Research Article Carbapenemase Genes among Multidrug ...

Research ArticleCarbapenemase Genes among MultidrugResistant Gram Negative Clinical Isolates froma Tertiary Hospital in Mwanza Tanzania

Martha F Mushi12 Stephen E Mshana1 Can Imirzalioglu34 and Freddie Bwanga25

1 Department of Microbiology Catholic University of Health and Allied Sciences PO Box 1464 Mwanza Tanzania2Department of Medical Microbiology School of Biomedical Sciences Makerere University College of Health SciencesPO Box 7072 Kampala Uganda

3 Institute of Medical Microbiology Justus-Liebig University Schubertstraszlige 81 35392 Giessen Germany4German Centre for Infection Research (DZIF) Partner Site Giessen-Marburg-Langen Campus Giessen Germany5MBN Clinical Laboratories Plot 28 Nakasero Road Kampala Uganda

Correspondence should be addressed to Martha F Mushi marthamushiyahoocom

Received 5 November 2013 Revised 30 December 2013 Accepted 16 January 2014 Published 24 February 2014

Academic Editor Branka Bedenic

Copyright copy 2014 Martha F Mushi et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

The burden of antimicrobial resistance (AMR) is rapidly growing across antibiotic classes with increased detection of isolatesresistant to carbapenems Data on the prevalence of carbapenem resistance in developing countries is limited therefore in thisstudy we determined the prevalence of carbapenemase genes among multidrug resistant gram negative bacteria (MDR-GNB)isolated from clinical specimens in a tertiary hospital in Mwanza Tanzania A total of 227 MDR-GNB isolates were analyzed forcarbapenem resistance genes For each isolate five different PCR assays were performed allowing for the detection of the majorcarbapenemase genes including those encoding the VIM- IMP- and NDM-type metallo-beta-lactamases the class A KPC-typecarbapenemases and the class D OXA-48 enzyme Of 227 isolates 80 (35) were positive for one or more carbapenemase geneIMP-types were the most predominant gene followed by VIM in 49 (2159) and 28 (12) isolates respectively Carbapenemasegenes were most detected in K pneumoniae 24 (11) followed by P aeruginosa 23 (10) and E coli with 19 isolates (8) We havedemonstrated for the first time a high prevalence of MDR-GNB clinical isolates having carbapenem resistance genes in TanzaniaWe recommend routine testing for carbapenem resistance among the MDR-GNB particularly in systemic infections

1 Introduction

Carbapenem antibiotics have been used as the last resort sal-vage treatment for infections caused bymultidrug resistance-gram negative bacteria (MDR-GNB) [1] that is gram nega-tive bacteria resistant to at least three of the following antimi-crobials ampicillin augmentin ceftazidime ciprofloxacingentamicin andor trimethoprim-sulfamethoxazole (SXT)[2] Thus resistance to carbapenems becomes a real threat tothe survival of patients with infections caused byMDR-GNBand the overall mortality in such infections has been reportedto be up to 50 [3 4]

Resistance to carbapenems among the MDR-GNB ismostly due to the production of carbapenemases which

are 120573-lactamases with capacity to hydrolyze not only thecarbapenems themselves but also all the other beta lactamagents [5] Some of these carbapenemases include veron inte-gronmetallo-beta-lactamases imipenemaseKlebsiella pneu-moniae carbapenemases oxacillinase-48 and New Delhimetallo-beta-lactamase 1 which are encoded by what istermed carbapenem resistance determining genes (CRDG)119887119897119886VIM 119887119897119886IMP 119887119897119886KPC 119887119897119886OXA-48 and 119887119897119886NDM respectively [6]

Recently increasing resistance to carbapenems in healthcare associated infections has been reported worldwide [1 7]Studies in New York City found 39 of patients with fecalcolonization of KPC producing K pneumoniae [3] In Africadata on the prevalence and distribution of carbapenem

Hindawi Publishing CorporationBioMed Research InternationalVolume 2014 Article ID 303104 6 pageshttpdxdoiorg1011552014303104

2 BioMed Research International

Table 1 Primer sets for amplification of carbapenem resistance determine genes (16)

Gene Primer sequence (51015840 rarr 31015840) TM (∘C) Amplicons size (bp)

bla-VIMForward GATGGTGTTTGGTCGCATAReverse CGAATGCGCAGCACCAG

545576 390

bla-KPCForward CATTCAAGGGCTTTCTTGCTGCReverse ACGACGGCATAGTCATTTGC

603573 498

bla-NDMForward GGTTTGGCGATCTGGTTTTCReverse CGGAATGGCTCATCACGATC

573594 521

bla-IMP-1Forward TTGACACTCCATTTACAG

Reverse GATTGAGAATTAAGCCACTCT491540 232

bla-IMP-2Forward TTGACACTCCATTTACGG

Reverse GATCGAGAATTAAGCCACCCT514579 232

bla-IMP-3TTGACACTCCATTTACTG

GATCGAGAATTAAGCCACTCT491559 232

bla-OXA-48Forward GCTTGATCGCCCTCGATT

Reverse GATTTGCTCCGTGGCCGAAA560594 238

TM melting temperature of the primer

resistance among the MDR-GNB is still limited Few studieshave been found to report on this problem a surveillancestudy done in Kenya reported the recovery of seven NDM-1-positive Klebsiella pneumoniae isolates mostly from urinesamples [8] While in two other studies the prevalence ofmetallo-beta-lactamase among Pseudomonas aeruginosa wasreported to be 14 in Kenya [9] and 67 in Northern Africa[10] Other studies in South Africa reported the existence ofcarbapenemase producers among ESBL isolates [4 11]

In this study we determined a wide range of carba-penem resistance determining genes (119887119897119886VIM 119887119897119886IMP 119887119897119886KPC119887119897119886OXA-48 and 119887119897119886NDM) among different MDR-GNB isolatesfrom patient specimens in Bugando Medical Centremdashatertiary hospital in Mwanza Tanzania All bacterial specieswhich were resistant to three or more classes of antibioticswere regarded as MDR-GNB and included in the study

2 Materials and Methods

21 Study Design and Population This was a cross-sectionallaboratory based study involving 234 multidrug resistantgram negative isolates collected between 2007 and 2012from clinical specimens in a tertiary hospital NorthwesternTanzania These isolates were from pus (112) urine (56)blood (55) aspirate (3) and sputum (1) The primary cultureidentification using biochemical tests and disk diffusionsusceptibility testing of these isolates were done at BugandoMedical Centre following previously published techniques[12 13] All the isolates had been confirmed to be resistant toampicillin and 177 (78) were ESBL producers as confirmedby double disk synergy test [13] andwere frozen in brain heartinfusion (BHI) broth with 20 glycerol at minus 80∘C at theMicrobiology Laboratory of Bugando Medical Centre

22 Subculturing and Disk Diffusion Susceptibility TestingIsolates were subcultured on blood agar (BA) and then resub-jected to further susceptibility testing on Muller-Hintonagar to ampicillin 25 120583g amoxicillinclavulanic acid 2010 120583gceftazidime 30 120583g ciprofloxacin 5 120583g gentamicin 10 120583g

trimethoprim-sulfamethoxazole (TMPSMX) 1252375 120583gertapenem 10 120583g and meropenem 10 120583g (Oxoid UK) Allsusceptibility results were interpreted based on the CLSI 2010guidelines [14]

23 PCR Amplification for Carbapenemase Genes All themolecularPCR tests (DNA extraction amplification andgel electrophoresis were conducted at MBN Clinical Labo-ratories Kampala Uganda The presence of carbapenemaseencoding genes was determined using primers targeting119887119897119886VIM 119887119897119886IMP 119887119897119886KPC 119887119897119886OXA-48 and 119887119897119886NDM [15] obtainedfrom Eurofin MWG Operon Germany as shown in Table 1Cells were lysed using boiling method to obtain bothgenomic and plasmid DNA as described previously [16] Foramplification 5 120583L of template DNA (50 ng120583L) was addedto a 45 120583L mixture containing 200120583M of dNTP mixtures(Roche Switzerland) 04120583M of each primer 25U Taqpolymerase (Invitrogen Germany) and appropriate buffer(02 120583M MgCl

2 25 120583M KCL 05 120583L 10 Tween 20 1 120583L of

Gelatin and 38 120583L of pure water)The amplification was done using GTQ-CYCLER 96

thermocycler machine (Hain Life science GmbH NehrenGermany) For 119887119897119886VIM 119887119897119886KPC 119887119897119886NDM and 119887119897119886OXA-48 the pro-gramme was denaturation at 94∘C for 45 seconds annealingat 52∘C for 1 minute and elongation at 72∘C for a minuteFor 119887119897119886IMP the same programme was used except that theannealing temperature was adjusted to 45∘C for 60 secondsThe cycles were repeated 40 times and all primer sets had afinal extension of 72∘C for 10 minutes

Five micro liters of PCR products were analyzed by elec-trophoresis in 10 agarose stained with ethidium bromideto detect the specific amplified product by comparing with100 base-pairs standard DNA ladder (Promega German)Quality control was performed with each run using DSMZ9377 Klebsiella pneumoniae as the negative control for allgenes Positive control strains from the Institute of Micro-biology Giessen Germany were Klebsiella pneumonia Nr8for NDM-1Klebsiella pneumoniae 714 for OXA-48Klebsiellapneumoniae 211 (T) for KPC and P aeruginosa from clinical

BioMed Research International 3

Table 2 Clinical isolate by specimens studied

Bacteria spp Specimen TotalAspirate Blood Pus swab Sputum Urine

K pneumoniae 1 23 28 0 24 76E coli 1 8 31 1 15 56P aeruginosa 1 16 22 0 2 41C freundii 0 1 8 0 6 15A baumannii 0 2 8 0 0 10P vulgaris 0 0 7 0 0 7E cloacae 0 3 0 0 2 5M morganii 0 0 2 0 1 3P mirabilis 0 0 1 0 1 2S marcescens 0 2 4 0 3 9Salmonella typhi 0 0 0 0 1 1Salmonella spp 0 0 1 0 1 2Total 3 55 112 1 56 227

Table 3 Resistance pattern of bacteria species used in the study

Isolate AMP AMC CRO CAZ CN CP SXT ERT MEMA baumannii (10) 1000 1000 900 900 800 400 900 400 100C freundii (15) 1000 1000 600 800 800 267 867 133 00E coli (56) 1000 1000 840 821 732 446 964 196 89Enterobacter (5) 1000 1000 200 400 600 200 1000 200 00K oxytoca (8) 1000 1000 1000 1000 1000 625 1000 125 00K pneumoniae (68) 1000 985 840 794 838 338 971 162 15M morganii (3) 1000 1000 333 333 333 00 1000 00 00P aeruginosa (41) 1000 975 732 537 317 171 927 561 195P mirabilis (2) 1000 1000 1000 1000 500 1000 1000 500 00P vulgaris (7) 1000 857 571 429 571 143 857 143 00S marcescens (9) 1000 1000 667 667 667 444 1000 00 00Salmonella spp (3) 1000 1000 1000 1000 1000 00 1000 00 00Total 1000 987 780 740 656 335 952 242 66AMP AMC CAZ CRO CN CIP SXT ERT andMEM stand for ampicillin amoxicillinclavulanic acid ceftazidime gentamicin ciprofloxacin trimethoprim-sulfamethoxazole ertapenem and meropenem respectively

routine samples for IMP in Giessen For the VIM gene thecontrol strain was obtained from RESET research collabora-tion [17]

24 Ethical Issues The study was approved by the school ofbiomedical sciences research and ethics committee of Mak-erere University College of Health Sciences Material transferagreement for transportation of 234 isolates from MwanzaTanzania to Kampala Uganda was obtained from the direc-tor of research and publication Catholic University of Healthand Allied Sciences Bugando

3 Results

31 Clinical Bacterial Isolates Studied The study excluded 9isolates which failed to grow on subculture Of the remaining227 isolates which successfully grew 76 (335) were Kpneumoniae as the most predominant species followed byE coli 56 (247) and P aeruginosa 41 (181) (Table 2)

The study used isolates which were resistant to at least threedifferent classes of antibiotics most of them were resistanceto ampicillin 100 augmentin and ceftazidime (Table 3) Forthis study strains displaying breakpoints for either resistanceor intermediate levels for ertapenem and meropenem wereconsidered as reduced susceptible Of the 227 MDR-GNB 55(24) had reduced susceptibility to ertapenem while only 15(7) had reduced susceptibility to meropenem

32 Prevalence of Carbapenemase Genes Based on the PCRassays 80 (3524) of 227 MDR-GNB isolates were positivefor one or more of the carbapenemase genes Of the 55isolates with reduced susceptibility to ertapenem 33 (60)tested positive for carbapenemase genes (119875 value lt 0001)while 11 (73) of the 15 isolates with reduced susceptibility tomeropenem were positive for carbapenemase genes (119875 value= 0001)

Overall IMP-types were the most predominant car-bapenemase genes detected in 49 (216) followed by VIM


Table 4 Distribution of carbapenemase genes among different organisms studied

Bacterial spp Carbapenemase genesIMP types VIM OXA 48 KPC NDM Carbapenemase positive

A baumannii (10) 3 0 0 0 0 3C freundii (15) 2 1 1 0 0 4E coli (56) 19 4 3 4 2 32E cloacae (5) 0 0 0 0 0 0K oxytoca (8) 3 0 1 0 1 5K pneumoniae (68) 9 11 4 3 2 29M morganii (3) 0 0 0 0 1 1P aeruginosa (41) 12 9 2 1 1 25P mirabilis (2) 0 0 0 0 0 0P vulgaris (7) 0 0 0 0 0 0S marcescens (9) 0 2 0 0 0 2Salmonella spp (3) 1 1 0 0 0 2

49 28 11 8 7 103

Table 5 Antimicrobial susceptibility profile of isolates with multiple carbapenem resistance genes

Isolate CAZ CRO AMC AMP CN CIP ERT MEM SXT Carbapenemase genes1 K pneumoniae R R R R R S R S R KPC IMP VIM2 E coli R R R R S R R R R KPC IMP3 K pneumoniae R R R R R S S S R OXA 48 and VIM4 P aeruginosa R R R R S S R S R IMP C and VIM5 E coli R R R R R R S S R KPC and IMP6 K pneumoniae R R R R R R S S R IMP and VIM7 K pneumoniae R R R R R S S S R IMP and VIM8 E coli R R R R R R S S R IMP and VIM9 E coli R R R R R R S S R OXA 48 IMP10 E coli R R R R R S R S R OXA 48 and NDM11 E coli R R R R S S S S R VIM and NDM12 K pneumoniae R R R R R R R S R OXA 48 and VIM13 E coli R R R R R R R R R IMP and VIM14 C freundii R R R R R S S S R OXA 48 IMP and VIM15 K oxytoca R R R R R S R S R OXA 48 and NDM

28 (123) OXA-48 11 (49) KPC 8 (35) and NDM 7(31) (Table 4) These genes were either solitarily detectedin one bacterial isolate or with more than one gene in onebacterial isolate Of 80 bacterial isolates with carbapenemasegenes 15 (66) harbored more than one carbapenemasegene (Table 5)

33 Distribution of Carbapenemase Genes among MultidrugResistant Gram Negative Bacterial Isolates The genes wereheterogeneously distributed among the different species ofmultidrug resistant gram negative bacteria with some bac-teria species having more than one carbapenemase genesas shown in Table 5 E coli was the most prevalent specieswith carbapenemase genes 32 (14) followed by Klebsiellapneumoniae 24 (1057) P aeruginosa 1013 Klebsiellaoxytoca 176 Acinetobacter baumannii 13 Citrobacterfreundii 088 Serratia marcescens 088 and Salmonella

spp 044 (Table 4) Of the clinical specimens studiedcarbapenemase genes were more prevalent in urine cultures22 (3929) of 56 specimens followed by blood culture 20(3636) of 55 specimen and pus swab with 37 (3304) of112 specimen studied

4 Discussion

We detected a high prevalence (3524) of carbapenemasegenes among multidrug resistant gram negative bacterialspecies The majority of the studied isolates were ESBLproducer thus our results are similar to those obtained byCoetzee and Brink in South Africa [11] This is a ratherworrying finding in the poor populations in the horn ofAfrica however this data is comparable to study donein India which found a similar prevalence particularly ofMBL (NDM 1 VIM types and IMP types) among family


Enterobacteriaceae In their study the prevalence of MBLwas between 31 and 55 among multidrug resistant familyEnterobacteriaceae [18] This prevalence is in concordancewith another study obtained in India which reported theprevalence of carbapenemase genes among gram negativebacterial isolates to be 43 [19 20] On the other hand thismagnitude is a bit higher than data reported from USA andKenya [9 21] this could be explained by the fact that thosestudies investigated fewer genes than in the current study

In the current study we also detected 22 bacterial specieswith phenotypically reduced susceptibility to carbapenemdrugs but its resistance mechanisms were not detected by anyof the screened carbapenemase primers used in this studyThis might be due to the limited number of genes targeted inour study as well as to other mechanisms of resistance suchas porin lossmutations [22 23]

As previously published OXA-48 gene for carbapenemresistance has been found in ESBL producers especially thoseharboring CTX-M [24] This was also proved in this study asmost of OXA-48 gene was detected on CTX-M producing Kpneumoniae and E coli [25 26]

In comparison with other carbapenem-resistant genes119887119897119886VIM poses the broadest range of substrate hydrolysis andcan eventually degrade all 120573-lactam except monobactams[27] In the present study these genes were mostly detectedin K pneumoniae E coli and P aeruginosa This datacorresponds to the findings of a study done in Korea whereVIM was reported as the most predominant carbapenemasegenes in class Bmetallo-beta-lactamase among gramnegativeclinical isolates It also corresponds to the worldwide findingswhere VIM is reported as the commonest MBL to be found[28]

We have also detected a low prevalence (119899 = 7308)of NDM gene among multidrug-resistant gram negativebacteriaThis prevalence ismuch lower than the one reportedin India by Kumarasamy et al among convenience sampleof family Enterobacteriaceaein which they obtained a preva-lence of 31 to 55 [18] Plasmids carrying carbapenemasegenes like NDM-1 are diverse and can harbor a high numberof additional resistance genes (eg ESBL-alleles) as well asother carbapenemase genes like Oxacillinase-48 types VIMtypes and so forth as the source of multidrug resistance inone single bacteria [18 29] Of 80 bacterial species detectedof having carbapenemase genes 15 had multiple genescoding for carbapenem resistance especially in E coli andP aeruginosa The presence of multiple resistance genes inone strain provides selection advantage of these strains [26]This phenomenon has not been commonly detected in alarge number of studies probably due to the number of genesstudied since most of the studies research on one or twogenes

The study did not investigate the clonality of the isolatesand the sequence of the genes and also did not use primersto target all known carbapenemases genes Thus there isa probability that some carbapenemase-producing isolatescould not be adequately characterized Despite these limita-tions the study has provided the distribution of the commoncarbapenemase genes and the magnitude of the problem

5 Conclusion and Recommendation

We have for the first time demonstrated a high prevalenceof carbapenem-resistance conferring genes amongmultidrugresistant gram negative bacteria in Tanzania Most of theisolates harboring carbapenemase genes originated fromblood culture specimens and pus We recommend routinetesting for carbapenem resistance among the MDR-GNB inour hospital and other health facilities in developing coun-tries where there is high prevalent MDR GNB In additionother antibiotics such as colistin and tigecycline should betested to provide alterative treatment to these isolates Morestudies should be done to determine evolution andmolecularepidemiology of these isolates

Conflict of Interests

The authors declare that there is no conflict of Interestsregarding the publication of this paper

Acknowledgments

The authors would like to acknowledge the technical supportprovided by the members of the Department of Microbiol-ogyImmunology of CUHAS-Bugando Mwanza Tanzaniaand MBN clinical laboratory Kampala Uganda This workwas supported by a research grant of ITECH Tanzaniaand CUHAS to Martha F Mushi reagents from SACIDS toStephen E Mshana and a researcher startup grant of theFaculty of Medicine of the Justus-Liebig-University Giessento Can Imirzalioglu

References

[1] O Moquet C Bouchiat A Kinana et al ldquoClass D OXA-48carbapenemase in multidrug-resistant enterobacteria SenegalrdquoEmerging Infectious Diseases vol 17 no 1 pp 143ndash144 2011

[2] A E Pop-Vicas and E M C DrsquoAgata ldquoThe rising influx ofmultidrug-resistant gram-negative bacilli into a tertiary carehospitalrdquo Clinical Infectious Diseases vol 40 no 12 pp 1792ndash1798 2005

[3] S Bratu D Landman R Haag et al ldquoRapid spread of carba-penem-resistantKlebsiella pneumoniae in NewYork City a newthreat to our antibiotic armamentariumrdquo Archives of InternalMedicine vol 165 no 12 pp 1430ndash1435 2005

[4] A J Brink J Coetzee C G Clay et al ldquoEmergence of NewDelhi metallo-beta-lactamase (NDM-1) and Klebsiella pneu-moniae carbapenemase (KPC-2) in South Africardquo Journal ofClinical Microbiology vol 50 no 2 pp 525ndash527 2012

[5] A M Queenan and K Bush ldquoCarbapenemases the versatile120573-lactamasesrdquo Clinical Microbiology Reviews vol 20 no 3 pp440ndash458 2007

[6] P Nordmann T Naas and L Poirel ldquoGlobal spread of car-bapenemase producingEnterobacteriaceaerdquoEmerging InfectiousDiseases vol 17 no 10 pp 1791ndash1798 2011

[7] A Carrer L Poirel M Yilmaz et al ldquoSpread of OXA-48-encoding plasmid in Turkey and beyondrdquo Antimicrobial Agentsand Chemotherapy vol 54 no 3 pp 1369ndash1373 2010


[8] L Poirel G Revathi S Bernabeu and P Nordmann ldquoDetectionof NDM-1-producing Klebsiella pneumoniae in Kenyardquo Antimi-crobial Agents and Chemotherapy vol 55 no 2 pp 934ndash9362011

[9] J D D Pitout G Revathi B L Chow et al ldquoMetallo-120573-lactamase-producing Pseudomonas aeruginosa isolated froma large tertiary centre in Kenyardquo Clinical Microbiology andInfection vol 14 no 8 pp 755ndash759 2008

[10] S Hammami I Boutiba-Ben Boubaker R Ghozzi M SaidaniS Amine and S Ben Redjeb ldquoNosocomial outbreak ofimipenem-resistant Pseudomonas aeruginosa producingVIM-2metallo-120573-lactamase in a kidney transplantation unitrdquoDiagnos-tic Pathology vol 6 no 1 article 106 2011

[11] J Coetzee and A Brink ldquoThe emergence of carbapenem resis-tance in Enterobacteriaceae in South Africardquo Southern AfricanJournal of Epidemiology and Infection vol 26 no 4 pp 239ndash240 2011

[12] N Kayange E Kamugisha D L Mwizamholya S Jeremiahand S E Mshana ldquoPredictors of positive blood culture anddeaths among neonates with suspected neonatal sepsis in atertiary hospital Mwanza-Tanzaniardquo BMC Pediatrics vol 10article 39 2010

[13] S E Mshana E Kamugisha M Mirambo T Chakrabortyand E F Lyamuya ldquoPrevalence of multiresistant gram-negativeorganisms in a tertiary hospital in Mwanza Tanzaniardquo BMCResearch Notes vol 2 article 49 2009

[14] CLSI Standards for Antimicrobial Disk Susceptibility TestsApproved Standard DocumentM2-A9 Clinical and LaboratoryStandards Institute Wayne Pa USA 9th edition 2010

[15] C Dallenne A da Costa D Decre C Favier and G ArletldquoDevelopment of a set of multiplex PCR assays for the detectionof genes encoding important 120573-lactamases in Enterobacteri-aceaerdquo Journal of Antimicrobial Chemotherapy vol 65 no 3 pp490ndash495 2010

[16] D S Holmes and M Quigley ldquoA rapid boiling method for thepreparation of bacterial plasmidsrdquo Analytical Biochemistry vol114 no 1 pp 193ndash197 1981

[17] J Fischer I Rodrıguez S Schmoger et al ldquoEscherichia coliproducing VIM-1 carbapenemase isolated on a pig farmrdquoJournal of Antimicrobial Chemotherapy vol 67 no 7 pp 1793ndash1795 2012

[18] K K Kumarasamy M A Toleman T R Walsh et al ldquoEmer-gence of a new antibiotic resistance mechanism in India Pak-istan and the UK a molecular biological and epidemiologicalstudyrdquoThe Lancet Infectious Diseases vol 10 no 9 pp 597ndash6022010

[19] J D D Pitout D B Gregson L Poirel J-A McClure P Le andD L Church ldquoDetection ofPseudomonas aeruginosa producingmetallo-120573-lactamases in a large centralized laboratoryrdquo Journalof Clinical Microbiology vol 43 no 7 pp 3129ndash3135 2005

[20] A M Hammerum M A Toleman F Hansen et al ldquoGlobalspread of New Delhi metallo-120573-lactamase 1rdquo The Lancet Infec-tious Diseases vol 10 no 12 pp 829ndash830 2010

[21] C Lascols M Hackel S H Marshall et al ldquoIncreasingprevalence and dissemination of NDM-1 metallo-120573-lactamasein India data from the SMART study (2009)rdquo Journal ofAntimicrobial Chemotherapy vol 66 no 9 pp 1992ndash1997 2011

[22] P Nordmann L Dortet and L Poirel ldquoCarbapenem resistancein Enterobacteriaceae here is the stormrdquo Trends in MolecularMedicine vol 18 no 5 pp 263ndash272 2012

[23] D P Webster T Gaulton N Woodford et al ldquoEmergenceof carbapenem resistance due to porin loss in an extended-spectrum 120573-lactamase (ESBL)-producing Klebsiella pneumo-niae strain during meropenem therapyrdquo International Journalof Antimicrobial Agents vol 36 no 6 pp 575ndash576 2010

[24] A Potron L Poirel E Rondinaud and P Nordmann ldquoInter-continental spread ofOXA-48 beta-lactamase-producingEnter-obacteriaceae over a 11-year period 2001 to 2011rdquo Euro Surveil-lance vol 18 no 31 Article ID 20549 2013

[25] S E Mshana C Imirzalioglu T Hain E Domann E FLyamuya and T Chakraborty ldquoMultiple ST clonal complexeswith a predominance of ST131 of Escherichia coli harbouringblaCTX-M-15 in a tertiary hospital in TanzaniardquoClinical Micro-biology and Infection vol 17 no 8 pp 1279ndash1282 2011

[26] S E Mshana T Hain E Domann E F Lyamuya TChakraborty and C Imirzalioglu ldquoPredominance of Klebsiellapneumoniae ST14 carrying CTX-M-15 causing neonatal sepsisin Tanzaniardquo BMC Infectious Diseases vol 13 no 1 article 4662013

[27] J-D Docquier J Lamotte-Brasseur M Galleni G AmicosanteJ-M Frere and G M Rossolini ldquoOn functional and structuralheterogeneity of VIM-type metallo-120573-lactamasesrdquo Journal ofAntimicrobial Chemotherapy vol 51 no 2 pp 257ndash266 2003

[28] N Gupta B M Limbago J B Patel and A J KallenldquoCarbapenem-resistant Enterobacteriaceae epidemiology andpreventionrdquo Clinical Infectious Diseases vol 53 no 1 pp 60ndash67 2011

[29] P Nordmann L Poirel M A Toleman and T R Walsh ldquoDoesbroad-spectrum 120573-lactam resistance due to NDM-1 herald theend of the antibiotic era for treatment of infections caused byGram-negative bacteriardquo Journal of Antimicrobial Chemother-apy vol 66 no 4 pp 689ndash692 2011

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


Table 1 Primer sets for amplification of carbapenem resistance determine genes (16)

Gene Primer sequence (51015840 rarr 31015840) TM (∘C) Amplicons size (bp)

bla-VIMForward GATGGTGTTTGGTCGCATAReverse CGAATGCGCAGCACCAG

545576 390

bla-KPCForward CATTCAAGGGCTTTCTTGCTGCReverse ACGACGGCATAGTCATTTGC

603573 498

bla-NDMForward GGTTTGGCGATCTGGTTTTCReverse CGGAATGGCTCATCACGATC

573594 521

bla-IMP-1Forward TTGACACTCCATTTACAG

Reverse GATTGAGAATTAAGCCACTCT491540 232

bla-IMP-2Forward TTGACACTCCATTTACGG

Reverse GATCGAGAATTAAGCCACCCT514579 232

bla-IMP-3TTGACACTCCATTTACTG

GATCGAGAATTAAGCCACTCT491559 232

bla-OXA-48Forward GCTTGATCGCCCTCGATT

Reverse GATTTGCTCCGTGGCCGAAA560594 238

TM melting temperature of the primer

resistance among the MDR-GNB is still limited Few studieshave been found to report on this problem a surveillancestudy done in Kenya reported the recovery of seven NDM-1-positive Klebsiella pneumoniae isolates mostly from urinesamples [8] While in two other studies the prevalence ofmetallo-beta-lactamase among Pseudomonas aeruginosa wasreported to be 14 in Kenya [9] and 67 in Northern Africa[10] Other studies in South Africa reported the existence ofcarbapenemase producers among ESBL isolates [4 11]

In this study we determined a wide range of carba-penem resistance determining genes (119887119897119886VIM 119887119897119886IMP 119887119897119886KPC119887119897119886OXA-48 and 119887119897119886NDM) among different MDR-GNB isolatesfrom patient specimens in Bugando Medical Centremdashatertiary hospital in Mwanza Tanzania All bacterial specieswhich were resistant to three or more classes of antibioticswere regarded as MDR-GNB and included in the study

2 Materials and Methods

21 Study Design and Population This was a cross-sectionallaboratory based study involving 234 multidrug resistantgram negative isolates collected between 2007 and 2012from clinical specimens in a tertiary hospital NorthwesternTanzania These isolates were from pus (112) urine (56)blood (55) aspirate (3) and sputum (1) The primary cultureidentification using biochemical tests and disk diffusionsusceptibility testing of these isolates were done at BugandoMedical Centre following previously published techniques[12 13] All the isolates had been confirmed to be resistant toampicillin and 177 (78) were ESBL producers as confirmedby double disk synergy test [13] andwere frozen in brain heartinfusion (BHI) broth with 20 glycerol at minus 80∘C at theMicrobiology Laboratory of Bugando Medical Centre

22 Subculturing and Disk Diffusion Susceptibility TestingIsolates were subcultured on blood agar (BA) and then resub-jected to further susceptibility testing on Muller-Hintonagar to ampicillin 25 120583g amoxicillinclavulanic acid 2010 120583gceftazidime 30 120583g ciprofloxacin 5 120583g gentamicin 10 120583g

trimethoprim-sulfamethoxazole (TMPSMX) 1252375 120583gertapenem 10 120583g and meropenem 10 120583g (Oxoid UK) Allsusceptibility results were interpreted based on the CLSI 2010guidelines [14]

23 PCR Amplification for Carbapenemase Genes All themolecularPCR tests (DNA extraction amplification andgel electrophoresis were conducted at MBN Clinical Labo-ratories Kampala Uganda The presence of carbapenemaseencoding genes was determined using primers targeting119887119897119886VIM 119887119897119886IMP 119887119897119886KPC 119887119897119886OXA-48 and 119887119897119886NDM [15] obtainedfrom Eurofin MWG Operon Germany as shown in Table 1Cells were lysed using boiling method to obtain bothgenomic and plasmid DNA as described previously [16] Foramplification 5 120583L of template DNA (50 ng120583L) was addedto a 45 120583L mixture containing 200120583M of dNTP mixtures(Roche Switzerland) 04120583M of each primer 25U Taqpolymerase (Invitrogen Germany) and appropriate buffer(02 120583M MgCl

2 25 120583M KCL 05 120583L 10 Tween 20 1 120583L of

Gelatin and 38 120583L of pure water)The amplification was done using GTQ-CYCLER 96

thermocycler machine (Hain Life science GmbH NehrenGermany) For 119887119897119886VIM 119887119897119886KPC 119887119897119886NDM and 119887119897119886OXA-48 the pro-gramme was denaturation at 94∘C for 45 seconds annealingat 52∘C for 1 minute and elongation at 72∘C for a minuteFor 119887119897119886IMP the same programme was used except that theannealing temperature was adjusted to 45∘C for 60 secondsThe cycles were repeated 40 times and all primer sets had afinal extension of 72∘C for 10 minutes

Five micro liters of PCR products were analyzed by elec-trophoresis in 10 agarose stained with ethidium bromideto detect the specific amplified product by comparing with100 base-pairs standard DNA ladder (Promega German)Quality control was performed with each run using DSMZ9377 Klebsiella pneumoniae as the negative control for allgenes Positive control strains from the Institute of Micro-biology Giessen Germany were Klebsiella pneumonia Nr8for NDM-1Klebsiella pneumoniae 714 for OXA-48Klebsiellapneumoniae 211 (T) for KPC and P aeruginosa from clinical









3 Results









49 28 11 8 7 103






4 Discussion













Acknowledgments


References






































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology









3 Results









49 28 11 8 7 103






4 Discussion













Acknowledgments


References






































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology





49 28 11 8 7 103






4 Discussion













Acknowledgments


References






































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology












Acknowledgments


References






































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

Research Article Carbapenemase Genes among Multidrug ...

Documents

Transcript of Research Article Carbapenemase Genes among Multidrug ...