterogeneous features of GBM aswell as to evaluate the practicality of NDV infection via CSFInitially we determined whether our model system supportsacute NDV infection in EGAS following treatment Previousreports showed that the NDV viral protein expression wasdetected after 6ndash8 hours [24] From the (+) sense sequenceprimer design our results indicated that expression of newV4UPM-HN gene was found in all treated EGAS coresIt showed that NDV infection had initiated in the aCSFenvironment following the 6-hour viral exposure Howeverviability analysis after viral exposure did not cause anysignificant cell death on EGAS cores In contrast subsequentcultivation of the cores in an organotypic culture revealedthat significant cell death only occurred after 48 hours in thetreatment group but regrowth of tumour cells was observedafter 72 hours

NDV replicates a thousandfold more efficiently in N-Ras transformed cells [37] The Ras gene is a downstream

6 BioMed Research International

300bp

75bp

50bp

M 1 2 3 4 5 6 7 8

(a)

0

1

2

EGAS mock infection EGAS V4UPM 512HAUTreatment group

minus4

minus3

minus2

minus1

lowastlowastlowast

Relat

ive e

xpre

ssio

n ra

tio (l

og 2)

Rac1Ras

(b)

Figure 4 (a) SybrGreen-stained agarose gel illustrating the PCRproducts of human ACTB Rac1 V4UPM-HN and Ras genes (M)represents the molecular weight of the marker (1) Human ACTB171 bp (2) human ACTB nontemplate control (NTC) (3) Rac1 gene125 bp (4) Rac1 NTC (5) V4UPM-HN gene 79 bp (6) V4UPM-HNNTC (7) Ras gene 70 bp and (8) Ras NTC For the V4UPM-HNgene RNA was extracted from the infected EGAS indicating theexistence of viral gene in the EGAS tissue (b) Analysis of qRT-PCRfor relative expression of mRNA transcripts is determined by therelative expression ratio method via REST-MCS and the Pair WiseFixed Reallocation Randomisation Test

effector of growth factor receptors such as EGFR and isamplified in 30 of GBM [17] In addition a study hasshown that NDV preferentially replicate in Rac1-expressingcell We therefore evaluated the EGAS samples for Ras andRac1 gene expression Our findings showed that Ras wasslightly downregulated in both treated and untreated groupsbut are not statistically significant as compared to fresh GBMsamples

In Rac1 gene analysis the gene was significantly down-regulated in the V4UPM-treated group as compared to thecontrol group Our screening on NDV effects in GBM cellline by western blot indicated Rac1 activation at 3 hours afterinfection (data not shown) In this regards Puhlmann et alhad previously established a link between tumourigenesisand sensitivity to oncolytic virus via Rac1 signalling NDVinfection preferentially replicate in Rac1-overexpressing cellsand inhibition of Rac1 protein also blocked the growth of

the skin carcinoma mutant cell line [24] In cancer biologyaberrant levels of Rac1 signalling has been implicated inmany aspects such as uncontrolled proliferation [21 22 38]as well as growth transformation invasion and metastasis[18] Specific Rac1 gene mutations are rarely detected inGBM but deregulated amplification is commonly found[22] Consequently Rac1 appears to be an ideal target fordeveloping approaches to block glioblastoma [3] Earlierreport had shown that suppression of Rac1 induced apoptosisin human glioma cell but not in normal astrocytes [20]

Therefore findings have pointed our study to this direc-tion Rac1 activation facilitated the NDV infection andthe infection led to reduction of EGAS viability Howeversubsequent Rac1 downregulation had inhibited NDV repli-cation and reduced its therapeutic efficiency thus leading toregrowth of EGAS viability at 72 hours Clearly further workhas to be done to outline the specific pathway leading toGBM cell death but NDV-Rac1 seems to be interrelated forsustainable infection in GBM

41 Ex Vivo Glioma Acute Slice (EGAS) Model Study Theex vivo model is an experiment that is performed outsideof the organism with minimum alteration to the naturalenvironment Pertaining to brain tissue the ex vivo slicemodel offers unique advantages over other in vitro or cell-culture approaches in that they largely preserve the tissuearchitecture and maintain neuronal activities with intactfunctional local synaptic circuits for long periods of time[39] Therefore the use of GBM slices from patients offergreat advantages such as using heterogeneous glioma tissuewhich is more relevant compared to homogeneous gliomacells in a cell-culture model Noticeably human tumour celllines in culture accumulate genetic alterations during serialpassaging that dramatically alter their biological behaviour[40] In contrast presence of normal astrocytes and necroticcells that features the GBM possibly becomes a drawback totargeted therapy analysis

Ideally maintaining glioma in an acute slice preparationwill provide physiologically and morphologically integratedglioma tissue for an acute infection mechanism study Theheterogeneous cells extracellular matrix (ECM) hypoxicregions high interstitial pressure and higher dose require-ments are amongst the major challenges in achieving lastingoncolytic viral infection [2] As summarised in Figure 1 weused the ex vivo model in aCSF to maintain the heteroge-neous cytoarchitecture and viability of freshly isolated humanglioma tissue to study the effects of acute oncolytic viralinfectionThe cerebrospinal fluid (CSF) is the colourless fluidfound in the ventricle system and subarachnoid space of thebrain where it maintains the chemical stability of the brainAs observed in our viability assay the relative number of livecells in the EGAS atmosphere after 7 hours in aCSF bubbledwith carbogen gas is slightly decreased but is not significantlyreduced compared to the relative number of live cells fromfreshly isolated GBM thus demonstrating that the protocolhas maintained the core viability (Figure 2) Therefore thetechnique not only permits acute testing of the antitumouragent but also allows for temperature manipulation oxygen

BioMed Research International 7

deprivation (hypoxic) conditions and higher dosages testingin the future

5 Conclusions

Acute exposure of the NDV strain V4UPM to freshly isolatedGBM slice in aCSF of ex vivo experiment had inducedsignificant but nonlasting reduction of the slice viability Geneexpression study revealed theRac1 gene downregulationThispossibly reduced the NDV proliferation and its therapeuticcapability thus leading to GBM slice regrowth ThereforeNDV-Rac1 is interrelated in sustaining NDV tropism inglioma

Conflict of Interests

All authors report no conflict of interests

Acknowledgments

The authors thank Majlis Kanser Nasional (MAKNA)Malaysia for providing financial grants and continuous sup-port for this study The authors also sincerely thank FarizanAhmad for writing assistance

References

[1] G Wollmann K Ozduman and A N van den Pol ldquoOncolyticvirus therapy for glioblastomamultiforme concepts and candi-datesrdquo Cancer Journal vol 18 no 1 pp 69ndash81 2012

[2] F J Zemp J C Corredor X Lun D A Muruve and PA Forsyth ldquoOncolytic viruses as experimental treatments formalignant gliomas using a scourge to treat a devilrdquo Cytokineand Growth Factor Reviews vol 21 no 2-3 pp 103ndash117 2010

[3] J Zhong A Paul S J Kellie and G M OrsquoNeill ldquoMesenchymalmigration as a therapeutic target in glioblastomardquo Journal ofOncology vol 2010 Article ID 430142 17 pages 2010

[4] T C Liu E Galanis and D Kirn ldquoClinical trial resultswith oncolytic virotherapy a century of promise a decade ofprogressrdquo Nature Clinical Practice Oncology vol 4 no 2 pp101ndash117 2007

[5] J N Parker D F Bauer J J Cody and J MMarkert ldquoOncolyticviral therapy ofmalignant gliomardquoNeurotherapeutics vol 6 no3 pp 558ndash569 2009

[6] K A Parato D Senger P A J Forsyth and J C Bell ldquoRecentprogress in the battle between oncolytic viruses and tumoursrdquoNature Reviews Cancer vol 5 no 12 pp 965ndash976 2005

[7] J G Sinkovics and J C Horvath ldquoNewcastle disease virus(NDV) brief history of its oncolytic strainsrdquo Journal of ClinicalVirology vol 16 no 1 pp 1ndash15 2000

[8] C Fiola B Peeters P Fournier A Arnold M Bucur andV Schirrmacher ldquoTumor selective replication of newcastledisease virus association with defects of tumor cells in antiviraldefencerdquo International Journal of Cancer vol 119 no 2 pp 328ndash338 2006

[9] S Krishnamurthy T Takimoto R A Scroggs and A PortnerldquoDifferentially regulated interferon response determines theoutcome of newcastle disease virus infection in normal andtumor cell linesrdquo Journal of Virology vol 80 no 11 pp 5145ndash5155 2006

[10] A Haseley C Alvarez-Breckenridge A R Chaudhury and BKaur ldquoAdvances in oncolytic virus therapy for gliomardquo RecentPatents on CNS Drug Discovery vol 4 no 1 pp 1ndash13 2009

[11] V Schirrmacher and P Fournier ldquoNewcastle disease virus apromising vector for viral therapy immune therapy and genetherapy of cancerrdquo Methods in Molecular Biology vol 542 pp565ndash605 2009

[12] A Phuangsab RM Lorence KWReichardM E Peeples andR J Walter ldquoNewcastle disease virus therapy of human tumorxenografts antitumor effects of local or systemic administra-tionrdquo Cancer Letters vol 172 no 1 pp 27ndash36 2001

[13] A L Pecora N Rizvi G I Cohen et al ldquoPhase I trialof intravenous administration of PV701 an oncolytic virusin patients with advanced solid cancersrdquo Journal of ClinicalOncology vol 20 no 9 pp 2251ndash2266 2002

[14] A M Alabsi S A Abu Bakar R Ali et al ldquoEffects of new-castle disease virus strains AF2240 and V4-UPM on cytolysisand apoptosis of leukemia cell linesrdquo International Journal ofMolecular Sciences vol 12 no 12 pp 8645ndash8660 2012

[15] M M Zulkifli R Ibrahim A M Ali et al ldquoNewcastlediseases virus strain V4UPM displayed oncolytic ability againstexperimental humanmalignant gliomardquoNeurological Researchvol 31 no 1 pp 3ndash10 2009

[16] O O Kanu B Hughes C Di et al ldquoGlioblastoma multiformeoncogenomics and signaling pathwaysrdquo Clinical MedicineOncology vol 2009 no 3 pp 39ndash52 2009

[17] M Nakada D Kita T Watanabe et al ldquoAberrant signalingpathways in gliomardquo Cancers vol 3 no 3 pp 3242ndash3278 2011

[18] A Y Chan S J Coniglio Y Y Chuang et al ldquoRoles of the Rac1and Rac3 GTPases in human tumor cell invasionrdquo Oncogenevol 24 no 53 pp 7821ndash7829 2005

[19] O Gjoerup J Lukas J Bartek and B M Willumsen ldquoRac andCdc42 are potent stimulators of E2F-dependent transcriptioncapable of promoting retinoblastoma susceptibility gene prod-uct hyperphosphorylationrdquoThe Journal of Biological Chemistryvol 273 no 30 pp 18812ndash18818 1998

[20] D L Senger C Tudan M C Guiot et al ldquoSuppression of Racactivity induces apoptosis of human glioma cells but not normalhuman astrocytesrdquoCancer Research vol 62 no 7 pp 2131ndash21402002

[21] P Villalonga R M Guasch K Riento and A J Ridley ldquoRhoEinhibits cell cycle progression and Ras-induced transforma-tionrdquo Molecular and Cellular Biology vol 24 no 18 pp 7829ndash7840 2004

[22] D Sun D Xu and B Zhang ldquoRac signaling in tumorigenesisand as target for anticancer drug developmentrdquoDrug ResistanceUpdates vol 9 no 6 pp 274ndash287 2006

[23] B Everts and H G van der Poel ldquoReplication-selectiveoncolytic viruses in the treatment of cancerrdquo Cancer GeneTherapy vol 12 no 2 pp 141ndash161 2005

[24] J Puhlmann F Puehler D Mumberg P Boukamp and RBeier ldquoRac1 is required for oncolytic NDV replication in humancancer cells and establishes a link between tumorigenesis andsensitivity to oncolytic virusrdquo Oncogene vol 29 no 15 pp2205ndash2216 2010

[25] L W McGinnes H Pantua J Reitter and T G MorrisonldquoUNIT 15F2 newcastle disease virus propagation quantifica-tion and storagerdquo Current Protocols in Microbiology 2006

[26] U Musshoff R Kohling A Lucke et al ldquoVigabatrin reducesepileptiform activity in brain slices from pharmacoresistantepilepsy patientsrdquo European Journal of Pharmacology vol 401no 2 pp 167ndash172 2000

8 BioMed Research International

[27] A Bordey and H Sontheimer ldquoElectrophysiological propertiesof human astrocytic tumor cells in situ enigma of spiking glialcellsrdquo Journal of Neurophysiology vol 79 no 5 pp 2782ndash27931998

[28] J S Diallo D Roy H Abdelbary N De Silva and J C BellldquoEx vivo infection of live tissue with oncolytic virusesrdquo Journalof Visualized Experiments no 52 Article ID e2854 2011

[29] K L Chaichana V Capilla-Gonzalez O Gonzalez-Perez etal ldquoPreservation of glial cytoarchitecture from ex vivo humantumor and non-tumor cerebral cortical explants a humanmodel to study neurological diseasesrdquo Journal of NeuroscienceMethods vol 164 no 2 pp 261ndash270 2007

[30] J Xu D Sampath F F Lang et al ldquoVorinostat modulates cellcycle regulatory proteins in glioma cells and human glioma sliceculturesrdquo Journal of Neuro-Oncology vol 105 no 2 pp 241ndash2512011

[31] V M Paulino Z Yang J Kloss et al ldquoTROY (TNFRSF19) isoverexpressed in advanced glial tumors and promotes glioblas-toma cell invasion via Pyk2-Rac1 signalingrdquo Molecular CancerResearch vol 8 no 11 pp 1558ndash1567 2010

[32] G Fulci and B Passer ldquoAnalysis of HSV oncolytic virotherapyin organotypic culturesrdquoMethods inMolecular Biology vol 542pp 75ndash86 2009

[33] V P Gopinath G D Raj A Raja K Kumanan and SElankumaran ldquoRapid detection of newcastle disease virusreplication in embryonated chicken eggs using quantitative realtime polymerase chain reactionrdquo Journal of VirologicalMethodsvol 171 no 1 pp 98ndash101 2011

[34] N Wakamatsu D J King B S Seal and C C Brown ldquoDetec-tion of newcastle disease virus RNA by reverse transcription-polymerase chain reaction using formalin-fixed paraffin-embedded tissue and comparison with immunohistochemistryand in situ hybridizationrdquo Journal of Veterinary DiagnosticInvestigation vol 19 no 4 pp 396ndash400 2007

[35] MWPfafflGWHorgan andLDempfle ldquoRelative expressionsoftware tool (REST) for group-wise comparison and statisticalanalysis of relative expression results in real-time PCRrdquoNucleicAcids Research vol 30 no 9 article e36 2002

[36] V Schirrmacher CHaas R Bonifer T Ahlert RGerhards andC Ertel ldquoHuman tumor cell modification by virus infection anefficient and safeway to produce cancer vaccinewith pleiotropicimmune stimulatory properties when using newcastle diseasevirusrdquo Gene Therapy vol 6 no 1 pp 63ndash73 1999

[37] R M Lorence B B Katubig K W Reichard et al ldquoCompleteregression of human fibrosarcoma xenografts after local new-castle disease virus therapyrdquo Cancer Research vol 54 no 23pp 6017ndash6021 1994

[38] K Pruitt and C J Der ldquoRas and Rho regulation of the cell cycleand oncogenesisrdquo Cancer Letters vol 171 no 1 pp 1ndash10 2001

[39] L Lossi S Alasia C Salio and A Merighi ldquoCell deathand proliferation in acute slices and organotypic cultures ofmammalian CNSrdquo Progress in Neurobiology vol 88 no 4 pp221ndash245 2009

[40] X Li J W S Law and A Y W Lee ldquoSemaphorin 5A andplexin-B3 regulate human glioma cell motility andmorphologythrough Rac1 and the actin cytoskeletonrdquo Oncogene vol 31 no5 pp 595ndash610 2012

BioMed Research International 3

Surgical resectionof glioma

(a)

Glioma tissue in aCSF slice into slice core

Blade

95 O2 +

5 CO2

02 120583m filter

(b)

Cultivation of glioma coresin aCSF known as EGAS

95 O2 +

5 CO2

(c)

Figure 1The figure summarises the protocol for preparation of EGAS cores Surgical specimens obtained from patient (a) were immediatelytransferred to a petri dish containing ice-cold aCSF bubbling with filtered carbogen gas (b)The specimen was prepared by punch biopsy andsliced with a sterile blade to form rounded glioma cores (c) The cores were later placed into a 6-well plate for acute infection with NDV 2cores per group were collected from each patient (119899 = 5)

25 EGAS Tissue Viability Analysis and Organotypic CultureThe viability of EGAS cores was assessed according to themodified method reported by Diallo et al 2010 [28] usingthe PrestoBlue Cell Viability Reagent (Invitrogen USA)The reagent contains a cell-permeable blue compound thatis virtually nonfluorescent but is converted to highly redfluorescent compound by the viable cells This test is asensitive analysis for a short incubation as compared to otherviability assays After the assay the PrestoBlue tested tissueremains viable and can be further cultured for other assaysIn our study an EGAS core was placed in a 24-well platewith 360 uL Dulbelcorsquos Minimum Essentials Media (DMEM)culture medium Next 40 uL PrestoBlue was added to thewell and incubated for 30 minutes in a 37∘C incubator with5 CO

2 After incubation 3 samples of 100 120583L were collected

from the well and placed into 3 wells of a 96-well plate andabsorbance was read using the spectrophotometer at 570 nm(600 nm reference wavelength for normalisation) The rela-tive tissue viability graph was plotted according to formulaviability = EGAS absorbancefresh GBM absorbance lowast 100The EGAS core was transferred back into the 6-well plate forfurther cultivation in an organotypic culture After 24 48 and72 hours the same EGAS core viability was assessed againFor the organotypic culture the treated and mock-treatedEGAS was maintained in a 6-well plate containing 2mL highglucose DMEM culture medium (Sigma Aldrich USA) andincubated in the 37∘C incubator with 5 CO

2 The medium

was supplemented with 10 foetal bovine serum 1 pen-strep antibiotic 1 nonessential amino acid (NEAA) 1mMsodium pyruvate and 2mM L-glutamine and the mediumwas changed dailyThe coremorphologywas examinedunderan inverted microscope The organotypic culture of braintissues previously has been reported [29ndash32]

26 qRT-PCR for HN Gene of NDV-V4UPM-Infected EGASThe qRT-PCR of all samples was performed according tothe previously reported protocols [33 34] Briefly RNA wasextracted using the RNAqueous-Micro Kit (Ambion USA)according to themanufacturerrsquos instructions Total RNAyieldwas determined by a nanophotometer (Implen Germany)at absorbance of 260 nm to 280 nm and RNA integrity wasdetermined using 1 agarose gel electrophoresis

For reverse transcription single-strand cDNA synthesiswas performed using Superscript III First-strand SynthesisSupermix from the qRT-PCRkit (InvitrogenUSA)The qRT-PCR analyses were performed using a probe-based detectionby the ABI PRISM 7500 Sequence Detection System (AppliedBiosystems USA) and TaqMan Universal PCR Master Mixkit The TaqMan probe contained a reporter dye at the 51015840 end(FAM dye) of the probe and a quencher dye (NFQ) at the31015840 end of the probe Intron-spinning primers and probe forall genes were designed using Primer Express Software v310(Applied Biosystems Germany) and synthesised by AppliedBiosystems (USA) according to the GenBank entries listed in

4 BioMed Research International

Table 1 List of sequence and GenBank accession number

Gene GenBank accession number Primers sequence (51015840 to 31015840) Product size

Rac1 NM 0188903Forward TGGGATACAGCTGGACAAGA

125 bpReverse CCGATTGCCGATGTGTTProbe TATCCGCAAACAGTTGGAGAAACGT

Ras NM 1767953Forward CACCAAGTCTTTTGAGGACATCCA

70 bpReverse CACGTCATCCGAGTCCTTCACProbe ACAGGGAGCAGATCAA

V4UPM HN X859711Forward CAGCACACCTAGCGATCTTGTAG

79 bpReverse TGGAACCGAGTGCAGATGTAATCProbe CCGACTGCGATCTCT

Table 1 Negative controls without reverse transcriptase wereperformed to ensure sufficient removal of contaminatingDNA In addition a nontemplate control containing all reac-tion mixtures except the template was included to rule outcontamination of the reagents The commercially availablehuman ACTB (GenBank Accession number NM 0011012Applied BiosystemsUSA)with an amplicon size of 171 bpwasused as endogenous reference gene The relative expressionof mRNA transcripts standard errors and 119875 values forfold-expression differences were determined by the relativeexpression ratio method via the Relative Expression SoftwareTool-Multiple Condition Solver (REST-MCS) [35]

27 Statistical Analysis Differences of viability within exper-imental groups were determined by Mann-Whitney testIn addition the relative expression ratio of target mRNAtranscripts was analysed using REST-MCS software via PairWise Fixed Reallocation Randomisation Test Any result with119875 lt 005 was considered to be statistically significant Allstatistical analyses were performed using SPSS 16 software

3 Results

31 EGAS Core Viability Analysis by PrestoBlue Cell ViabilityReagent To validate the use of the EGAS as an NDV targetthe relative number of live cells after 7 hours of EGAScultivation was determined by a PrestoBlue cell viabilityassay in DMEM medium Compared to the viability of theGroup 1 the Group 2 at 7 hours (represented by 0 hourin Figure 2) did not show a significant decrease (119875 =005) in cell viability Thus it indicated that the post EGAStissue remains viable throughout the EGAS cultivation Todouble confirm the viability the same tissuewas subsequentlycultured as organotypic culture for other 24 48 and 72hours As expected the tissue viability gradually increased inthe relative number of viable cells following 72 hours in anorganotypic culture

In the Group 3 the viability of V4UPM-infected coresafter 6 hours treatment in EGAS atmosphere showed nonsignificant reduction which were equally observed as inGroup 2 Following subsequent culture the treated tissuealso showed non-significant change after 24 hours but wassignificantly lower at 48 hours (119875 = 0004) Nonetheless theviability of the infected cores was renewed after 72 hours

0

20

40

60

80

100

120

0 24 48 72

Rela

tive v

iabi

lity

()

Time in organotypic culture (hours)

Viability of post NDV infected EGAS versus mock infected maintained in organotypic culture

V4UPM treatedMock infected

lowastlowast

Figure 2 EGAS viability progression analysis and subsequentassessment in an organotypic culture following the excision from thepatient and maintenance as EGAS in aCSF for 7 hours (representedas 0 hour in organotypic culture) the NDV-V4UPM treated EGASshowed a significantlowastlowast reduction in the number of viable cells until48 hours but regrowth at 72 hours whilst mock-infected EGASshowed persistent growth with an increased number of viable cellsError bars represent the plusmnSE

In this regard the observation of more than 80 cell via-bility ofmock-infected (Group 2) and treated cores (Group 3)after 6 hours demonstrated that the EGAS protocolmaintainsGBM core viability However the equal level of cell viabilitybetween both groups indicated that a 6-hour treatment didnot exhibit the number of acutely dead cells Converselyobservation of reduced viability in organotypic culture oftreated cores at 24 and 48 hours demonstrated that infectivityhad occurred in an EGAS treatment atmosphere

The regrowth of treated EGAS cores (Group 3) at 72hours indicated that GBM replication has occurred whichcoincides with our previous findings in nude mice in whichtreated GBMs regrew following a single treatment of V4UPM[15] One relevant explanation of this discrepancy wasdescribed by McGinnes et al who explained that the secondgeneration of a nonvirulent NDV strain that proliferatedin mammalian cells is not infectious and was due to lackof furin recognition sequence of fusion (F) protein to be

BioMed Research International 5

(a) (b)

Figure 3 The microphotograph (10X) illustrates the infected and uninfected EGAS core after 48 hours in organotypic culture (a) shows thetreated EGAS broken into pieces and dead cells and (b) shows the viable cells from the GBM core losing their organotypic core featuresattached and spread on the culture well

proteolytically cleaved into disulphate-linked heterodimerF [25] thus forming inactive F protein Posttranslationalprocessing of the precursor protein F

0into infective F protein

cleaved by a specific protease only exists in avian cells [36]Therefore a single dose in our treatment kills only a portionof cells and new monocyclic V4UPM progeny producedduring infection in this tumourigenic mammalian cell is notinfectious Hence this treatment possibly has limited viralproliferation or a self-amplifying dose and led to regrowthof the tumours Nevertheless Puhlmann et al has reportedthat Rac1 protein is essential for efficient replication of NDVin tumourigenic cells which kindled the interest to study thegene expression of Rac1

32 Microscopy Morphology of EGAS in Organotypic CultureFollowing treatment in an EGAS atmosphere the cores weresubsequently cultivated in an organotypic culture Parallelto viability assay infection in Group 3 had occurred whereinfected cores exhibited a mix of live and dead morphologyfollowing 48 hours in culture Nonetheless the organotypicfeatures were lost and a number of live cells were alsoobserved to migrate away from the cores (Figure 3) Incontrast mock-infected cores (Group 2) showed cell attach-ment spread and continued to growth in the culture wellreflecting the increased cell progression observed in theviability analysis

33 Gene Expression of Rac1 V4UPM-HN and Ras Fromthe RNA extraction of the treated EGAS group (Group 3)the V4UPM-HN gene was expressed in all treated samplesindicating that the infection process had initiated in EGAScores during treatment The relative expression of mRNAtranscripts of all genes that had been normalised to humanbeta-actin (ACTB) to determine pairwise fold differences ingene expression were further analysed A previous reportshowed that NDV infection was a thousandfold better inRas-transformed cells [37] Ras is a downstreammediator of EGFthe pathway that is commonly activated in GBM and leadsto an increase in cell proliferation [17] Besides Rac1 we alsoanalysed the Ras expression in mock-infected (Group 2) andV4UPM-treated cores (Group 3)

Figure 4(a) illustrates the PCR products of humanACTBRac1 V4UPM-HN andRas genes in our analysis As shown inFigure 4(b) theRas genewas not significantly downregulatedat 0440-fold and 0447-fold in both Group 2 (119875 = 0938) andGroup 3 (119875 = 0944) respectively as compared to fresh GBM(Group 1) The Rac1 gene was significantly downregulated at0095-fold in Group 3 (119875 = 0001) but was not significantlychanged in Group 2 with 0390-fold changes (119875 = 0473)having been observed

4 Discussion

Despite the clinical results indicating that all oncolytic virusesin trials are safe for direct injection to the brain overall ithas fallen short of expectations [2] NDV was the subject ofrelatively little preclinical investigation before being testedin clinical trials [1] We address this issue to generate bettermodels to compare to the conventional in vitromodel becausethis incomplete achievement is associated with the shallowunderstanding of the barrier for oncolytic virus infectioncreated by the wild tumour and heterogeneous tumourbiology in human body

In this study we are first to demonstrate the use of anEGAS for GBM-NDV acute interaction studies The modelwas used to recapitulate heterogeneous features of GBM aswell as to evaluate the practicality of NDV infection via CSFInitially we determined whether our model system supportsacute NDV infection in EGAS following treatment Previousreports showed that the NDV viral protein expression wasdetected after 6ndash8 hours [24] From the (+) sense sequenceprimer design our results indicated that expression of newV4UPM-HN gene was found in all treated EGAS coresIt showed that NDV infection had initiated in the aCSFenvironment following the 6-hour viral exposure Howeverviability analysis after viral exposure did not cause anysignificant cell death on EGAS cores In contrast subsequentcultivation of the cores in an organotypic culture revealedthat significant cell death only occurred after 48 hours in thetreatment group but regrowth of tumour cells was observedafter 72 hours

NDV replicates a thousandfold more efficiently in N-Ras transformed cells [37] The Ras gene is a downstream

6 BioMed Research International

300bp

75bp

50bp

M 1 2 3 4 5 6 7 8

(a)

0

1

2

EGAS mock infection EGAS V4UPM 512HAUTreatment group

minus4

minus3

minus2

minus1

lowastlowastlowast

Relat

ive e

xpre

ssio

n ra

tio (l

og 2)

Rac1Ras

(b)

Figure 4 (a) SybrGreen-stained agarose gel illustrating the PCRproducts of human ACTB Rac1 V4UPM-HN and Ras genes (M)represents the molecular weight of the marker (1) Human ACTB171 bp (2) human ACTB nontemplate control (NTC) (3) Rac1 gene125 bp (4) Rac1 NTC (5) V4UPM-HN gene 79 bp (6) V4UPM-HNNTC (7) Ras gene 70 bp and (8) Ras NTC For the V4UPM-HNgene RNA was extracted from the infected EGAS indicating theexistence of viral gene in the EGAS tissue (b) Analysis of qRT-PCRfor relative expression of mRNA transcripts is determined by therelative expression ratio method via REST-MCS and the Pair WiseFixed Reallocation Randomisation Test

effector of growth factor receptors such as EGFR and isamplified in 30 of GBM [17] In addition a study hasshown that NDV preferentially replicate in Rac1-expressingcell We therefore evaluated the EGAS samples for Ras andRac1 gene expression Our findings showed that Ras wasslightly downregulated in both treated and untreated groupsbut are not statistically significant as compared to fresh GBMsamples

In Rac1 gene analysis the gene was significantly down-regulated in the V4UPM-treated group as compared to thecontrol group Our screening on NDV effects in GBM cellline by western blot indicated Rac1 activation at 3 hours afterinfection (data not shown) In this regards Puhlmann et alhad previously established a link between tumourigenesisand sensitivity to oncolytic virus via Rac1 signalling NDVinfection preferentially replicate in Rac1-overexpressing cellsand inhibition of Rac1 protein also blocked the growth of

the skin carcinoma mutant cell line [24] In cancer biologyaberrant levels of Rac1 signalling has been implicated inmany aspects such as uncontrolled proliferation [21 22 38]as well as growth transformation invasion and metastasis[18] Specific Rac1 gene mutations are rarely detected inGBM but deregulated amplification is commonly found[22] Consequently Rac1 appears to be an ideal target fordeveloping approaches to block glioblastoma [3] Earlierreport had shown that suppression of Rac1 induced apoptosisin human glioma cell but not in normal astrocytes [20]

Therefore findings have pointed our study to this direc-tion Rac1 activation facilitated the NDV infection andthe infection led to reduction of EGAS viability Howeversubsequent Rac1 downregulation had inhibited NDV repli-cation and reduced its therapeutic efficiency thus leading toregrowth of EGAS viability at 72 hours Clearly further workhas to be done to outline the specific pathway leading toGBM cell death but NDV-Rac1 seems to be interrelated forsustainable infection in GBM

41 Ex Vivo Glioma Acute Slice (EGAS) Model Study Theex vivo model is an experiment that is performed outsideof the organism with minimum alteration to the naturalenvironment Pertaining to brain tissue the ex vivo slicemodel offers unique advantages over other in vitro or cell-culture approaches in that they largely preserve the tissuearchitecture and maintain neuronal activities with intactfunctional local synaptic circuits for long periods of time[39] Therefore the use of GBM slices from patients offergreat advantages such as using heterogeneous glioma tissuewhich is more relevant compared to homogeneous gliomacells in a cell-culture model Noticeably human tumour celllines in culture accumulate genetic alterations during serialpassaging that dramatically alter their biological behaviour[40] In contrast presence of normal astrocytes and necroticcells that features the GBM possibly becomes a drawback totargeted therapy analysis

Ideally maintaining glioma in an acute slice preparationwill provide physiologically and morphologically integratedglioma tissue for an acute infection mechanism study Theheterogeneous cells extracellular matrix (ECM) hypoxicregions high interstitial pressure and higher dose require-ments are amongst the major challenges in achieving lastingoncolytic viral infection [2] As summarised in Figure 1 weused the ex vivo model in aCSF to maintain the heteroge-neous cytoarchitecture and viability of freshly isolated humanglioma tissue to study the effects of acute oncolytic viralinfectionThe cerebrospinal fluid (CSF) is the colourless fluidfound in the ventricle system and subarachnoid space of thebrain where it maintains the chemical stability of the brainAs observed in our viability assay the relative number of livecells in the EGAS atmosphere after 7 hours in aCSF bubbledwith carbogen gas is slightly decreased but is not significantlyreduced compared to the relative number of live cells fromfreshly isolated GBM thus demonstrating that the protocolhas maintained the core viability (Figure 2) Therefore thetechnique not only permits acute testing of the antitumouragent but also allows for temperature manipulation oxygen

BioMed Research International 7

deprivation (hypoxic) conditions and higher dosages testingin the future

5 Conclusions

Acute exposure of the NDV strain V4UPM to freshly isolatedGBM slice in aCSF of ex vivo experiment had inducedsignificant but nonlasting reduction of the slice viability Geneexpression study revealed theRac1 gene downregulationThispossibly reduced the NDV proliferation and its therapeuticcapability thus leading to GBM slice regrowth ThereforeNDV-Rac1 is interrelated in sustaining NDV tropism inglioma

Conflict of Interests

All authors report no conflict of interests

Acknowledgments

The authors thank Majlis Kanser Nasional (MAKNA)Malaysia for providing financial grants and continuous sup-port for this study The authors also sincerely thank FarizanAhmad for writing assistance

References

[1] G Wollmann K Ozduman and A N van den Pol ldquoOncolyticvirus therapy for glioblastomamultiforme concepts and candi-datesrdquo Cancer Journal vol 18 no 1 pp 69ndash81 2012

[2] F J Zemp J C Corredor X Lun D A Muruve and PA Forsyth ldquoOncolytic viruses as experimental treatments formalignant gliomas using a scourge to treat a devilrdquo Cytokineand Growth Factor Reviews vol 21 no 2-3 pp 103ndash117 2010

[3] J Zhong A Paul S J Kellie and G M OrsquoNeill ldquoMesenchymalmigration as a therapeutic target in glioblastomardquo Journal ofOncology vol 2010 Article ID 430142 17 pages 2010

[4] T C Liu E Galanis and D Kirn ldquoClinical trial resultswith oncolytic virotherapy a century of promise a decade ofprogressrdquo Nature Clinical Practice Oncology vol 4 no 2 pp101ndash117 2007

[5] J N Parker D F Bauer J J Cody and J MMarkert ldquoOncolyticviral therapy ofmalignant gliomardquoNeurotherapeutics vol 6 no3 pp 558ndash569 2009

[6] K A Parato D Senger P A J Forsyth and J C Bell ldquoRecentprogress in the battle between oncolytic viruses and tumoursrdquoNature Reviews Cancer vol 5 no 12 pp 965ndash976 2005

[7] J G Sinkovics and J C Horvath ldquoNewcastle disease virus(NDV) brief history of its oncolytic strainsrdquo Journal of ClinicalVirology vol 16 no 1 pp 1ndash15 2000

[8] C Fiola B Peeters P Fournier A Arnold M Bucur andV Schirrmacher ldquoTumor selective replication of newcastledisease virus association with defects of tumor cells in antiviraldefencerdquo International Journal of Cancer vol 119 no 2 pp 328ndash338 2006

[9] S Krishnamurthy T Takimoto R A Scroggs and A PortnerldquoDifferentially regulated interferon response determines theoutcome of newcastle disease virus infection in normal andtumor cell linesrdquo Journal of Virology vol 80 no 11 pp 5145ndash5155 2006

[10] A Haseley C Alvarez-Breckenridge A R Chaudhury and BKaur ldquoAdvances in oncolytic virus therapy for gliomardquo RecentPatents on CNS Drug Discovery vol 4 no 1 pp 1ndash13 2009

[11] V Schirrmacher and P Fournier ldquoNewcastle disease virus apromising vector for viral therapy immune therapy and genetherapy of cancerrdquo Methods in Molecular Biology vol 542 pp565ndash605 2009

[12] A Phuangsab RM Lorence KWReichardM E Peeples andR J Walter ldquoNewcastle disease virus therapy of human tumorxenografts antitumor effects of local or systemic administra-tionrdquo Cancer Letters vol 172 no 1 pp 27ndash36 2001

[13] A L Pecora N Rizvi G I Cohen et al ldquoPhase I trialof intravenous administration of PV701 an oncolytic virusin patients with advanced solid cancersrdquo Journal of ClinicalOncology vol 20 no 9 pp 2251ndash2266 2002

[14] A M Alabsi S A Abu Bakar R Ali et al ldquoEffects of new-castle disease virus strains AF2240 and V4-UPM on cytolysisand apoptosis of leukemia cell linesrdquo International Journal ofMolecular Sciences vol 12 no 12 pp 8645ndash8660 2012

[15] M M Zulkifli R Ibrahim A M Ali et al ldquoNewcastlediseases virus strain V4UPM displayed oncolytic ability againstexperimental humanmalignant gliomardquoNeurological Researchvol 31 no 1 pp 3ndash10 2009

[16] O O Kanu B Hughes C Di et al ldquoGlioblastoma multiformeoncogenomics and signaling pathwaysrdquo Clinical MedicineOncology vol 2009 no 3 pp 39ndash52 2009

[17] M Nakada D Kita T Watanabe et al ldquoAberrant signalingpathways in gliomardquo Cancers vol 3 no 3 pp 3242ndash3278 2011

[18] A Y Chan S J Coniglio Y Y Chuang et al ldquoRoles of the Rac1and Rac3 GTPases in human tumor cell invasionrdquo Oncogenevol 24 no 53 pp 7821ndash7829 2005

[19] O Gjoerup J Lukas J Bartek and B M Willumsen ldquoRac andCdc42 are potent stimulators of E2F-dependent transcriptioncapable of promoting retinoblastoma susceptibility gene prod-uct hyperphosphorylationrdquoThe Journal of Biological Chemistryvol 273 no 30 pp 18812ndash18818 1998

[20] D L Senger C Tudan M C Guiot et al ldquoSuppression of Racactivity induces apoptosis of human glioma cells but not normalhuman astrocytesrdquoCancer Research vol 62 no 7 pp 2131ndash21402002

[21] P Villalonga R M Guasch K Riento and A J Ridley ldquoRhoEinhibits cell cycle progression and Ras-induced transforma-tionrdquo Molecular and Cellular Biology vol 24 no 18 pp 7829ndash7840 2004

[22] D Sun D Xu and B Zhang ldquoRac signaling in tumorigenesisand as target for anticancer drug developmentrdquoDrug ResistanceUpdates vol 9 no 6 pp 274ndash287 2006

[23] B Everts and H G van der Poel ldquoReplication-selectiveoncolytic viruses in the treatment of cancerrdquo Cancer GeneTherapy vol 12 no 2 pp 141ndash161 2005

[24] J Puhlmann F Puehler D Mumberg P Boukamp and RBeier ldquoRac1 is required for oncolytic NDV replication in humancancer cells and establishes a link between tumorigenesis andsensitivity to oncolytic virusrdquo Oncogene vol 29 no 15 pp2205ndash2216 2010

[25] L W McGinnes H Pantua J Reitter and T G MorrisonldquoUNIT 15F2 newcastle disease virus propagation quantifica-tion and storagerdquo Current Protocols in Microbiology 2006

[26] U Musshoff R Kohling A Lucke et al ldquoVigabatrin reducesepileptiform activity in brain slices from pharmacoresistantepilepsy patientsrdquo European Journal of Pharmacology vol 401no 2 pp 167ndash172 2000

8 BioMed Research International

[27] A Bordey and H Sontheimer ldquoElectrophysiological propertiesof human astrocytic tumor cells in situ enigma of spiking glialcellsrdquo Journal of Neurophysiology vol 79 no 5 pp 2782ndash27931998

[28] J S Diallo D Roy H Abdelbary N De Silva and J C BellldquoEx vivo infection of live tissue with oncolytic virusesrdquo Journalof Visualized Experiments no 52 Article ID e2854 2011

[29] K L Chaichana V Capilla-Gonzalez O Gonzalez-Perez etal ldquoPreservation of glial cytoarchitecture from ex vivo humantumor and non-tumor cerebral cortical explants a humanmodel to study neurological diseasesrdquo Journal of NeuroscienceMethods vol 164 no 2 pp 261ndash270 2007

[30] J Xu D Sampath F F Lang et al ldquoVorinostat modulates cellcycle regulatory proteins in glioma cells and human glioma sliceculturesrdquo Journal of Neuro-Oncology vol 105 no 2 pp 241ndash2512011

[31] V M Paulino Z Yang J Kloss et al ldquoTROY (TNFRSF19) isoverexpressed in advanced glial tumors and promotes glioblas-toma cell invasion via Pyk2-Rac1 signalingrdquo Molecular CancerResearch vol 8 no 11 pp 1558ndash1567 2010

[32] G Fulci and B Passer ldquoAnalysis of HSV oncolytic virotherapyin organotypic culturesrdquoMethods inMolecular Biology vol 542pp 75ndash86 2009

[33] V P Gopinath G D Raj A Raja K Kumanan and SElankumaran ldquoRapid detection of newcastle disease virusreplication in embryonated chicken eggs using quantitative realtime polymerase chain reactionrdquo Journal of VirologicalMethodsvol 171 no 1 pp 98ndash101 2011

[34] N Wakamatsu D J King B S Seal and C C Brown ldquoDetec-tion of newcastle disease virus RNA by reverse transcription-polymerase chain reaction using formalin-fixed paraffin-embedded tissue and comparison with immunohistochemistryand in situ hybridizationrdquo Journal of Veterinary DiagnosticInvestigation vol 19 no 4 pp 396ndash400 2007

[35] MWPfafflGWHorgan andLDempfle ldquoRelative expressionsoftware tool (REST) for group-wise comparison and statisticalanalysis of relative expression results in real-time PCRrdquoNucleicAcids Research vol 30 no 9 article e36 2002

[36] V Schirrmacher CHaas R Bonifer T Ahlert RGerhards andC Ertel ldquoHuman tumor cell modification by virus infection anefficient and safeway to produce cancer vaccinewith pleiotropicimmune stimulatory properties when using newcastle diseasevirusrdquo Gene Therapy vol 6 no 1 pp 63ndash73 1999

[37] R M Lorence B B Katubig K W Reichard et al ldquoCompleteregression of human fibrosarcoma xenografts after local new-castle disease virus therapyrdquo Cancer Research vol 54 no 23pp 6017ndash6021 1994

[38] K Pruitt and C J Der ldquoRas and Rho regulation of the cell cycleand oncogenesisrdquo Cancer Letters vol 171 no 1 pp 1ndash10 2001

[39] L Lossi S Alasia C Salio and A Merighi ldquoCell deathand proliferation in acute slices and organotypic cultures ofmammalian CNSrdquo Progress in Neurobiology vol 88 no 4 pp221ndash245 2009

[40] X Li J W S Law and A Y W Lee ldquoSemaphorin 5A andplexin-B3 regulate human glioma cell motility andmorphologythrough Rac1 and the actin cytoskeletonrdquo Oncogene vol 31 no5 pp 595ndash610 2012

4 BioMed Research International

Table 1 List of sequence and GenBank accession number

Gene GenBank accession number Primers sequence (51015840 to 31015840) Product size

Rac1 NM 0188903Forward TGGGATACAGCTGGACAAGA

125 bpReverse CCGATTGCCGATGTGTTProbe TATCCGCAAACAGTTGGAGAAACGT

Ras NM 1767953Forward CACCAAGTCTTTTGAGGACATCCA

70 bpReverse CACGTCATCCGAGTCCTTCACProbe ACAGGGAGCAGATCAA

V4UPM HN X859711Forward CAGCACACCTAGCGATCTTGTAG

79 bpReverse TGGAACCGAGTGCAGATGTAATCProbe CCGACTGCGATCTCT

Table 1 Negative controls without reverse transcriptase wereperformed to ensure sufficient removal of contaminatingDNA In addition a nontemplate control containing all reac-tion mixtures except the template was included to rule outcontamination of the reagents The commercially availablehuman ACTB (GenBank Accession number NM 0011012Applied BiosystemsUSA)with an amplicon size of 171 bpwasused as endogenous reference gene The relative expressionof mRNA transcripts standard errors and 119875 values forfold-expression differences were determined by the relativeexpression ratio method via the Relative Expression SoftwareTool-Multiple Condition Solver (REST-MCS) [35]

27 Statistical Analysis Differences of viability within exper-imental groups were determined by Mann-Whitney testIn addition the relative expression ratio of target mRNAtranscripts was analysed using REST-MCS software via PairWise Fixed Reallocation Randomisation Test Any result with119875 lt 005 was considered to be statistically significant Allstatistical analyses were performed using SPSS 16 software

3 Results

31 EGAS Core Viability Analysis by PrestoBlue Cell ViabilityReagent To validate the use of the EGAS as an NDV targetthe relative number of live cells after 7 hours of EGAScultivation was determined by a PrestoBlue cell viabilityassay in DMEM medium Compared to the viability of theGroup 1 the Group 2 at 7 hours (represented by 0 hourin Figure 2) did not show a significant decrease (119875 =005) in cell viability Thus it indicated that the post EGAStissue remains viable throughout the EGAS cultivation Todouble confirm the viability the same tissuewas subsequentlycultured as organotypic culture for other 24 48 and 72hours As expected the tissue viability gradually increased inthe relative number of viable cells following 72 hours in anorganotypic culture

In the Group 3 the viability of V4UPM-infected coresafter 6 hours treatment in EGAS atmosphere showed nonsignificant reduction which were equally observed as inGroup 2 Following subsequent culture the treated tissuealso showed non-significant change after 24 hours but wassignificantly lower at 48 hours (119875 = 0004) Nonetheless theviability of the infected cores was renewed after 72 hours

0

20

40

60

80

100

120

0 24 48 72

Rela

tive v

iabi

lity

()

Time in organotypic culture (hours)

Viability of post NDV infected EGAS versus mock infected maintained in organotypic culture

V4UPM treatedMock infected

lowastlowast

Figure 2 EGAS viability progression analysis and subsequentassessment in an organotypic culture following the excision from thepatient and maintenance as EGAS in aCSF for 7 hours (representedas 0 hour in organotypic culture) the NDV-V4UPM treated EGASshowed a significantlowastlowast reduction in the number of viable cells until48 hours but regrowth at 72 hours whilst mock-infected EGASshowed persistent growth with an increased number of viable cellsError bars represent the plusmnSE

In this regard the observation of more than 80 cell via-bility ofmock-infected (Group 2) and treated cores (Group 3)after 6 hours demonstrated that the EGAS protocolmaintainsGBM core viability However the equal level of cell viabilitybetween both groups indicated that a 6-hour treatment didnot exhibit the number of acutely dead cells Converselyobservation of reduced viability in organotypic culture oftreated cores at 24 and 48 hours demonstrated that infectivityhad occurred in an EGAS treatment atmosphere

The regrowth of treated EGAS cores (Group 3) at 72hours indicated that GBM replication has occurred whichcoincides with our previous findings in nude mice in whichtreated GBMs regrew following a single treatment of V4UPM[15] One relevant explanation of this discrepancy wasdescribed by McGinnes et al who explained that the secondgeneration of a nonvirulent NDV strain that proliferatedin mammalian cells is not infectious and was due to lackof furin recognition sequence of fusion (F) protein to be

BioMed Research International 5

(a) (b)

Figure 3 The microphotograph (10X) illustrates the infected and uninfected EGAS core after 48 hours in organotypic culture (a) shows thetreated EGAS broken into pieces and dead cells and (b) shows the viable cells from the GBM core losing their organotypic core featuresattached and spread on the culture well

proteolytically cleaved into disulphate-linked heterodimerF [25] thus forming inactive F protein Posttranslationalprocessing of the precursor protein F

0into infective F protein

cleaved by a specific protease only exists in avian cells [36]Therefore a single dose in our treatment kills only a portionof cells and new monocyclic V4UPM progeny producedduring infection in this tumourigenic mammalian cell is notinfectious Hence this treatment possibly has limited viralproliferation or a self-amplifying dose and led to regrowthof the tumours Nevertheless Puhlmann et al has reportedthat Rac1 protein is essential for efficient replication of NDVin tumourigenic cells which kindled the interest to study thegene expression of Rac1

32 Microscopy Morphology of EGAS in Organotypic CultureFollowing treatment in an EGAS atmosphere the cores weresubsequently cultivated in an organotypic culture Parallelto viability assay infection in Group 3 had occurred whereinfected cores exhibited a mix of live and dead morphologyfollowing 48 hours in culture Nonetheless the organotypicfeatures were lost and a number of live cells were alsoobserved to migrate away from the cores (Figure 3) Incontrast mock-infected cores (Group 2) showed cell attach-ment spread and continued to growth in the culture wellreflecting the increased cell progression observed in theviability analysis

33 Gene Expression of Rac1 V4UPM-HN and Ras Fromthe RNA extraction of the treated EGAS group (Group 3)the V4UPM-HN gene was expressed in all treated samplesindicating that the infection process had initiated in EGAScores during treatment The relative expression of mRNAtranscripts of all genes that had been normalised to humanbeta-actin (ACTB) to determine pairwise fold differences ingene expression were further analysed A previous reportshowed that NDV infection was a thousandfold better inRas-transformed cells [37] Ras is a downstreammediator of EGFthe pathway that is commonly activated in GBM and leadsto an increase in cell proliferation [17] Besides Rac1 we alsoanalysed the Ras expression in mock-infected (Group 2) andV4UPM-treated cores (Group 3)

Figure 4(a) illustrates the PCR products of humanACTBRac1 V4UPM-HN andRas genes in our analysis As shown inFigure 4(b) theRas genewas not significantly downregulatedat 0440-fold and 0447-fold in both Group 2 (119875 = 0938) andGroup 3 (119875 = 0944) respectively as compared to fresh GBM(Group 1) The Rac1 gene was significantly downregulated at0095-fold in Group 3 (119875 = 0001) but was not significantlychanged in Group 2 with 0390-fold changes (119875 = 0473)having been observed

4 Discussion

Despite the clinical results indicating that all oncolytic virusesin trials are safe for direct injection to the brain overall ithas fallen short of expectations [2] NDV was the subject ofrelatively little preclinical investigation before being testedin clinical trials [1] We address this issue to generate bettermodels to compare to the conventional in vitromodel becausethis incomplete achievement is associated with the shallowunderstanding of the barrier for oncolytic virus infectioncreated by the wild tumour and heterogeneous tumourbiology in human body

In this study we are first to demonstrate the use of anEGAS for GBM-NDV acute interaction studies The modelwas used to recapitulate heterogeneous features of GBM aswell as to evaluate the practicality of NDV infection via CSFInitially we determined whether our model system supportsacute NDV infection in EGAS following treatment Previousreports showed that the NDV viral protein expression wasdetected after 6ndash8 hours [24] From the (+) sense sequenceprimer design our results indicated that expression of newV4UPM-HN gene was found in all treated EGAS coresIt showed that NDV infection had initiated in the aCSFenvironment following the 6-hour viral exposure Howeverviability analysis after viral exposure did not cause anysignificant cell death on EGAS cores In contrast subsequentcultivation of the cores in an organotypic culture revealedthat significant cell death only occurred after 48 hours in thetreatment group but regrowth of tumour cells was observedafter 72 hours

NDV replicates a thousandfold more efficiently in N-Ras transformed cells [37] The Ras gene is a downstream

6 BioMed Research International

300bp

75bp

50bp

M 1 2 3 4 5 6 7 8

(a)

0

1

2

EGAS mock infection EGAS V4UPM 512HAUTreatment group

minus4

minus3

minus2

minus1

lowastlowastlowast

Relat

ive e

xpre

ssio

n ra

tio (l

og 2)

Rac1Ras

(b)

Figure 4 (a) SybrGreen-stained agarose gel illustrating the PCRproducts of human ACTB Rac1 V4UPM-HN and Ras genes (M)represents the molecular weight of the marker (1) Human ACTB171 bp (2) human ACTB nontemplate control (NTC) (3) Rac1 gene125 bp (4) Rac1 NTC (5) V4UPM-HN gene 79 bp (6) V4UPM-HNNTC (7) Ras gene 70 bp and (8) Ras NTC For the V4UPM-HNgene RNA was extracted from the infected EGAS indicating theexistence of viral gene in the EGAS tissue (b) Analysis of qRT-PCRfor relative expression of mRNA transcripts is determined by therelative expression ratio method via REST-MCS and the Pair WiseFixed Reallocation Randomisation Test

effector of growth factor receptors such as EGFR and isamplified in 30 of GBM [17] In addition a study hasshown that NDV preferentially replicate in Rac1-expressingcell We therefore evaluated the EGAS samples for Ras andRac1 gene expression Our findings showed that Ras wasslightly downregulated in both treated and untreated groupsbut are not statistically significant as compared to fresh GBMsamples

In Rac1 gene analysis the gene was significantly down-regulated in the V4UPM-treated group as compared to thecontrol group Our screening on NDV effects in GBM cellline by western blot indicated Rac1 activation at 3 hours afterinfection (data not shown) In this regards Puhlmann et alhad previously established a link between tumourigenesisand sensitivity to oncolytic virus via Rac1 signalling NDVinfection preferentially replicate in Rac1-overexpressing cellsand inhibition of Rac1 protein also blocked the growth of

the skin carcinoma mutant cell line [24] In cancer biologyaberrant levels of Rac1 signalling has been implicated inmany aspects such as uncontrolled proliferation [21 22 38]as well as growth transformation invasion and metastasis[18] Specific Rac1 gene mutations are rarely detected inGBM but deregulated amplification is commonly found[22] Consequently Rac1 appears to be an ideal target fordeveloping approaches to block glioblastoma [3] Earlierreport had shown that suppression of Rac1 induced apoptosisin human glioma cell but not in normal astrocytes [20]

Therefore findings have pointed our study to this direc-tion Rac1 activation facilitated the NDV infection andthe infection led to reduction of EGAS viability Howeversubsequent Rac1 downregulation had inhibited NDV repli-cation and reduced its therapeutic efficiency thus leading toregrowth of EGAS viability at 72 hours Clearly further workhas to be done to outline the specific pathway leading toGBM cell death but NDV-Rac1 seems to be interrelated forsustainable infection in GBM

41 Ex Vivo Glioma Acute Slice (EGAS) Model Study Theex vivo model is an experiment that is performed outsideof the organism with minimum alteration to the naturalenvironment Pertaining to brain tissue the ex vivo slicemodel offers unique advantages over other in vitro or cell-culture approaches in that they largely preserve the tissuearchitecture and maintain neuronal activities with intactfunctional local synaptic circuits for long periods of time[39] Therefore the use of GBM slices from patients offergreat advantages such as using heterogeneous glioma tissuewhich is more relevant compared to homogeneous gliomacells in a cell-culture model Noticeably human tumour celllines in culture accumulate genetic alterations during serialpassaging that dramatically alter their biological behaviour[40] In contrast presence of normal astrocytes and necroticcells that features the GBM possibly becomes a drawback totargeted therapy analysis

Ideally maintaining glioma in an acute slice preparationwill provide physiologically and morphologically integratedglioma tissue for an acute infection mechanism study Theheterogeneous cells extracellular matrix (ECM) hypoxicregions high interstitial pressure and higher dose require-ments are amongst the major challenges in achieving lastingoncolytic viral infection [2] As summarised in Figure 1 weused the ex vivo model in aCSF to maintain the heteroge-neous cytoarchitecture and viability of freshly isolated humanglioma tissue to study the effects of acute oncolytic viralinfectionThe cerebrospinal fluid (CSF) is the colourless fluidfound in the ventricle system and subarachnoid space of thebrain where it maintains the chemical stability of the brainAs observed in our viability assay the relative number of livecells in the EGAS atmosphere after 7 hours in aCSF bubbledwith carbogen gas is slightly decreased but is not significantlyreduced compared to the relative number of live cells fromfreshly isolated GBM thus demonstrating that the protocolhas maintained the core viability (Figure 2) Therefore thetechnique not only permits acute testing of the antitumouragent but also allows for temperature manipulation oxygen

BioMed Research International 7

deprivation (hypoxic) conditions and higher dosages testingin the future

5 Conclusions

Acute exposure of the NDV strain V4UPM to freshly isolatedGBM slice in aCSF of ex vivo experiment had inducedsignificant but nonlasting reduction of the slice viability Geneexpression study revealed theRac1 gene downregulationThispossibly reduced the NDV proliferation and its therapeuticcapability thus leading to GBM slice regrowth ThereforeNDV-Rac1 is interrelated in sustaining NDV tropism inglioma

Conflict of Interests

All authors report no conflict of interests

Acknowledgments

The authors thank Majlis Kanser Nasional (MAKNA)Malaysia for providing financial grants and continuous sup-port for this study The authors also sincerely thank FarizanAhmad for writing assistance

References

[1] G Wollmann K Ozduman and A N van den Pol ldquoOncolyticvirus therapy for glioblastomamultiforme concepts and candi-datesrdquo Cancer Journal vol 18 no 1 pp 69ndash81 2012

[2] F J Zemp J C Corredor X Lun D A Muruve and PA Forsyth ldquoOncolytic viruses as experimental treatments formalignant gliomas using a scourge to treat a devilrdquo Cytokineand Growth Factor Reviews vol 21 no 2-3 pp 103ndash117 2010

[3] J Zhong A Paul S J Kellie and G M OrsquoNeill ldquoMesenchymalmigration as a therapeutic target in glioblastomardquo Journal ofOncology vol 2010 Article ID 430142 17 pages 2010

[4] T C Liu E Galanis and D Kirn ldquoClinical trial resultswith oncolytic virotherapy a century of promise a decade ofprogressrdquo Nature Clinical Practice Oncology vol 4 no 2 pp101ndash117 2007

[5] J N Parker D F Bauer J J Cody and J MMarkert ldquoOncolyticviral therapy ofmalignant gliomardquoNeurotherapeutics vol 6 no3 pp 558ndash569 2009

[6] K A Parato D Senger P A J Forsyth and J C Bell ldquoRecentprogress in the battle between oncolytic viruses and tumoursrdquoNature Reviews Cancer vol 5 no 12 pp 965ndash976 2005

[7] J G Sinkovics and J C Horvath ldquoNewcastle disease virus(NDV) brief history of its oncolytic strainsrdquo Journal of ClinicalVirology vol 16 no 1 pp 1ndash15 2000

[8] C Fiola B Peeters P Fournier A Arnold M Bucur andV Schirrmacher ldquoTumor selective replication of newcastledisease virus association with defects of tumor cells in antiviraldefencerdquo International Journal of Cancer vol 119 no 2 pp 328ndash338 2006

[9] S Krishnamurthy T Takimoto R A Scroggs and A PortnerldquoDifferentially regulated interferon response determines theoutcome of newcastle disease virus infection in normal andtumor cell linesrdquo Journal of Virology vol 80 no 11 pp 5145ndash5155 2006

[10] A Haseley C Alvarez-Breckenridge A R Chaudhury and BKaur ldquoAdvances in oncolytic virus therapy for gliomardquo RecentPatents on CNS Drug Discovery vol 4 no 1 pp 1ndash13 2009

[11] V Schirrmacher and P Fournier ldquoNewcastle disease virus apromising vector for viral therapy immune therapy and genetherapy of cancerrdquo Methods in Molecular Biology vol 542 pp565ndash605 2009

[12] A Phuangsab RM Lorence KWReichardM E Peeples andR J Walter ldquoNewcastle disease virus therapy of human tumorxenografts antitumor effects of local or systemic administra-tionrdquo Cancer Letters vol 172 no 1 pp 27ndash36 2001

[13] A L Pecora N Rizvi G I Cohen et al ldquoPhase I trialof intravenous administration of PV701 an oncolytic virusin patients with advanced solid cancersrdquo Journal of ClinicalOncology vol 20 no 9 pp 2251ndash2266 2002

[14] A M Alabsi S A Abu Bakar R Ali et al ldquoEffects of new-castle disease virus strains AF2240 and V4-UPM on cytolysisand apoptosis of leukemia cell linesrdquo International Journal ofMolecular Sciences vol 12 no 12 pp 8645ndash8660 2012

[15] M M Zulkifli R Ibrahim A M Ali et al ldquoNewcastlediseases virus strain V4UPM displayed oncolytic ability againstexperimental humanmalignant gliomardquoNeurological Researchvol 31 no 1 pp 3ndash10 2009

[16] O O Kanu B Hughes C Di et al ldquoGlioblastoma multiformeoncogenomics and signaling pathwaysrdquo Clinical MedicineOncology vol 2009 no 3 pp 39ndash52 2009

[17] M Nakada D Kita T Watanabe et al ldquoAberrant signalingpathways in gliomardquo Cancers vol 3 no 3 pp 3242ndash3278 2011

[18] A Y Chan S J Coniglio Y Y Chuang et al ldquoRoles of the Rac1and Rac3 GTPases in human tumor cell invasionrdquo Oncogenevol 24 no 53 pp 7821ndash7829 2005

[19] O Gjoerup J Lukas J Bartek and B M Willumsen ldquoRac andCdc42 are potent stimulators of E2F-dependent transcriptioncapable of promoting retinoblastoma susceptibility gene prod-uct hyperphosphorylationrdquoThe Journal of Biological Chemistryvol 273 no 30 pp 18812ndash18818 1998

[20] D L Senger C Tudan M C Guiot et al ldquoSuppression of Racactivity induces apoptosis of human glioma cells but not normalhuman astrocytesrdquoCancer Research vol 62 no 7 pp 2131ndash21402002

[21] P Villalonga R M Guasch K Riento and A J Ridley ldquoRhoEinhibits cell cycle progression and Ras-induced transforma-tionrdquo Molecular and Cellular Biology vol 24 no 18 pp 7829ndash7840 2004

[22] D Sun D Xu and B Zhang ldquoRac signaling in tumorigenesisand as target for anticancer drug developmentrdquoDrug ResistanceUpdates vol 9 no 6 pp 274ndash287 2006

[23] B Everts and H G van der Poel ldquoReplication-selectiveoncolytic viruses in the treatment of cancerrdquo Cancer GeneTherapy vol 12 no 2 pp 141ndash161 2005

[24] J Puhlmann F Puehler D Mumberg P Boukamp and RBeier ldquoRac1 is required for oncolytic NDV replication in humancancer cells and establishes a link between tumorigenesis andsensitivity to oncolytic virusrdquo Oncogene vol 29 no 15 pp2205ndash2216 2010

[25] L W McGinnes H Pantua J Reitter and T G MorrisonldquoUNIT 15F2 newcastle disease virus propagation quantifica-tion and storagerdquo Current Protocols in Microbiology 2006

[26] U Musshoff R Kohling A Lucke et al ldquoVigabatrin reducesepileptiform activity in brain slices from pharmacoresistantepilepsy patientsrdquo European Journal of Pharmacology vol 401no 2 pp 167ndash172 2000

8 BioMed Research International

[27] A Bordey and H Sontheimer ldquoElectrophysiological propertiesof human astrocytic tumor cells in situ enigma of spiking glialcellsrdquo Journal of Neurophysiology vol 79 no 5 pp 2782ndash27931998

[28] J S Diallo D Roy H Abdelbary N De Silva and J C BellldquoEx vivo infection of live tissue with oncolytic virusesrdquo Journalof Visualized Experiments no 52 Article ID e2854 2011

[29] K L Chaichana V Capilla-Gonzalez O Gonzalez-Perez etal ldquoPreservation of glial cytoarchitecture from ex vivo humantumor and non-tumor cerebral cortical explants a humanmodel to study neurological diseasesrdquo Journal of NeuroscienceMethods vol 164 no 2 pp 261ndash270 2007

[30] J Xu D Sampath F F Lang et al ldquoVorinostat modulates cellcycle regulatory proteins in glioma cells and human glioma sliceculturesrdquo Journal of Neuro-Oncology vol 105 no 2 pp 241ndash2512011

[31] V M Paulino Z Yang J Kloss et al ldquoTROY (TNFRSF19) isoverexpressed in advanced glial tumors and promotes glioblas-toma cell invasion via Pyk2-Rac1 signalingrdquo Molecular CancerResearch vol 8 no 11 pp 1558ndash1567 2010

[32] G Fulci and B Passer ldquoAnalysis of HSV oncolytic virotherapyin organotypic culturesrdquoMethods inMolecular Biology vol 542pp 75ndash86 2009

[33] V P Gopinath G D Raj A Raja K Kumanan and SElankumaran ldquoRapid detection of newcastle disease virusreplication in embryonated chicken eggs using quantitative realtime polymerase chain reactionrdquo Journal of VirologicalMethodsvol 171 no 1 pp 98ndash101 2011

[34] N Wakamatsu D J King B S Seal and C C Brown ldquoDetec-tion of newcastle disease virus RNA by reverse transcription-polymerase chain reaction using formalin-fixed paraffin-embedded tissue and comparison with immunohistochemistryand in situ hybridizationrdquo Journal of Veterinary DiagnosticInvestigation vol 19 no 4 pp 396ndash400 2007

[35] MWPfafflGWHorgan andLDempfle ldquoRelative expressionsoftware tool (REST) for group-wise comparison and statisticalanalysis of relative expression results in real-time PCRrdquoNucleicAcids Research vol 30 no 9 article e36 2002

[36] V Schirrmacher CHaas R Bonifer T Ahlert RGerhards andC Ertel ldquoHuman tumor cell modification by virus infection anefficient and safeway to produce cancer vaccinewith pleiotropicimmune stimulatory properties when using newcastle diseasevirusrdquo Gene Therapy vol 6 no 1 pp 63ndash73 1999

[37] R M Lorence B B Katubig K W Reichard et al ldquoCompleteregression of human fibrosarcoma xenografts after local new-castle disease virus therapyrdquo Cancer Research vol 54 no 23pp 6017ndash6021 1994

[38] K Pruitt and C J Der ldquoRas and Rho regulation of the cell cycleand oncogenesisrdquo Cancer Letters vol 171 no 1 pp 1ndash10 2001

[39] L Lossi S Alasia C Salio and A Merighi ldquoCell deathand proliferation in acute slices and organotypic cultures ofmammalian CNSrdquo Progress in Neurobiology vol 88 no 4 pp221ndash245 2009

[40] X Li J W S Law and A Y W Lee ldquoSemaphorin 5A andplexin-B3 regulate human glioma cell motility andmorphologythrough Rac1 and the actin cytoskeletonrdquo Oncogene vol 31 no5 pp 595ndash610 2012

BioMed Research International 5

(a) (b)

Figure 3 The microphotograph (10X) illustrates the infected and uninfected EGAS core after 48 hours in organotypic culture (a) shows thetreated EGAS broken into pieces and dead cells and (b) shows the viable cells from the GBM core losing their organotypic core featuresattached and spread on the culture well

proteolytically cleaved into disulphate-linked heterodimerF [25] thus forming inactive F protein Posttranslationalprocessing of the precursor protein F

0into infective F protein

cleaved by a specific protease only exists in avian cells [36]Therefore a single dose in our treatment kills only a portionof cells and new monocyclic V4UPM progeny producedduring infection in this tumourigenic mammalian cell is notinfectious Hence this treatment possibly has limited viralproliferation or a self-amplifying dose and led to regrowthof the tumours Nevertheless Puhlmann et al has reportedthat Rac1 protein is essential for efficient replication of NDVin tumourigenic cells which kindled the interest to study thegene expression of Rac1

32 Microscopy Morphology of EGAS in Organotypic CultureFollowing treatment in an EGAS atmosphere the cores weresubsequently cultivated in an organotypic culture Parallelto viability assay infection in Group 3 had occurred whereinfected cores exhibited a mix of live and dead morphologyfollowing 48 hours in culture Nonetheless the organotypicfeatures were lost and a number of live cells were alsoobserved to migrate away from the cores (Figure 3) Incontrast mock-infected cores (Group 2) showed cell attach-ment spread and continued to growth in the culture wellreflecting the increased cell progression observed in theviability analysis

33 Gene Expression of Rac1 V4UPM-HN and Ras Fromthe RNA extraction of the treated EGAS group (Group 3)the V4UPM-HN gene was expressed in all treated samplesindicating that the infection process had initiated in EGAScores during treatment The relative expression of mRNAtranscripts of all genes that had been normalised to humanbeta-actin (ACTB) to determine pairwise fold differences ingene expression were further analysed A previous reportshowed that NDV infection was a thousandfold better inRas-transformed cells [37] Ras is a downstreammediator of EGFthe pathway that is commonly activated in GBM and leadsto an increase in cell proliferation [17] Besides Rac1 we alsoanalysed the Ras expression in mock-infected (Group 2) andV4UPM-treated cores (Group 3)

Figure 4(a) illustrates the PCR products of humanACTBRac1 V4UPM-HN andRas genes in our analysis As shown inFigure 4(b) theRas genewas not significantly downregulatedat 0440-fold and 0447-fold in both Group 2 (119875 = 0938) andGroup 3 (119875 = 0944) respectively as compared to fresh GBM(Group 1) The Rac1 gene was significantly downregulated at0095-fold in Group 3 (119875 = 0001) but was not significantlychanged in Group 2 with 0390-fold changes (119875 = 0473)having been observed

4 Discussion

Despite the clinical results indicating that all oncolytic virusesin trials are safe for direct injection to the brain overall ithas fallen short of expectations [2] NDV was the subject ofrelatively little preclinical investigation before being testedin clinical trials [1] We address this issue to generate bettermodels to compare to the conventional in vitromodel becausethis incomplete achievement is associated with the shallowunderstanding of the barrier for oncolytic virus infectioncreated by the wild tumour and heterogeneous tumourbiology in human body

In this study we are first to demonstrate the use of anEGAS for GBM-NDV acute interaction studies The modelwas used to recapitulate heterogeneous features of GBM aswell as to evaluate the practicality of NDV infection via CSFInitially we determined whether our model system supportsacute NDV infection in EGAS following treatment Previousreports showed that the NDV viral protein expression wasdetected after 6ndash8 hours [24] From the (+) sense sequenceprimer design our results indicated that expression of newV4UPM-HN gene was found in all treated EGAS coresIt showed that NDV infection had initiated in the aCSFenvironment following the 6-hour viral exposure Howeverviability analysis after viral exposure did not cause anysignificant cell death on EGAS cores In contrast subsequentcultivation of the cores in an organotypic culture revealedthat significant cell death only occurred after 48 hours in thetreatment group but regrowth of tumour cells was observedafter 72 hours

NDV replicates a thousandfold more efficiently in N-Ras transformed cells [37] The Ras gene is a downstream

6 BioMed Research International

300bp

75bp

50bp

M 1 2 3 4 5 6 7 8

(a)

0

1

2

EGAS mock infection EGAS V4UPM 512HAUTreatment group

minus4

minus3

minus2

minus1

lowastlowastlowast

Relat

ive e

xpre

ssio

n ra

tio (l

og 2)

Rac1Ras

(b)

Figure 4 (a) SybrGreen-stained agarose gel illustrating the PCRproducts of human ACTB Rac1 V4UPM-HN and Ras genes (M)represents the molecular weight of the marker (1) Human ACTB171 bp (2) human ACTB nontemplate control (NTC) (3) Rac1 gene125 bp (4) Rac1 NTC (5) V4UPM-HN gene 79 bp (6) V4UPM-HNNTC (7) Ras gene 70 bp and (8) Ras NTC For the V4UPM-HNgene RNA was extracted from the infected EGAS indicating theexistence of viral gene in the EGAS tissue (b) Analysis of qRT-PCRfor relative expression of mRNA transcripts is determined by therelative expression ratio method via REST-MCS and the Pair WiseFixed Reallocation Randomisation Test

effector of growth factor receptors such as EGFR and isamplified in 30 of GBM [17] In addition a study hasshown that NDV preferentially replicate in Rac1-expressingcell We therefore evaluated the EGAS samples for Ras andRac1 gene expression Our findings showed that Ras wasslightly downregulated in both treated and untreated groupsbut are not statistically significant as compared to fresh GBMsamples

In Rac1 gene analysis the gene was significantly down-regulated in the V4UPM-treated group as compared to thecontrol group Our screening on NDV effects in GBM cellline by western blot indicated Rac1 activation at 3 hours afterinfection (data not shown) In this regards Puhlmann et alhad previously established a link between tumourigenesisand sensitivity to oncolytic virus via Rac1 signalling NDVinfection preferentially replicate in Rac1-overexpressing cellsand inhibition of Rac1 protein also blocked the growth of

the skin carcinoma mutant cell line [24] In cancer biologyaberrant levels of Rac1 signalling has been implicated inmany aspects such as uncontrolled proliferation [21 22 38]as well as growth transformation invasion and metastasis[18] Specific Rac1 gene mutations are rarely detected inGBM but deregulated amplification is commonly found[22] Consequently Rac1 appears to be an ideal target fordeveloping approaches to block glioblastoma [3] Earlierreport had shown that suppression of Rac1 induced apoptosisin human glioma cell but not in normal astrocytes [20]

Therefore findings have pointed our study to this direc-tion Rac1 activation facilitated the NDV infection andthe infection led to reduction of EGAS viability Howeversubsequent Rac1 downregulation had inhibited NDV repli-cation and reduced its therapeutic efficiency thus leading toregrowth of EGAS viability at 72 hours Clearly further workhas to be done to outline the specific pathway leading toGBM cell death but NDV-Rac1 seems to be interrelated forsustainable infection in GBM

41 Ex Vivo Glioma Acute Slice (EGAS) Model Study Theex vivo model is an experiment that is performed outsideof the organism with minimum alteration to the naturalenvironment Pertaining to brain tissue the ex vivo slicemodel offers unique advantages over other in vitro or cell-culture approaches in that they largely preserve the tissuearchitecture and maintain neuronal activities with intactfunctional local synaptic circuits for long periods of time[39] Therefore the use of GBM slices from patients offergreat advantages such as using heterogeneous glioma tissuewhich is more relevant compared to homogeneous gliomacells in a cell-culture model Noticeably human tumour celllines in culture accumulate genetic alterations during serialpassaging that dramatically alter their biological behaviour[40] In contrast presence of normal astrocytes and necroticcells that features the GBM possibly becomes a drawback totargeted therapy analysis

Ideally maintaining glioma in an acute slice preparationwill provide physiologically and morphologically integratedglioma tissue for an acute infection mechanism study Theheterogeneous cells extracellular matrix (ECM) hypoxicregions high interstitial pressure and higher dose require-ments are amongst the major challenges in achieving lastingoncolytic viral infection [2] As summarised in Figure 1 weused the ex vivo model in aCSF to maintain the heteroge-neous cytoarchitecture and viability of freshly isolated humanglioma tissue to study the effects of acute oncolytic viralinfectionThe cerebrospinal fluid (CSF) is the colourless fluidfound in the ventricle system and subarachnoid space of thebrain where it maintains the chemical stability of the brainAs observed in our viability assay the relative number of livecells in the EGAS atmosphere after 7 hours in aCSF bubbledwith carbogen gas is slightly decreased but is not significantlyreduced compared to the relative number of live cells fromfreshly isolated GBM thus demonstrating that the protocolhas maintained the core viability (Figure 2) Therefore thetechnique not only permits acute testing of the antitumouragent but also allows for temperature manipulation oxygen

BioMed Research International 7

deprivation (hypoxic) conditions and higher dosages testingin the future

5 Conclusions

Acute exposure of the NDV strain V4UPM to freshly isolatedGBM slice in aCSF of ex vivo experiment had inducedsignificant but nonlasting reduction of the slice viability Geneexpression study revealed theRac1 gene downregulationThispossibly reduced the NDV proliferation and its therapeuticcapability thus leading to GBM slice regrowth ThereforeNDV-Rac1 is interrelated in sustaining NDV tropism inglioma

Conflict of Interests

All authors report no conflict of interests

Acknowledgments

The authors thank Majlis Kanser Nasional (MAKNA)Malaysia for providing financial grants and continuous sup-port for this study The authors also sincerely thank FarizanAhmad for writing assistance

References

[1] G Wollmann K Ozduman and A N van den Pol ldquoOncolyticvirus therapy for glioblastomamultiforme concepts and candi-datesrdquo Cancer Journal vol 18 no 1 pp 69ndash81 2012

[2] F J Zemp J C Corredor X Lun D A Muruve and PA Forsyth ldquoOncolytic viruses as experimental treatments formalignant gliomas using a scourge to treat a devilrdquo Cytokineand Growth Factor Reviews vol 21 no 2-3 pp 103ndash117 2010

[3] J Zhong A Paul S J Kellie and G M OrsquoNeill ldquoMesenchymalmigration as a therapeutic target in glioblastomardquo Journal ofOncology vol 2010 Article ID 430142 17 pages 2010

[4] T C Liu E Galanis and D Kirn ldquoClinical trial resultswith oncolytic virotherapy a century of promise a decade ofprogressrdquo Nature Clinical Practice Oncology vol 4 no 2 pp101ndash117 2007

[5] J N Parker D F Bauer J J Cody and J MMarkert ldquoOncolyticviral therapy ofmalignant gliomardquoNeurotherapeutics vol 6 no3 pp 558ndash569 2009

[6] K A Parato D Senger P A J Forsyth and J C Bell ldquoRecentprogress in the battle between oncolytic viruses and tumoursrdquoNature Reviews Cancer vol 5 no 12 pp 965ndash976 2005

[7] J G Sinkovics and J C Horvath ldquoNewcastle disease virus(NDV) brief history of its oncolytic strainsrdquo Journal of ClinicalVirology vol 16 no 1 pp 1ndash15 2000

[8] C Fiola B Peeters P Fournier A Arnold M Bucur andV Schirrmacher ldquoTumor selective replication of newcastledisease virus association with defects of tumor cells in antiviraldefencerdquo International Journal of Cancer vol 119 no 2 pp 328ndash338 2006

[9] S Krishnamurthy T Takimoto R A Scroggs and A PortnerldquoDifferentially regulated interferon response determines theoutcome of newcastle disease virus infection in normal andtumor cell linesrdquo Journal of Virology vol 80 no 11 pp 5145ndash5155 2006

[10] A Haseley C Alvarez-Breckenridge A R Chaudhury and BKaur ldquoAdvances in oncolytic virus therapy for gliomardquo RecentPatents on CNS Drug Discovery vol 4 no 1 pp 1ndash13 2009

[11] V Schirrmacher and P Fournier ldquoNewcastle disease virus apromising vector for viral therapy immune therapy and genetherapy of cancerrdquo Methods in Molecular Biology vol 542 pp565ndash605 2009

[12] A Phuangsab RM Lorence KWReichardM E Peeples andR J Walter ldquoNewcastle disease virus therapy of human tumorxenografts antitumor effects of local or systemic administra-tionrdquo Cancer Letters vol 172 no 1 pp 27ndash36 2001

[13] A L Pecora N Rizvi G I Cohen et al ldquoPhase I trialof intravenous administration of PV701 an oncolytic virusin patients with advanced solid cancersrdquo Journal of ClinicalOncology vol 20 no 9 pp 2251ndash2266 2002

[14] A M Alabsi S A Abu Bakar R Ali et al ldquoEffects of new-castle disease virus strains AF2240 and V4-UPM on cytolysisand apoptosis of leukemia cell linesrdquo International Journal ofMolecular Sciences vol 12 no 12 pp 8645ndash8660 2012

[15] M M Zulkifli R Ibrahim A M Ali et al ldquoNewcastlediseases virus strain V4UPM displayed oncolytic ability againstexperimental humanmalignant gliomardquoNeurological Researchvol 31 no 1 pp 3ndash10 2009

[16] O O Kanu B Hughes C Di et al ldquoGlioblastoma multiformeoncogenomics and signaling pathwaysrdquo Clinical MedicineOncology vol 2009 no 3 pp 39ndash52 2009

[17] M Nakada D Kita T Watanabe et al ldquoAberrant signalingpathways in gliomardquo Cancers vol 3 no 3 pp 3242ndash3278 2011

[18] A Y Chan S J Coniglio Y Y Chuang et al ldquoRoles of the Rac1and Rac3 GTPases in human tumor cell invasionrdquo Oncogenevol 24 no 53 pp 7821ndash7829 2005

[19] O Gjoerup J Lukas J Bartek and B M Willumsen ldquoRac andCdc42 are potent stimulators of E2F-dependent transcriptioncapable of promoting retinoblastoma susceptibility gene prod-uct hyperphosphorylationrdquoThe Journal of Biological Chemistryvol 273 no 30 pp 18812ndash18818 1998

[20] D L Senger C Tudan M C Guiot et al ldquoSuppression of Racactivity induces apoptosis of human glioma cells but not normalhuman astrocytesrdquoCancer Research vol 62 no 7 pp 2131ndash21402002

[21] P Villalonga R M Guasch K Riento and A J Ridley ldquoRhoEinhibits cell cycle progression and Ras-induced transforma-tionrdquo Molecular and Cellular Biology vol 24 no 18 pp 7829ndash7840 2004

[22] D Sun D Xu and B Zhang ldquoRac signaling in tumorigenesisand as target for anticancer drug developmentrdquoDrug ResistanceUpdates vol 9 no 6 pp 274ndash287 2006

[23] B Everts and H G van der Poel ldquoReplication-selectiveoncolytic viruses in the treatment of cancerrdquo Cancer GeneTherapy vol 12 no 2 pp 141ndash161 2005

[24] J Puhlmann F Puehler D Mumberg P Boukamp and RBeier ldquoRac1 is required for oncolytic NDV replication in humancancer cells and establishes a link between tumorigenesis andsensitivity to oncolytic virusrdquo Oncogene vol 29 no 15 pp2205ndash2216 2010

[25] L W McGinnes H Pantua J Reitter and T G MorrisonldquoUNIT 15F2 newcastle disease virus propagation quantifica-tion and storagerdquo Current Protocols in Microbiology 2006

[26] U Musshoff R Kohling A Lucke et al ldquoVigabatrin reducesepileptiform activity in brain slices from pharmacoresistantepilepsy patientsrdquo European Journal of Pharmacology vol 401no 2 pp 167ndash172 2000

8 BioMed Research International

[27] A Bordey and H Sontheimer ldquoElectrophysiological propertiesof human astrocytic tumor cells in situ enigma of spiking glialcellsrdquo Journal of Neurophysiology vol 79 no 5 pp 2782ndash27931998

[28] J S Diallo D Roy H Abdelbary N De Silva and J C BellldquoEx vivo infection of live tissue with oncolytic virusesrdquo Journalof Visualized Experiments no 52 Article ID e2854 2011

[29] K L Chaichana V Capilla-Gonzalez O Gonzalez-Perez etal ldquoPreservation of glial cytoarchitecture from ex vivo humantumor and non-tumor cerebral cortical explants a humanmodel to study neurological diseasesrdquo Journal of NeuroscienceMethods vol 164 no 2 pp 261ndash270 2007

[30] J Xu D Sampath F F Lang et al ldquoVorinostat modulates cellcycle regulatory proteins in glioma cells and human glioma sliceculturesrdquo Journal of Neuro-Oncology vol 105 no 2 pp 241ndash2512011

[31] V M Paulino Z Yang J Kloss et al ldquoTROY (TNFRSF19) isoverexpressed in advanced glial tumors and promotes glioblas-toma cell invasion via Pyk2-Rac1 signalingrdquo Molecular CancerResearch vol 8 no 11 pp 1558ndash1567 2010

[32] G Fulci and B Passer ldquoAnalysis of HSV oncolytic virotherapyin organotypic culturesrdquoMethods inMolecular Biology vol 542pp 75ndash86 2009

[33] V P Gopinath G D Raj A Raja K Kumanan and SElankumaran ldquoRapid detection of newcastle disease virusreplication in embryonated chicken eggs using quantitative realtime polymerase chain reactionrdquo Journal of VirologicalMethodsvol 171 no 1 pp 98ndash101 2011

[34] N Wakamatsu D J King B S Seal and C C Brown ldquoDetec-tion of newcastle disease virus RNA by reverse transcription-polymerase chain reaction using formalin-fixed paraffin-embedded tissue and comparison with immunohistochemistryand in situ hybridizationrdquo Journal of Veterinary DiagnosticInvestigation vol 19 no 4 pp 396ndash400 2007

[35] MWPfafflGWHorgan andLDempfle ldquoRelative expressionsoftware tool (REST) for group-wise comparison and statisticalanalysis of relative expression results in real-time PCRrdquoNucleicAcids Research vol 30 no 9 article e36 2002

[36] V Schirrmacher CHaas R Bonifer T Ahlert RGerhards andC Ertel ldquoHuman tumor cell modification by virus infection anefficient and safeway to produce cancer vaccinewith pleiotropicimmune stimulatory properties when using newcastle diseasevirusrdquo Gene Therapy vol 6 no 1 pp 63ndash73 1999

[37] R M Lorence B B Katubig K W Reichard et al ldquoCompleteregression of human fibrosarcoma xenografts after local new-castle disease virus therapyrdquo Cancer Research vol 54 no 23pp 6017ndash6021 1994

[38] K Pruitt and C J Der ldquoRas and Rho regulation of the cell cycleand oncogenesisrdquo Cancer Letters vol 171 no 1 pp 1ndash10 2001

[39] L Lossi S Alasia C Salio and A Merighi ldquoCell deathand proliferation in acute slices and organotypic cultures ofmammalian CNSrdquo Progress in Neurobiology vol 88 no 4 pp221ndash245 2009

[40] X Li J W S Law and A Y W Lee ldquoSemaphorin 5A andplexin-B3 regulate human glioma cell motility andmorphologythrough Rac1 and the actin cytoskeletonrdquo Oncogene vol 31 no5 pp 595ndash610 2012

6 BioMed Research International

300bp

75bp

50bp

M 1 2 3 4 5 6 7 8

(a)

0

1

2

EGAS mock infection EGAS V4UPM 512HAUTreatment group

minus4

minus3

minus2

minus1

lowastlowastlowast

Relat

ive e

xpre

ssio

n ra

tio (l

og 2)

Rac1Ras

(b)

Figure 4 (a) SybrGreen-stained agarose gel illustrating the PCRproducts of human ACTB Rac1 V4UPM-HN and Ras genes (M)represents the molecular weight of the marker (1) Human ACTB171 bp (2) human ACTB nontemplate control (NTC) (3) Rac1 gene125 bp (4) Rac1 NTC (5) V4UPM-HN gene 79 bp (6) V4UPM-HNNTC (7) Ras gene 70 bp and (8) Ras NTC For the V4UPM-HNgene RNA was extracted from the infected EGAS indicating theexistence of viral gene in the EGAS tissue (b) Analysis of qRT-PCRfor relative expression of mRNA transcripts is determined by therelative expression ratio method via REST-MCS and the Pair WiseFixed Reallocation Randomisation Test

effector of growth factor receptors such as EGFR and isamplified in 30 of GBM [17] In addition a study hasshown that NDV preferentially replicate in Rac1-expressingcell We therefore evaluated the EGAS samples for Ras andRac1 gene expression Our findings showed that Ras wasslightly downregulated in both treated and untreated groupsbut are not statistically significant as compared to fresh GBMsamples

In Rac1 gene analysis the gene was significantly down-regulated in the V4UPM-treated group as compared to thecontrol group Our screening on NDV effects in GBM cellline by western blot indicated Rac1 activation at 3 hours afterinfection (data not shown) In this regards Puhlmann et alhad previously established a link between tumourigenesisand sensitivity to oncolytic virus via Rac1 signalling NDVinfection preferentially replicate in Rac1-overexpressing cellsand inhibition of Rac1 protein also blocked the growth of

the skin carcinoma mutant cell line [24] In cancer biologyaberrant levels of Rac1 signalling has been implicated inmany aspects such as uncontrolled proliferation [21 22 38]as well as growth transformation invasion and metastasis[18] Specific Rac1 gene mutations are rarely detected inGBM but deregulated amplification is commonly found[22] Consequently Rac1 appears to be an ideal target fordeveloping approaches to block glioblastoma [3] Earlierreport had shown that suppression of Rac1 induced apoptosisin human glioma cell but not in normal astrocytes [20]

Therefore findings have pointed our study to this direc-tion Rac1 activation facilitated the NDV infection andthe infection led to reduction of EGAS viability Howeversubsequent Rac1 downregulation had inhibited NDV repli-cation and reduced its therapeutic efficiency thus leading toregrowth of EGAS viability at 72 hours Clearly further workhas to be done to outline the specific pathway leading toGBM cell death but NDV-Rac1 seems to be interrelated forsustainable infection in GBM

41 Ex Vivo Glioma Acute Slice (EGAS) Model Study Theex vivo model is an experiment that is performed outsideof the organism with minimum alteration to the naturalenvironment Pertaining to brain tissue the ex vivo slicemodel offers unique advantages over other in vitro or cell-culture approaches in that they largely preserve the tissuearchitecture and maintain neuronal activities with intactfunctional local synaptic circuits for long periods of time[39] Therefore the use of GBM slices from patients offergreat advantages such as using heterogeneous glioma tissuewhich is more relevant compared to homogeneous gliomacells in a cell-culture model Noticeably human tumour celllines in culture accumulate genetic alterations during serialpassaging that dramatically alter their biological behaviour[40] In contrast presence of normal astrocytes and necroticcells that features the GBM possibly becomes a drawback totargeted therapy analysis

Ideally maintaining glioma in an acute slice preparationwill provide physiologically and morphologically integratedglioma tissue for an acute infection mechanism study Theheterogeneous cells extracellular matrix (ECM) hypoxicregions high interstitial pressure and higher dose require-ments are amongst the major challenges in achieving lastingoncolytic viral infection [2] As summarised in Figure 1 weused the ex vivo model in aCSF to maintain the heteroge-neous cytoarchitecture and viability of freshly isolated humanglioma tissue to study the effects of acute oncolytic viralinfectionThe cerebrospinal fluid (CSF) is the colourless fluidfound in the ventricle system and subarachnoid space of thebrain where it maintains the chemical stability of the brainAs observed in our viability assay the relative number of livecells in the EGAS atmosphere after 7 hours in aCSF bubbledwith carbogen gas is slightly decreased but is not significantlyreduced compared to the relative number of live cells fromfreshly isolated GBM thus demonstrating that the protocolhas maintained the core viability (Figure 2) Therefore thetechnique not only permits acute testing of the antitumouragent but also allows for temperature manipulation oxygen

BioMed Research International 7

deprivation (hypoxic) conditions and higher dosages testingin the future

5 Conclusions

Acute exposure of the NDV strain V4UPM to freshly isolatedGBM slice in aCSF of ex vivo experiment had inducedsignificant but nonlasting reduction of the slice viability Geneexpression study revealed theRac1 gene downregulationThispossibly reduced the NDV proliferation and its therapeuticcapability thus leading to GBM slice regrowth ThereforeNDV-Rac1 is interrelated in sustaining NDV tropism inglioma

Conflict of Interests

All authors report no conflict of interests

Acknowledgments

The authors thank Majlis Kanser Nasional (MAKNA)Malaysia for providing financial grants and continuous sup-port for this study The authors also sincerely thank FarizanAhmad for writing assistance

References

[1] G Wollmann K Ozduman and A N van den Pol ldquoOncolyticvirus therapy for glioblastomamultiforme concepts and candi-datesrdquo Cancer Journal vol 18 no 1 pp 69ndash81 2012

[2] F J Zemp J C Corredor X Lun D A Muruve and PA Forsyth ldquoOncolytic viruses as experimental treatments formalignant gliomas using a scourge to treat a devilrdquo Cytokineand Growth Factor Reviews vol 21 no 2-3 pp 103ndash117 2010

[3] J Zhong A Paul S J Kellie and G M OrsquoNeill ldquoMesenchymalmigration as a therapeutic target in glioblastomardquo Journal ofOncology vol 2010 Article ID 430142 17 pages 2010

[4] T C Liu E Galanis and D Kirn ldquoClinical trial resultswith oncolytic virotherapy a century of promise a decade ofprogressrdquo Nature Clinical Practice Oncology vol 4 no 2 pp101ndash117 2007

[5] J N Parker D F Bauer J J Cody and J MMarkert ldquoOncolyticviral therapy ofmalignant gliomardquoNeurotherapeutics vol 6 no3 pp 558ndash569 2009

[6] K A Parato D Senger P A J Forsyth and J C Bell ldquoRecentprogress in the battle between oncolytic viruses and tumoursrdquoNature Reviews Cancer vol 5 no 12 pp 965ndash976 2005

[7] J G Sinkovics and J C Horvath ldquoNewcastle disease virus(NDV) brief history of its oncolytic strainsrdquo Journal of ClinicalVirology vol 16 no 1 pp 1ndash15 2000

[8] C Fiola B Peeters P Fournier A Arnold M Bucur andV Schirrmacher ldquoTumor selective replication of newcastledisease virus association with defects of tumor cells in antiviraldefencerdquo International Journal of Cancer vol 119 no 2 pp 328ndash338 2006

[9] S Krishnamurthy T Takimoto R A Scroggs and A PortnerldquoDifferentially regulated interferon response determines theoutcome of newcastle disease virus infection in normal andtumor cell linesrdquo Journal of Virology vol 80 no 11 pp 5145ndash5155 2006

[10] A Haseley C Alvarez-Breckenridge A R Chaudhury and BKaur ldquoAdvances in oncolytic virus therapy for gliomardquo RecentPatents on CNS Drug Discovery vol 4 no 1 pp 1ndash13 2009

[11] V Schirrmacher and P Fournier ldquoNewcastle disease virus apromising vector for viral therapy immune therapy and genetherapy of cancerrdquo Methods in Molecular Biology vol 542 pp565ndash605 2009

[12] A Phuangsab RM Lorence KWReichardM E Peeples andR J Walter ldquoNewcastle disease virus therapy of human tumorxenografts antitumor effects of local or systemic administra-tionrdquo Cancer Letters vol 172 no 1 pp 27ndash36 2001

[13] A L Pecora N Rizvi G I Cohen et al ldquoPhase I trialof intravenous administration of PV701 an oncolytic virusin patients with advanced solid cancersrdquo Journal of ClinicalOncology vol 20 no 9 pp 2251ndash2266 2002

[14] A M Alabsi S A Abu Bakar R Ali et al ldquoEffects of new-castle disease virus strains AF2240 and V4-UPM on cytolysisand apoptosis of leukemia cell linesrdquo International Journal ofMolecular Sciences vol 12 no 12 pp 8645ndash8660 2012

[15] M M Zulkifli R Ibrahim A M Ali et al ldquoNewcastlediseases virus strain V4UPM displayed oncolytic ability againstexperimental humanmalignant gliomardquoNeurological Researchvol 31 no 1 pp 3ndash10 2009

[16] O O Kanu B Hughes C Di et al ldquoGlioblastoma multiformeoncogenomics and signaling pathwaysrdquo Clinical MedicineOncology vol 2009 no 3 pp 39ndash52 2009

[17] M Nakada D Kita T Watanabe et al ldquoAberrant signalingpathways in gliomardquo Cancers vol 3 no 3 pp 3242ndash3278 2011

[18] A Y Chan S J Coniglio Y Y Chuang et al ldquoRoles of the Rac1and Rac3 GTPases in human tumor cell invasionrdquo Oncogenevol 24 no 53 pp 7821ndash7829 2005

[19] O Gjoerup J Lukas J Bartek and B M Willumsen ldquoRac andCdc42 are potent stimulators of E2F-dependent transcriptioncapable of promoting retinoblastoma susceptibility gene prod-uct hyperphosphorylationrdquoThe Journal of Biological Chemistryvol 273 no 30 pp 18812ndash18818 1998

[20] D L Senger C Tudan M C Guiot et al ldquoSuppression of Racactivity induces apoptosis of human glioma cells but not normalhuman astrocytesrdquoCancer Research vol 62 no 7 pp 2131ndash21402002

[21] P Villalonga R M Guasch K Riento and A J Ridley ldquoRhoEinhibits cell cycle progression and Ras-induced transforma-tionrdquo Molecular and Cellular Biology vol 24 no 18 pp 7829ndash7840 2004

[22] D Sun D Xu and B Zhang ldquoRac signaling in tumorigenesisand as target for anticancer drug developmentrdquoDrug ResistanceUpdates vol 9 no 6 pp 274ndash287 2006

[23] B Everts and H G van der Poel ldquoReplication-selectiveoncolytic viruses in the treatment of cancerrdquo Cancer GeneTherapy vol 12 no 2 pp 141ndash161 2005

[24] J Puhlmann F Puehler D Mumberg P Boukamp and RBeier ldquoRac1 is required for oncolytic NDV replication in humancancer cells and establishes a link between tumorigenesis andsensitivity to oncolytic virusrdquo Oncogene vol 29 no 15 pp2205ndash2216 2010

[25] L W McGinnes H Pantua J Reitter and T G MorrisonldquoUNIT 15F2 newcastle disease virus propagation quantifica-tion and storagerdquo Current Protocols in Microbiology 2006

[26] U Musshoff R Kohling A Lucke et al ldquoVigabatrin reducesepileptiform activity in brain slices from pharmacoresistantepilepsy patientsrdquo European Journal of Pharmacology vol 401no 2 pp 167ndash172 2000

8 BioMed Research International

[27] A Bordey and H Sontheimer ldquoElectrophysiological propertiesof human astrocytic tumor cells in situ enigma of spiking glialcellsrdquo Journal of Neurophysiology vol 79 no 5 pp 2782ndash27931998

[28] J S Diallo D Roy H Abdelbary N De Silva and J C BellldquoEx vivo infection of live tissue with oncolytic virusesrdquo Journalof Visualized Experiments no 52 Article ID e2854 2011

[29] K L Chaichana V Capilla-Gonzalez O Gonzalez-Perez etal ldquoPreservation of glial cytoarchitecture from ex vivo humantumor and non-tumor cerebral cortical explants a humanmodel to study neurological diseasesrdquo Journal of NeuroscienceMethods vol 164 no 2 pp 261ndash270 2007

[30] J Xu D Sampath F F Lang et al ldquoVorinostat modulates cellcycle regulatory proteins in glioma cells and human glioma sliceculturesrdquo Journal of Neuro-Oncology vol 105 no 2 pp 241ndash2512011

[31] V M Paulino Z Yang J Kloss et al ldquoTROY (TNFRSF19) isoverexpressed in advanced glial tumors and promotes glioblas-toma cell invasion via Pyk2-Rac1 signalingrdquo Molecular CancerResearch vol 8 no 11 pp 1558ndash1567 2010

[32] G Fulci and B Passer ldquoAnalysis of HSV oncolytic virotherapyin organotypic culturesrdquoMethods inMolecular Biology vol 542pp 75ndash86 2009

[33] V P Gopinath G D Raj A Raja K Kumanan and SElankumaran ldquoRapid detection of newcastle disease virusreplication in embryonated chicken eggs using quantitative realtime polymerase chain reactionrdquo Journal of VirologicalMethodsvol 171 no 1 pp 98ndash101 2011

[34] N Wakamatsu D J King B S Seal and C C Brown ldquoDetec-tion of newcastle disease virus RNA by reverse transcription-polymerase chain reaction using formalin-fixed paraffin-embedded tissue and comparison with immunohistochemistryand in situ hybridizationrdquo Journal of Veterinary DiagnosticInvestigation vol 19 no 4 pp 396ndash400 2007

[35] MWPfafflGWHorgan andLDempfle ldquoRelative expressionsoftware tool (REST) for group-wise comparison and statisticalanalysis of relative expression results in real-time PCRrdquoNucleicAcids Research vol 30 no 9 article e36 2002

[36] V Schirrmacher CHaas R Bonifer T Ahlert RGerhards andC Ertel ldquoHuman tumor cell modification by virus infection anefficient and safeway to produce cancer vaccinewith pleiotropicimmune stimulatory properties when using newcastle diseasevirusrdquo Gene Therapy vol 6 no 1 pp 63ndash73 1999

[37] R M Lorence B B Katubig K W Reichard et al ldquoCompleteregression of human fibrosarcoma xenografts after local new-castle disease virus therapyrdquo Cancer Research vol 54 no 23pp 6017ndash6021 1994

[38] K Pruitt and C J Der ldquoRas and Rho regulation of the cell cycleand oncogenesisrdquo Cancer Letters vol 171 no 1 pp 1ndash10 2001

[39] L Lossi S Alasia C Salio and A Merighi ldquoCell deathand proliferation in acute slices and organotypic cultures ofmammalian CNSrdquo Progress in Neurobiology vol 88 no 4 pp221ndash245 2009

[40] X Li J W S Law and A Y W Lee ldquoSemaphorin 5A andplexin-B3 regulate human glioma cell motility andmorphologythrough Rac1 and the actin cytoskeletonrdquo Oncogene vol 31 no5 pp 595ndash610 2012

BioMed Research International 7

deprivation (hypoxic) conditions and higher dosages testingin the future

5 Conclusions

Acute exposure of the NDV strain V4UPM to freshly isolatedGBM slice in aCSF of ex vivo experiment had inducedsignificant but nonlasting reduction of the slice viability Geneexpression study revealed theRac1 gene downregulationThispossibly reduced the NDV proliferation and its therapeuticcapability thus leading to GBM slice regrowth ThereforeNDV-Rac1 is interrelated in sustaining NDV tropism inglioma

Conflict of Interests

All authors report no conflict of interests

Acknowledgments

The authors thank Majlis Kanser Nasional (MAKNA)Malaysia for providing financial grants and continuous sup-port for this study The authors also sincerely thank FarizanAhmad for writing assistance

References

[1] G Wollmann K Ozduman and A N van den Pol ldquoOncolyticvirus therapy for glioblastomamultiforme concepts and candi-datesrdquo Cancer Journal vol 18 no 1 pp 69ndash81 2012

[2] F J Zemp J C Corredor X Lun D A Muruve and PA Forsyth ldquoOncolytic viruses as experimental treatments formalignant gliomas using a scourge to treat a devilrdquo Cytokineand Growth Factor Reviews vol 21 no 2-3 pp 103ndash117 2010

[3] J Zhong A Paul S J Kellie and G M OrsquoNeill ldquoMesenchymalmigration as a therapeutic target in glioblastomardquo Journal ofOncology vol 2010 Article ID 430142 17 pages 2010

[4] T C Liu E Galanis and D Kirn ldquoClinical trial resultswith oncolytic virotherapy a century of promise a decade ofprogressrdquo Nature Clinical Practice Oncology vol 4 no 2 pp101ndash117 2007

[5] J N Parker D F Bauer J J Cody and J MMarkert ldquoOncolyticviral therapy ofmalignant gliomardquoNeurotherapeutics vol 6 no3 pp 558ndash569 2009

[6] K A Parato D Senger P A J Forsyth and J C Bell ldquoRecentprogress in the battle between oncolytic viruses and tumoursrdquoNature Reviews Cancer vol 5 no 12 pp 965ndash976 2005

[7] J G Sinkovics and J C Horvath ldquoNewcastle disease virus(NDV) brief history of its oncolytic strainsrdquo Journal of ClinicalVirology vol 16 no 1 pp 1ndash15 2000

[8] C Fiola B Peeters P Fournier A Arnold M Bucur andV Schirrmacher ldquoTumor selective replication of newcastledisease virus association with defects of tumor cells in antiviraldefencerdquo International Journal of Cancer vol 119 no 2 pp 328ndash338 2006

[9] S Krishnamurthy T Takimoto R A Scroggs and A PortnerldquoDifferentially regulated interferon response determines theoutcome of newcastle disease virus infection in normal andtumor cell linesrdquo Journal of Virology vol 80 no 11 pp 5145ndash5155 2006

[10] A Haseley C Alvarez-Breckenridge A R Chaudhury and BKaur ldquoAdvances in oncolytic virus therapy for gliomardquo RecentPatents on CNS Drug Discovery vol 4 no 1 pp 1ndash13 2009

[11] V Schirrmacher and P Fournier ldquoNewcastle disease virus apromising vector for viral therapy immune therapy and genetherapy of cancerrdquo Methods in Molecular Biology vol 542 pp565ndash605 2009

[12] A Phuangsab RM Lorence KWReichardM E Peeples andR J Walter ldquoNewcastle disease virus therapy of human tumorxenografts antitumor effects of local or systemic administra-tionrdquo Cancer Letters vol 172 no 1 pp 27ndash36 2001

[13] A L Pecora N Rizvi G I Cohen et al ldquoPhase I trialof intravenous administration of PV701 an oncolytic virusin patients with advanced solid cancersrdquo Journal of ClinicalOncology vol 20 no 9 pp 2251ndash2266 2002

[14] A M Alabsi S A Abu Bakar R Ali et al ldquoEffects of new-castle disease virus strains AF2240 and V4-UPM on cytolysisand apoptosis of leukemia cell linesrdquo International Journal ofMolecular Sciences vol 12 no 12 pp 8645ndash8660 2012

[15] M M Zulkifli R Ibrahim A M Ali et al ldquoNewcastlediseases virus strain V4UPM displayed oncolytic ability againstexperimental humanmalignant gliomardquoNeurological Researchvol 31 no 1 pp 3ndash10 2009

[16] O O Kanu B Hughes C Di et al ldquoGlioblastoma multiformeoncogenomics and signaling pathwaysrdquo Clinical MedicineOncology vol 2009 no 3 pp 39ndash52 2009

[17] M Nakada D Kita T Watanabe et al ldquoAberrant signalingpathways in gliomardquo Cancers vol 3 no 3 pp 3242ndash3278 2011

[18] A Y Chan S J Coniglio Y Y Chuang et al ldquoRoles of the Rac1and Rac3 GTPases in human tumor cell invasionrdquo Oncogenevol 24 no 53 pp 7821ndash7829 2005

[19] O Gjoerup J Lukas J Bartek and B M Willumsen ldquoRac andCdc42 are potent stimulators of E2F-dependent transcriptioncapable of promoting retinoblastoma susceptibility gene prod-uct hyperphosphorylationrdquoThe Journal of Biological Chemistryvol 273 no 30 pp 18812ndash18818 1998

[20] D L Senger C Tudan M C Guiot et al ldquoSuppression of Racactivity induces apoptosis of human glioma cells but not normalhuman astrocytesrdquoCancer Research vol 62 no 7 pp 2131ndash21402002

[21] P Villalonga R M Guasch K Riento and A J Ridley ldquoRhoEinhibits cell cycle progression and Ras-induced transforma-tionrdquo Molecular and Cellular Biology vol 24 no 18 pp 7829ndash7840 2004

[22] D Sun D Xu and B Zhang ldquoRac signaling in tumorigenesisand as target for anticancer drug developmentrdquoDrug ResistanceUpdates vol 9 no 6 pp 274ndash287 2006

[23] B Everts and H G van der Poel ldquoReplication-selectiveoncolytic viruses in the treatment of cancerrdquo Cancer GeneTherapy vol 12 no 2 pp 141ndash161 2005

[24] J Puhlmann F Puehler D Mumberg P Boukamp and RBeier ldquoRac1 is required for oncolytic NDV replication in humancancer cells and establishes a link between tumorigenesis andsensitivity to oncolytic virusrdquo Oncogene vol 29 no 15 pp2205ndash2216 2010

[25] L W McGinnes H Pantua J Reitter and T G MorrisonldquoUNIT 15F2 newcastle disease virus propagation quantifica-tion and storagerdquo Current Protocols in Microbiology 2006

[26] U Musshoff R Kohling A Lucke et al ldquoVigabatrin reducesepileptiform activity in brain slices from pharmacoresistantepilepsy patientsrdquo European Journal of Pharmacology vol 401no 2 pp 167ndash172 2000

8 BioMed Research International

[27] A Bordey and H Sontheimer ldquoElectrophysiological propertiesof human astrocytic tumor cells in situ enigma of spiking glialcellsrdquo Journal of Neurophysiology vol 79 no 5 pp 2782ndash27931998

[28] J S Diallo D Roy H Abdelbary N De Silva and J C BellldquoEx vivo infection of live tissue with oncolytic virusesrdquo Journalof Visualized Experiments no 52 Article ID e2854 2011

[29] K L Chaichana V Capilla-Gonzalez O Gonzalez-Perez etal ldquoPreservation of glial cytoarchitecture from ex vivo humantumor and non-tumor cerebral cortical explants a humanmodel to study neurological diseasesrdquo Journal of NeuroscienceMethods vol 164 no 2 pp 261ndash270 2007

[30] J Xu D Sampath F F Lang et al ldquoVorinostat modulates cellcycle regulatory proteins in glioma cells and human glioma sliceculturesrdquo Journal of Neuro-Oncology vol 105 no 2 pp 241ndash2512011

[31] V M Paulino Z Yang J Kloss et al ldquoTROY (TNFRSF19) isoverexpressed in advanced glial tumors and promotes glioblas-toma cell invasion via Pyk2-Rac1 signalingrdquo Molecular CancerResearch vol 8 no 11 pp 1558ndash1567 2010

[32] G Fulci and B Passer ldquoAnalysis of HSV oncolytic virotherapyin organotypic culturesrdquoMethods inMolecular Biology vol 542pp 75ndash86 2009

[33] V P Gopinath G D Raj A Raja K Kumanan and SElankumaran ldquoRapid detection of newcastle disease virusreplication in embryonated chicken eggs using quantitative realtime polymerase chain reactionrdquo Journal of VirologicalMethodsvol 171 no 1 pp 98ndash101 2011

[34] N Wakamatsu D J King B S Seal and C C Brown ldquoDetec-tion of newcastle disease virus RNA by reverse transcription-polymerase chain reaction using formalin-fixed paraffin-embedded tissue and comparison with immunohistochemistryand in situ hybridizationrdquo Journal of Veterinary DiagnosticInvestigation vol 19 no 4 pp 396ndash400 2007

[35] MWPfafflGWHorgan andLDempfle ldquoRelative expressionsoftware tool (REST) for group-wise comparison and statisticalanalysis of relative expression results in real-time PCRrdquoNucleicAcids Research vol 30 no 9 article e36 2002

[36] V Schirrmacher CHaas R Bonifer T Ahlert RGerhards andC Ertel ldquoHuman tumor cell modification by virus infection anefficient and safeway to produce cancer vaccinewith pleiotropicimmune stimulatory properties when using newcastle diseasevirusrdquo Gene Therapy vol 6 no 1 pp 63ndash73 1999

[37] R M Lorence B B Katubig K W Reichard et al ldquoCompleteregression of human fibrosarcoma xenografts after local new-castle disease virus therapyrdquo Cancer Research vol 54 no 23pp 6017ndash6021 1994

[38] K Pruitt and C J Der ldquoRas and Rho regulation of the cell cycleand oncogenesisrdquo Cancer Letters vol 171 no 1 pp 1ndash10 2001

[39] L Lossi S Alasia C Salio and A Merighi ldquoCell deathand proliferation in acute slices and organotypic cultures ofmammalian CNSrdquo Progress in Neurobiology vol 88 no 4 pp221ndash245 2009

[40] X Li J W S Law and A Y W Lee ldquoSemaphorin 5A andplexin-B3 regulate human glioma cell motility andmorphologythrough Rac1 and the actin cytoskeletonrdquo Oncogene vol 31 no5 pp 595ndash610 2012

8 BioMed Research International

[27] A Bordey and H Sontheimer ldquoElectrophysiological propertiesof human astrocytic tumor cells in situ enigma of spiking glialcellsrdquo Journal of Neurophysiology vol 79 no 5 pp 2782ndash27931998

[28] J S Diallo D Roy H Abdelbary N De Silva and J C BellldquoEx vivo infection of live tissue with oncolytic virusesrdquo Journalof Visualized Experiments no 52 Article ID e2854 2011

[29] K L Chaichana V Capilla-Gonzalez O Gonzalez-Perez etal ldquoPreservation of glial cytoarchitecture from ex vivo humantumor and non-tumor cerebral cortical explants a humanmodel to study neurological diseasesrdquo Journal of NeuroscienceMethods vol 164 no 2 pp 261ndash270 2007

[30] J Xu D Sampath F F Lang et al ldquoVorinostat modulates cellcycle regulatory proteins in glioma cells and human glioma sliceculturesrdquo Journal of Neuro-Oncology vol 105 no 2 pp 241ndash2512011

[31] V M Paulino Z Yang J Kloss et al ldquoTROY (TNFRSF19) isoverexpressed in advanced glial tumors and promotes glioblas-toma cell invasion via Pyk2-Rac1 signalingrdquo Molecular CancerResearch vol 8 no 11 pp 1558ndash1567 2010

[32] G Fulci and B Passer ldquoAnalysis of HSV oncolytic virotherapyin organotypic culturesrdquoMethods inMolecular Biology vol 542pp 75ndash86 2009

[33] V P Gopinath G D Raj A Raja K Kumanan and SElankumaran ldquoRapid detection of newcastle disease virusreplication in embryonated chicken eggs using quantitative realtime polymerase chain reactionrdquo Journal of VirologicalMethodsvol 171 no 1 pp 98ndash101 2011

[34] N Wakamatsu D J King B S Seal and C C Brown ldquoDetec-tion of newcastle disease virus RNA by reverse transcription-polymerase chain reaction using formalin-fixed paraffin-embedded tissue and comparison with immunohistochemistryand in situ hybridizationrdquo Journal of Veterinary DiagnosticInvestigation vol 19 no 4 pp 396ndash400 2007

[35] MWPfafflGWHorgan andLDempfle ldquoRelative expressionsoftware tool (REST) for group-wise comparison and statisticalanalysis of relative expression results in real-time PCRrdquoNucleicAcids Research vol 30 no 9 article e36 2002

[36] V Schirrmacher CHaas R Bonifer T Ahlert RGerhards andC Ertel ldquoHuman tumor cell modification by virus infection anefficient and safeway to produce cancer vaccinewith pleiotropicimmune stimulatory properties when using newcastle diseasevirusrdquo Gene Therapy vol 6 no 1 pp 63ndash73 1999

[37] R M Lorence B B Katubig K W Reichard et al ldquoCompleteregression of human fibrosarcoma xenografts after local new-castle disease virus therapyrdquo Cancer Research vol 54 no 23pp 6017ndash6021 1994

[38] K Pruitt and C J Der ldquoRas and Rho regulation of the cell cycleand oncogenesisrdquo Cancer Letters vol 171 no 1 pp 1ndash10 2001

[39] L Lossi S Alasia C Salio and A Merighi ldquoCell deathand proliferation in acute slices and organotypic cultures ofmammalian CNSrdquo Progress in Neurobiology vol 88 no 4 pp221ndash245 2009

[40] X Li J W S Law and A Y W Lee ldquoSemaphorin 5A andplexin-B3 regulate human glioma cell motility andmorphologythrough Rac1 and the actin cytoskeletonrdquo Oncogene vol 31 no5 pp 595ndash610 2012