The Plant Cell, Vol. 5, 501-514, May 1993 0 1993 American Society of Plant Physiologists

RESEARCH ARTICLE

A Genetic Analysis of DNA Sequence Requirements for Dissociation State I Activity in Tobacco

James English, Kate Harrison, and Jonathan D. G. Jones’

The Sainsbury Laboratory, John lnnes Centre, Colney Lane, Norwich, NR4 7UH, United Kingdom

Our objective was to test whether the double Ds structure correlated with Dissociation state I activity @e., high frequency of chromosome breakage and low frequency of reversion) in maize exhibited similar properties in tobacco. A genetic assay was established to test double Ds and related structures for their ability to cause loss of the linked marker genes streptomycin phosphotransferase and P-glucuronidase in transgenic tobacco. An engineered double Ds element and a simple Ds element showed behavior consistent with that of state I and state II Ds elements, respectively, as described for maize. DNA structural rearrangements accompanied marker gene loss. Dissection of the double Ds structure showed that a left end and a right end of Ds in direct orientation were sufficient for the instability observed. This result suggested that left and right ends of Ds in direct orientation can participate in aberrant transposition events, consistent with two different models for double Ds-induced chromosome breakage proposed previously. Both models predict that the inver- sion of a half Ds element accompanies the aberrant transposition event. Such an inversion was detected by polymerase chain reaction experiments in tobacco and maize only when Activator activity was present in the genome.

INTRODUCTION

Members of the maize ActivatorlDissociation (AclDs) transpos- able element family can participate in several types of chromosomal rearrangements in addition to transposition. In response to Ac, certain Os elements give rise to chromosome breakage associated with the formation of acentric and dicen- tric chromosomes and to deletions and duplications, inversions, ring chromosomes, and translocations (McClintock, 1947, 1948, 1949, 1953a). The chromosome-breaking activity of a particu- lar Os element was the first manifestation of transposable activity detected by McClintock (1947). Subsequently, she showed that both Ac and Os could transpose to new locations in the genome (McClintock, 1948; Fedoroff, 1983).

Different “states” of Ds elements were defined with respect to the relative frequency of chromosome breakage versus rever- sion (transposition) events associated with them. State I Os elements give a high frequency of chromosome breaks and a low frequency of reversion when inserted in a known gene. State II Os elements give little or no chromosome breakage anda high frequencyof reversion (McClintock, 1949). The pat- tern of reversion associated with the state II Os element at c-m7 was dependent on the state and dose of Ac in the same way as the pattern of chromosome breakage due to state I Os ele- ments (McClintock, 1951). This result suggested that state I and state II Os activity were closely related phenomena and

To whom correspondence should be addressed.

might be alternative outcomes of the same process. Whereas transposition is the simple outcome, chromosome breakage and other rearrangements are consequences of aberrant events involving Os (McClintock, 1949).

Little is known about how these chromosomal rearrange- ments occur. Severa1 structures involved with chromosome breakage in maize have been characterized. The double Os element has been identified in several unstable shrunken 81- leles associated with chromosome breakage (Courage-Tebbe et al., 1983; Weck et al., 1984; Doring et al., 1990). It consists of a 2-kb Os inserted, in opposite orientation, into an exact copy of itself, as shown in Figure 1 (Doring et al., 1984). Dooner and Belachew (1991) showed that two Ac elements or an Ac and a Os located within -3 centimorgans of each other, one being at the bronze locus, can cause chromosome breakage. Weil and Wessler (1993) characterized two waxy alleles as- sociated with chromosome breakage. 60th contain closely linked Os elements, 0.5 and 1.5 kb apart, respectively. It is not known how these structures cause chromosome breakage, al- though a feature they all have in common is the presence of multiple transposable element ends in close proximity. Dou- ble Os is the most extreme case; it has four transposable element ends within 4 kb of each other. For this reason, dou- ble Os was chosen for the work presented here.

At least two features of the double Os structure could poten- tially give rise to chromosome breakage: (1) double Os contains long inverted repeats formed by the two pairs of like Os ends

502 The Plant Cell

H B ss I\ .I

Figure 1. Schematic Diagrams of Double Ds from Maize and the eDDs Element.

Open arrowheads represent left (BamHI) element ends. Solid arrow- heads represent right element ends. Lengths (in base pairs) are shown below. BamHl (E) and Hindlll (H) restriction sites are indicated. Sal1 (Sa) and Sstl (Ss) restriction sites were used for cloning.

that are present, and if these inverted repeats participated in sister chromatid exchanges, acentric and dicentric chromatids would be formed leading to chromosome breakage (Weck et al., 1984); (2) unlike simple AclDs elements, double Os con- tains a left end and a right end of Os in direct orientation. If these directly repeated ends acted as a substrate for trans-

of adjacent marker genes in the absence of other Ds elements, to dissect the double Os structure, and to generate double Ds-induced DNA rearrangements. We first characterized this system with respect to marker loss and reversion with double Ds and a simple Os. Simple Os behaves like a state II element, and double Os behaves like a state I element, as described for maize. Dissection of the double Os structure revealed that a left end and a right end of Os in direct orientation &e., half a double Os) cause marker loss in the same way as double Ds. This result suggests that left and right ends of Ds in direct orientation can participate in aberrant transposition events and is consistent with models for double Os-induced chromosome breakage proposed by Doring and Starlinger (1984) and by Fedoroff (1989) (see Results). If such an aberrant event oc- curs, the specific inversion of a half Os element would be predicted. Polymerase chain reaction (PCR) experiments de- tected this type of inversion in both tobacco and maize. Further experiments will be required to determine whether Os-induced chromosome breakage occurs through one or both of the mech- anisms proposed.

posase, aberrant events leading to chromosome breakage and other rearrangements would be predicted (Doring and Starlinger, 1984; Fedoroff, 1989).

RESULTS

Models for Ac/Ds-induced chromosome breakage have been proposed based on element-induced rearrangements. Double Ds is associated with large and complex insertions in the shrunken alleles sh-m5933 and sh-m6258 (Courage- Tebbe et al., 1983; Doring et al., 1990). These insertions contain double Os elements in inverted orientation at each end and severa1 additional kilobases of inverted sequences. The struc- tures of these insertions form the basis for a model proposed by Fedoroff (1989) (see below). Excision of a putative “macro- transposon” encompassing two closely linked elements and the DNA between them led to the model of Ralston et al. (1989).

To address how double Os-induced chromosome breakage occurs, it would be desirable to start with a defined transpos- able element structure, to generate rearrangements, and to analyze the resulting structures. This has proved difficult in maize because there are many copies of Ds sequences in most genomes (Geiser et al., 1982; Fedoroff et al., 1983). In maize, the structures that can be observed are limited to those that occur naturally, whereas in heterologous hosts, nove1 struc- tures can be engineered and tested. For these reasons, it may be advantageous to perform a rigorous analysis of DNA structures sufficient to cause chromosome breakage using a heterologous plant species.

We have established a phenotypic assay to monitor the ability of double Ds and other structures to cause marker gene insta- bility in tobacco. We constructed T-DNA vectors that carry the cell-autonomous markers streptomycin phosphotransferase (SPT) (Maliga et al., 1988; Jones et al., 1989) and p-gluc- uronidase (GUS) (Jefferson et al., 1987) and convenient restric- tion sites into which test structures can be inserted. We have used this system to address whether double Os can cause loss

Ds Elements

Simple Ds elements used in this work were Os4135 and Ds4081. Os4735 was derived from Ac by deleting the interna1 1.6-kb Hindlll fragment. Os4081 was derived from Ac by filling in the 5’ Hindlll site (Jones et al., 1990). An engineered double Os (eDDs) element was constructed by cloning, in the opposite orientation, the 2961-bp Ds4135 between the Nrul and Xhol sites of another Os. This resulted in a structure that has the same configuration of Os ends as double Os (Figure 1). The elements eDDs and Os4135 were cloned adjacent to the marker genes SPT(Maliga et al., 1988; Jones et al., 1989) and GUS (Jefferson et al., 1987) to test their ability to cause Ac-dependent instability of nearby genes. The resulting constructs were desig- nated eDDs/SPT and Ds/SPT, respectively, and are shown in Figure 2. To assess their relative rates of excision, eDDs and Os4081 were cloned into the 5‘ untranslated leader of SPT, resulting in constructs SPT::eDDs and SPT::Ds (Jones et al., 1990), respectively (Figure 2). Tobacco plants were trans- formed with these constructs via Agrobacterium and crossed to untransformed tobacco and to Ac transposase (Ac TPase)- expressing tines.

Ac TPase Sources

Three different sources of Ac TPase were used in this work. The first, sAc, carries a 177-bp deletion of Ac at its 3‘end and provides transposase under control of the Ac promoter, but cannot transpose itself (Scofield et al., 1992). Construct 35S:TPase contains a cauliflower mosaic virus (CaMV) 35s

Ds-lnduced Chromosome Breakage in Tobacco 503

promoter fused to the Ac TPase gene (Scofield et al., 1992).A 35S:TPase cDNA construct (35S:X\cDNA) was made by fus-ing a CaMV 35S promoter to a PCR-generated Ac cDNA (J.English, unpublished data). Transformed tobacco lines weregenerated containing each of these constructs and crossedto the SPT::Ds tester line (Jones et al., 1990) to assess the Acactivity associated with them. Each Ac TPase source gave riseto a unique pattern of Os excision due to differences in thetiming and level of Ac TPase expression during embryo de-velopment (Scofield et al., 1992; S. Scofield, J. English, andJ. Jones, manuscript in preparation). In the cases of sAc and35S:TPase, all transformants gave patterns of Ds excisionsimilar to those previously described (Scofield et al., 1992).Transformants that had single T-DNA insertions were chosen,and homozygous lines were generated from them. In the caseof 35S:X\cDNA, a single locus transformant giving the charac-teristic pattern of Ds excision was chosen. The pattern of Ds

ePDs/SPrtpSLJ 13361

LI

GUS 2~ V NPTII

Ps/SPrfpSLJ4135)

LB

"-<!GUS 2' V NPTII

SPr..eDDs(DSLJ1856l

LB

V NPTII

SPr.vDs (DJJ4081)

LB

SPT 35S

SPT 35S dBSlacZ

SPT 35S

V HPT SPT 35S

Figure 2. Schematic Diagrams of T-DNA Regions of Constructs Usedto Assay the Behavior of eDOs and Simple Ds Elements.Constructs eDDs/SPT have eDDs cloned adjacent to SPT. Two differ-ent versions were used. pSLJ1336 is shown here. Construct pSLJ4123is similar, the only difference being that eDDs was cloned into the dBS+polylinker of pSLJ4061. Construct Ds/SP7has the 3-kb Ds4135 clonedinto a dBS+ polylinker adjacent to SPT. Construct SPT::eDDs has eDDscloned into the 5' untranslated leader of SPT. Construct SPT.-.Ds hasthe 4.6-kb Ds4081 cloned into the 5'untranslated leader of SPT. NPTII,neomycin phosphotransferase gene; HPTII, hygromycin phosphotrans-ferase gene; 35S, cauliflower mosaic virus 35S promoter; B, BamHI; H,Hindlll; E, EcoRI. T-DNA left and right borders (LB and RB, respectively)are indicated. Open and solid arrowheads are as given in Figure 1.

Figure 3. Somatic Variegation Resulting from Transactivation ofeDDs/SPT and SPTr.Ds by Different Ac TPase Sources.

(A) sAc x SPT::Ds.(B) sAc x eDDs/SPT.(C) 35S:TPase x SP7::Ds.(D) 35S:TPase x eDDs/SPT.(E) 35S:X\cDNA x SPT::Ds.(F) 35S:/AcDNA x eDDs/SPT.

excision associated with each of the Ac TPase sources is shownin Figures 3A, 3C, and 3E.

eDDs Causes Instability of Adjacent Marker GenesDependent on Ac Activity

Eight independent eDDs/SPWransformed tobacco lines weregenerated and crossed to Ac TPase-containing tobacco linesand to untransformed tobacco. The resulting progeny were ger-minated on streptomycin-containing medium. Seven of thesetransformed lines gave rise to green, streptomycin-resistantprogeny, which exhibited white sectors when Ac TPase waspresent in the genome. The remaining line did not produce

504 The Plant Cell

white-sectored progeny. In the absence of Ac TPase, all of theeDDs/SPTtransformants gave rise to fully green progeny. Typ-ical phenotypes of sectored seedlings are shown in Figures3B, 3D, and 3F. The white, streptomycin-sensitive sectors areclonal in nature, with sharp boundaries.

Four independent Ds/SP7-transformed tobacco lines weregenerated. These transformants were crossed to Ac TPase-containing tobacco lines and to untransformed tobacco. Prog-eny from two plants were fully green when germinated onstreptomycin-containing media both in the presence and ab-sence of an Ac TPase source. Loss of SPT function dependenton Ac activity was observed at very low frequencies (sevento nine sectors per 200 seedlings) in progeny of the other twoDs/SPT transformants.

Pattern of Marker Loss Due to eDDs Is Similar to thePattern of Reversion Due to Ds4081

To compare the pattern of instability caused by eDDs to thepattern of reversion due to a simple Ds, eDDs/SPT and SPT::Dstransformants were crossed to each of three different Ac TPasesources. Typical progeny from these crosses are shown in Fig-ure 3. The pattern of Ds excision in response to sAc is acontinuous range of sector sizes from large to small (Figure3A). This pattern is also observed in the white sectors on agreen backgound of eDDs/SPT x sAc seedlings (Figure 3B).The pattern of Ds excision promoted by 35S:TPase is fairlyregular and consists mostly of medium-sized sectors (Figure3C). The white sectors on green of eDDs/SPT x 35S:TPaseseedlings show a similar pattern (Figure 3D). The pattern ofDs excision promoted by 35S:,4cDNA gives rise to a high fre-quency of medium to small sectors (Figure 3E). This patternis also reflected in the pattern of white sectors on green ofeDDs/SPT" x 35S:AcDNA seedlings (Figure 3F). Thus, the pat-tern of eDDs-associated marker loss is similar to the patternof reversion due to excision of Ds4081 with each Ac TPasesource tested.

Loss of GUS Activity Is Correlated with Loss ofSPT Activity

Loss of GUS activity is correlated with loss of SPT activity ineDDs/SPT x Ac TPase seedlings. Figure 4A shows aneDDs/SPT x sAc seedling with a white, streptomycin-sensitivesector, which was stained for GUS activity. When the chlorophyllwas extracted with 70% ethanol, it was clear that the sectorwhich lacked GUS activity coincided with the streptomycin-sensitive sector (Figure 4B). Even and reproducible stainingof seedlings for GUS activity proved to be difficult. To confirmthat loss of SPT function was correlated with loss of GUS func-tion, a population of eDDs/SP7~individuals was generated thathad lost the SPT gene germinally. Progeny from three differ-ent eDDs/SPT transformants, homozygous for the eDDs/SPTT-DNA and with Ac TPase in the genome, were crossedto untransformed tobacco. Progeny were germinated on

I ^Hr ^ **^mi^^i^Ef•P^ ^BPr ' JJP1

Figure 4. Tobacco Seedlings Germinated on Streptomycin-ContainingMedia.(A) An eDDs/SPT x sAc seedling that has been histochemically stainedfor GUS activity.(B) The same seedling as shown in (A) after extraction of chlorophyllwith 70% ethanol.(C) Progeny from an eDDs/SPT homozygous, sAc homozygous plantcrossed to untransformed tobacco. Three individuals that have lostSPT activity germinally can be seen among the majority of white-sectored, green seedlings.(D) Somatic variegation resulting from transactivation of SPT.:eDDsby 35S:TPase.(E) Somatic variegation resulting from transactivation of SPT.:Ds by35S:TPase.

streptomycin-containing medium. In addition to the majorityof green individuals with white sectors, there was a small num-ber of fully white seedlings (0.5 to 2%), as shown in Figure4C. These individuals had lost SPT function germinally.Histochemical staining for GUS activity was performed on 33fully white individuals and, of these, 29 had lost GUS activity.Coincidental loss of GUS and SPT activity rules out insertionalinactivation of SPI The relatively high frequency argues againstthe occurrence of small adjacent deletions, which has beenshown to be a low-frequency event in maize (Dooner et al.,1988). These points suggest that other types of rearrangementsare giving rise to loss of SPT activity in most cases.

Loss of Marker Genes Is Associated with DMAStructural Rearrangements

When the 29 eDDs/SPT individuals that had lost both SPTand GUS activity were large enough, DMA was extracted and

Ds-lnduced Chromosome Breakage in Tobacco 505

subjected to gel blot analysis to determine whether DMA struc-tural rearrangements accompanied the marker loss observed.A restriction map of the relevant part of the eDDs/SPTT-DNAis shown in Figure 5A. DNA samples were digested with Sstland probed with fragment A (SPTand 3' sequence). None ofthese individuals had homology to fragment A (data not shown).

B1 2 3 4 5 6 7 9 10

-4kb

Figure 5. DNA Gel Blot Analysis of eDDs/SPT Plants Selected for Ger-minal Loss of SPT and GUS Function.(A) Map of the relevant part of the eDDs/SPT T-DNA. Probe fragmentsA and B are indicated. Sstl (Ss), Hindlll (H), and BamHI (B) restrictionsites are indicated. T-DNA right border is indicated as RB. Open andsolid arrowheads are as given in Figure 1.(B) Each DNA sample was digested with Sstl and probed with frag-ment B. Lane 10 contains DNA from untransformed tobacco. Lane 7contains DNA from primary transformant eDDs/SP7"-1, and lanes 1 to6 contain DNA from its streptomycin-sensitive progeny. Lanes 9 and8 contain DNA from primary transformant eDDs/SPT-2 and astreptomycin-sensitive progeny plant, respectively. Three Ac TPaseT-DNAs were segregating in this population. The Ac TPase sourceis an Ac cDNA fusion, so fragment B hybridizes less to it than to eDDs.The sample in lane 2 is an example of a streptomycin-sensitive plantthat no longer has eDDs sequences. Two bands corresponding to AcTPase source T-DNAs can be seen. The 4-kb progenitor band (pres-ent in lanes 7 and 9) is indicated. New Ds-hybridizing bands areindicated by asterisks.

This blot was stripped and reprobed with fragment B (Ds4135)(Figure 5A). Of 29 individuals, 23 had no homology to frag-ment B (data not shown), except for background hybridizationto the Ac TPase source (of which there were three T-DNA locisegregating in this population). The observation that 23 of 29individuals no longer had homology to Ds could be explainedby asymmetric breakage of an eDDs-induced dicentric chro-mosome. Such an individual should be viable, even as ahaploid gamete, because tobacco is a tetraploid and wouldhave another copy of the sequence to provide function. Theavailability of a complete set of tobacco monosomic lines(Clausen and Cameron, 1944) is consistent with this idea.

The remaining six individuals had homology to fragment B,but the 4-kb Sstl band of the progenitors (Figure 5B, lanes 7and 9) was now absent, and one or more new Ds-hybridizingbands had appeared (Figure 5B). The individual representedin lane 2 no longer has Ds sequences, but two of the Ac TPasebands can be seen. Individuals in lanes 3, 4, 5, and 6 of Fig-ure 5B have lost the 4-kb progenitor band and each has a newDs-hybridizing band. Individuals in lanes 1 and 8 have alsolost the progenitor band, and they now show two and threenew bands, respectively. These results show that DNA rear-rangements involving eDDs are associated with loss of SPTand GUS function. The individuals with multiple new Ds-hybridizing bands may indicate that complex DNA rearrange-ments have occurred, or since the Ac TPase source is stillpresent, they could be due to somatic events.

Simple Os Excises More Frequently than eDDs

To compare somatic reversion rates due to excision of eDDsand a simple Ds, four independent SPT::eDDs transformantsand four independent SPT::Ds transformants were crossed to35S:TPase and sAc tobacco lines. Progeny were germinatedon streptomycin-containing medium, and the average fre-quency of green sectors was determined for each transformedline. Typical seedlings are shown in Figures 4D and 4E. Thefrequencies of sectors observed with 35S:TPase are listed inTable 1. Variability between transformants was observed in therates of eDDs and Ds excision. Green sectors occurred at av-erage frequencies of 22 to 66 per seedling for SPT::Ds x35S:TPase seedlings. Green sectors occurred at average fre-quencies ranging from 0.02 to 0.83 sectors per seedling inSP7::eDDs x 35S:TPase seedlings. Despite the vast decreasein excision frequency exhibited by eDDs, the characteristic pat-terns of sector sizes are retained with both 35S:TPase and sActransposase sources.

PCR analysis showed that both the internal Ds element ofeDDs and the entire eDDs element can excise (data not shown).To permit SPT function in SPT::eDDs seedlings, the outer Dselement must excise, either as the entire eDDs or subsequentto excision of the inner Ds element. We do not have a directestimate of the relative frequencies of excision of the internaland external Ds elements of eDDs. The data presented in Ta-ble 1 suggest that the outer Ds element excises at a lowfrequency relative to a simple Ds. If the inner Ds element

506 The Plant Cell

Tab,e ,. Frequency of Somatic Reversion of SPT in SPT::eDDs and SPT::Ds Tobacco Lines

Plant Sectors per Seedling

Ac adjacent to SPT; in both possible orientations. Construct eDDslSPT(Figure 68, construct 4) contains an eDDs element adjacent to SPT Construct Ds/SPT(Figure 6B, construct 5) car- ries the simple Os element, Ds4735, adjacent to SPT Construct

SPT::eDDs-1 0.24 SPT::eDDs-2 0.02 SPT: :eDDs-3 0.02 SPT::eDDs-4 0.03 SPT::Ds-I 32 SPT: : Ds-2 64 SPT::Ds-3 66 SPT: zDs-4 22

Each plant listed was crossed to a 35S:TPase source. Progeny were germinated on streptomycin-containing media. Green revertant sec- tors were counted. Sectors per seedling are average values for 100 seedlings in the cases of SPT::eDDs-1 and SPT::eDDs-4; -700 seed- lings in the cases of SPT::eDDs-2 and SPT::eDDs-3; 15 seedlings in the SPT::Ds transformants.

excised, it would leave a 1.6-kb simple Ds inserted in SPT If such an event occurred early, it would produce a large sector carrying a 1.6-kb simple Ds element in SPT, which we would expect to see as a sector with a high frequency of green spots. Large green sectors corresponding to excision of the outer Os occur at a low frequency in SPT::eDDs x SAC seedlings. However, sectors with a high frequency of green spots, corre- sponding to an early excision of the internal Ds element, have not been seen in more than 2000 SPT::eDDs x sAc seedlings screened so far, suggesting that excision of the internal Ds element of eDDs is a low-frequency event.

X E S RB . . ~ _ ~ _ LB A pSLJ4061 e ..

GUS 2' 1' NPT II SPT 35s dBS lac 2

Number 01 Transíormants SPT unsfable SPT unstable

Structures assaved depende", ~n mdependenf I3

1 4 l o l o 1 / 3 l 0 1 1 1

Dissection of the Double Ds Structure

The system described above was used to dissect double Ds to determine which feature of its structure gives rise to the marker gene instability that was observed. A series of 11 con- structs was made based on pSW4061, shown in Figure 6A, which has GUS and SPT as markers for chromosome break- age and the neomycin phosphotransferase gene as a selection for transformation. A darkBluescript (dBS+) lacZ region (Jones et al., 1992) adjacent to the SPTgene provided convenient re- striction sites and a blue/white screen for inserting test structures. Between three and eight transformed tobacco plants were generated for each construct. Transformants were crossed to untransformed, sAc and 35S:TPase tobacco lines. Progeny were germinated on streptomycin-containing medium and ob- served for SPT expression.

The structures that were assayed and a summary of the results that were obtained are shown in Figure 6B. Construct Ds::Ac/SPT (Figure 6B, construct 1) contains an Ac element inserted in a Ds element, in opposite orientation, a structure that is essentially an autonomous double Ds. Two AclSPTcon- structs (Figure 66, constructs 2 and 3) were generated carrying

Figure 6. Summary of Experiments Designed to Dissect the Double Ds Structure.

(A) Schematic diagram of the T-DNA region of pSW4061. Structures to be assayed were inserted into a dBS+ lacZ region, which is situ- ated adjacent to the SPTgene. X, Xhol; E, EcoRI; S, Sstl; LB and RB, T-DNA left and right borders, respectively; NPTII, neomycin phos- photransferase gene. The SPT, NPTII, and GUS genes are indicated. (6) Chart showing phenotypic classes of individual tobacco trans- formants for each construct based on pSW4061. Schematic representations show structures that were cloned into the dBS+ poly- linker in each construct: 1, Ds::AcISPT; 2, AcISPT; 3, AcISPT; 4, eDDslSPT; 5, DsISPT; 6, RE,RElSPT; 7, LE,LEISPT; 0, LE,REISPT; 9, R€,L€ISPT; 10, LNSPT; 11, REISPT (described in detail in Methods). Elements were oriented as shown relative to the rest of the T-DNA. BamHl (6) sites are indicated. Open and solid arrowheads are as given in Figure 1. The number of independent transformants in each pheno- typic class is shown next to each structure. Phenotypic classes are described in the text. Superscript A, individuals that acquire the 35S:TPase phenotype when 35S:TPase is present; superscript E, one of three transformants giving 10 to 15 sectors per 200 seedlings; su- perscript C, two of four transformants giving seven to nine sectors per 200 seedlings when Ac TPase was present; superscript D, one of five transformants giving two sectors per 200 seedlings with or without Ac TPase present.

Ds-lnduced Chromosome Breakage in Tobacco 507

R f , RfISPT(Figure 6B, construct 6) carries two right Ds ends as an inverted repeat adjacent to SPT Construct Lf,LEISPT (Figure 6B, construct 7) carries two left Ds ends and is analo- gous to construct RE, REISP'I: Constructs Lf,RfISPT and RE,Lf/SPT (Figure 6, constructs 8 and 9, respectively) carry left and right Ds ends in direct orientation, equivalent to one- half or the other of eDDs. Constructs LEISPTand RE/SPT(Fig- ure 66, constructs 10 and 11, respectively) carry one end or the other of Ds.

Three different classes of transformants were observed. In one class, seedlings were fully green and had no white sec- tors in the absence of Ac TPase, but in the presence of Ac TPase, there were white sectors in the characteristic pattern of the Ac TPase source used. SAC induced a range of sector sizes, and 35S:TPase induced medium-sized sectors, as shown in Figures 38 and 3D, respectively. Thus, transformants in this class gave rise to progeny in which SPT expression was un- stable dependent on the presence of Ac activity.

Structures that caused instability of SPT expression depen- dent on the presence of Ac activity all had a common feature, namely, left and right Ds ends in direct orientation. These in- cluded Ds::Ac/SPT, eDDsISPT, LE,RE/SPT, and Rf,LNSPT Of eight eDDsISPTtransformants (Figure 6B, construct 4), all but one exhibited instability of SPT expression dependent on the presence of Ac activity. The frequency of white sectors on eDDs/SPT seedlings was two- to threefold lower than the fre- quency of green sectors on SPT::Ds seedlings. 35S:TPase induced -10 to 20 white sectors per eDDslSPTseedling, com- pared to 20 to 66 green sectors in SPT::Ds seedlings (Table 1).

Four of five Ds::AcISPTtransformants (Figure 6B, construct 1) exhibited SPT expression that was unstable dependent on the presence of Ac activity. Of course, Ac is always present in these individuals, so nothing can be said about their behavior in the absence of Ac activity. However, they are put in this category because they exhibit the 35S:TPase phenotype when 35S:TPase is present. This result is consistent with the obser- vation that SPT::Ds seedlings containing both SAC and 35S:TPase exhibit the 35S:TPase pattern of variegation (S. Scofield, J. English, and J. Jones, unpublished data).

Transformants Lf,R€/SPT and RE,L€ISPT (Figure 66, con- structs 8 and 9, respectively) had phenotypes that were indistinguishable from the phenotypes of eDDsISPT transfor- mants. In LE, REISPT, the element ends are oriented away from SPT; whereas in R f , LEISPT, they are oriented toward SPT The observation that both of these structures produce the same phenotype implies that their effect is bidirectional.

The possibility existed that streptomycin-sensitive sectors could be due to interactions between T-DNA sequences lead- ing to gene silencing (Matzke et al., 1989; Hobbs et al., 1990; Napoli et al., 1990). As a control for this type of interaction, each plant in which SPTfunction was unstable dependent on the presence of the Ac TPase T-DNA was crossed to SPT::Ds- carrying plants from two independent lines. Plants in this category never had white sectors in the presence of an SPT::Ds T-DNA, confirming the interpretation that Ac activity was responsible for the loss of SPT function that was observed.

In a second class of transformants, expression of SPT was relatively stable whether or not an Ac TPase source was pres- ent. All of the constructs that did not have left and right Ds ends in direct orientation gave rise to transformants in this cat- egory. Both sets of AcISPTtransformants (Figure 66, constructs 2 and 3) showed relatively stable SPT expression in three of three cases each. Each set had one individual with white sec- tors at a frequency of 10 to 15 per 200 seedlings. This was m200-fold fewer sectors than was observed with transformants categorized as having SPT expression that was unstable de- pendent on the presence of Ac activity. Similar results were obtained with two of the DsISPT transformants.

Transformants RE, REISPT and Lf,LE/SPT (Figure 6B, con- structs 6 and 7, respectively) contain long inverted repeats formed by inverted like ends of Ds. These individuals had sta- ble SPT expression in each case. Finally, transformants LEISPT and RNSPT (Figure 66, constructs 10 and 11, respectively) showed stable SPT expression in each case.

In the third category of transformants, SPT was expressed poorly whether or not an Ac TPase source was present. The phenotype was an overall mottling, rather than being comprised of clonal sectors, which are characteristic of Ac-induced events. In four lines, SPT expression decreased when the Ac TPase T-DNA was present. This decrease in expression could be due to gene silencing (Matzke et al., 1989; Hobbs et al., 1990; Napoli et al., 1990). These individuals were crossed to SPT::Ds- carrying plants. In this case, SPT expression was decreased in the presence of the SPT::Ds T-DNA for each of the four lines, supporting the notion that an interaction between T-DNA loci was responsible for the mottling observed. lndividuals in this category were uninterpretable with respect to Ac TPase- dependent instability of SPT expression.

Structures Predicted by Models for Double Ds-lnduced Chromosome Breakage

The observation that a left end and a right end of Ds in direct orientation are sufficient to give marker gene instability in this system suggests that this structure can act as a substrate for Ac TPase. The implication is that aberrant transposition events involving the directly repeated left and right Ds ends in double Ds lead to chromosome breakage and other rearrangements. This is consistent with two different models for double Ds-in- duced chromosome breakage.

The first, shown in Figure 7, is similar to the model presented by Doring and Starlinger (1984). This model predicts that the directly repeated left and right ends of Ds, which serve as a substrate for transposase, are on the same DNA strand. For simplicity, only aberrant transpositions from one sister chro- matid to the other are shown in Figure 7. If this type of aberrant transposition event occurs, it can result in the formation of acen- tric and dicentric chromosomes, leading to a chromatid-type breakage-fusion-bridge cycle (Figure 71). The alternative out- come occurs if reinsertion is in the opposite orientation and gives rise to a sister chromatid exchange. This would result

508 The Plant Cell

Ac or simple Ds double Ds 1 2 3 4 M L L uv r V F

ra

1 2 I I I

J OR L L r V

E-

- J OR L L

r V

E- Figure 7. Model for Double Ds-lnduced Chromosome Breakage.

(A) to (E) Simple representation of Ac or simple Ds transposition to a sister chromatid. (A) Shows a Ds element in the starting position and the sister chromatid. (B) The transposase recognizes left and right ends of the element and excises them. (C) Shows the ligation of flanking sequences forming an “empty site.” (D) Shows the insertion of Ds at a new position in one orientation. (E) Shows the insertion of Ds at a new position in the other orientation. (F) to (J) Model for aberrant transposition of double Ds to a sister chromatid. (F) Represents the double Ds element in the starting position and the sister chromatid. (G) The double Ds element has been twisted around so directly repeated left and right ends look like a simple Ds element. (H) The transposase recognizes directly repeated Ds ends 2 and 4 and excises them. (I) Shows the ligation of flanking sequences 1 and 3 to form an “empty site:’ resulting in the inversion of a half-Ds (3,2) relative to flanking sequence 1. lnsertion of element ends 2 and 4 in this orientation forms U-shaped acentric and dicentic chromatids. (J) The ligation of flanking sequences 1 and 3 results in an inversion. lnsertion in this orientation results in an exchange between sister chromatids. Boxes (open and shaded) represent the 8-bp sequences flanking transposable element termini. Open and solid arrowheads are as given in Figure 1. This model is similar to the one proposed by Doring and Starlinger (1984).

in a deletion and a duplication (Figure 7J). In either case, a half Ds (extending from 2 to 3 in the Figure 7) will be inverted if the sequences flanking the excised Ds ends are ligated to- gether to form an empty site. This would be analogous to the formation of an empty site resulting from a simple excision event.

The “strand selectivity” model (Fedoroff, 1989), shown in Fig- ure 8, is based on the complicated insertions present in the maize shrunken alleles sh-m5933 and sh-m6258. This model predicts that the double Ds structure disrupts a strand selec- tivity mechanism associated with Ac TPase, such that directly repeated left and right ends of Ds located on sister chromatids act as a substrate for transposition. An aberrant transposition event involving directly repeated element ends on sister chro- matids would produce an empty site (Figure 8C), resulting in

the inversion of a half Ds element (extending from 2’to 3’) rel- ative to the flanking sequence (designated 1). In this case, formation of the empty site would give rise to an acentric or dicentric chromosome. Reinsertion of element ends 2 and 4’ could result in complex structures, such as the insertion at sh-m5933, acentric or dicentric chromosomes, or other com- plicated structures.

PCR Experiments Detect lnversion of a Half Ds in Tobacco and Maize

PCR experiments were designed to test whether the type of inversion predicted by these models occurs. Oligonucleotide primers were made to interna1 Ds sequences and sequences

Ds-lnduced Chromosome Breakage in Tobacco 509

flanking Ds in constructs L€,R€/SPTand RE,LE/SPTsuch that PCR products would be made if the predicted inversion of a half Ds occurred, as shown in Figure 9A (see Methods for primer sequences). DNA was isolated from L€, R€/SPT and R€,L€/SPTplants with or without 35S:TPase present. PCR was performed on the R€,L€/SPT DNA samples using primers M13+ and J1, which would yield a product of -278 bp if the inversion occurred. PCR was performed on L€, R€/SPT DNA samples using primers M13- and J2, which would yield a prod- uct of -220 bp if the inversion occurred. PCR products of the predicted sizes were generated only when Ac TPase was pres- ent (data not shown).

PCR products were cut from gels, cloned, and sequenced. Sequences around the junction point of the inversions are shown in Figure 96. The junction point of the inversion is anal- ogous to an empty site formed by excision of a Ds or Ac element. The "predicted" sequences would result if the inver- sion was exact, i.e., if the flanking sequences joined precisely, without inserting or deleting any bases. The eight bases flank- ing the junction points are the same, because the left and right Ds ends in these constructs were derived from the same Ac element (see Methods). The sequences obtained have small deletions at the junction point of the inversion, consistent with Ds and Ac empty site sequences that have been reported pre- viously (Coen et al., 1989; Fedoroff, 1989).

Similar PCR experiments were performed to determine whether the same type of inversion occurs in maize lines

1' 2 3'4' L .

U1 I V

1

1 3 4 . L

I

4' a . . I I

Figure 8. Strand Selectivity Model for Double Ds-lnduced Chromo- some Breakage.

(A) Newly replicated double Ds elements on sister chromatids or on opposite strands of a replication fork are shown. (E) The double Ds structure disrupts the strand selectivity of trans- posase such that element ends 2 and 4' act as a substrate for Ac transposase, designated TPase here. Element ends 2 and 4' are excised. (C) Ligation of flanking sequences 1 and 3'forms an "empty site" result- ing in the inversion of a half Ds (2'to 39 relative to flanking sequence 1. A dicentric or acentric chromatid is a consequence of this "empty site" formation. Element ends 2 and 4' may or may not reinsert. Open boxes represent the 8-bp sequences flanking transposable ele- ment termini. Open and solid arrowheads are as given in Figure 1.

A LE.RE/SPT RE. LE/SPT

M13t J1 m B W S P T Droa- M13t-> . . . TGCGTGACCTAGGGATGAAA.

1 2 LIIM13 ( + l PCR ~ r d i i c L s

Predicted M13+. . .GCGTTGCGTGACC I

5201 M13t . . . GCGTTGCGTGACC 5204 M13i.. . G C G T T w 5422 M13t . . . GCGTTGCGTGAC 5423 M13t.. .GCGTT= 5426 M13+. . .GCGTT= 5441 M13t.. .44bR deletiorl 5455 M13t . . . G C G T T m 5456 M13+...GCGTTGCGTGAC 54516 M13t . . . GCGTTG 54520 M13t . . . GCGTTGCGTGAC

&LE/SPT Droaenitor seauence . . .TTTCATCCCTAGUEKCC. . . <-J2. 8 . 7

J2lM13L-I PCR Droducts

.J1->...GGGTCACGCCAGGGATGAAA. 3 -

G C G T G A C C C G G C C G C G C G G G G T A C C . . . 51

ACC.. . J1 TGACCCGGCCGCGCGGGGTACC . . . J 1

GGCCGCGCGGGGTACC . . . J1

. T T T C A T C C C T G m A . . .<-M13- 6 - 5

Predicted 52 . . . CGCGCGGCCCGGGTCACGC GGTCACGCAACGCGCCCCA . . . Ml3-

54811 52 . . . CGCGCGGCCCGGGTCACGC AACGCGCCCCA . . . M13- 54818 32 . . . CGCGCGGCCCG- GTCACGCAACGCGCCCCA . . . M13-

7 5

Figure 9. PCR Experiments to Detect lnversion of a Half Ds in Tobacco.

(A) Schematic representation of the double Ds-like structures in Lf,R€/SPT and Rf ,L f /S fT before and after inversion. PCR prirners are indicated by small arrowheads. Open boxes represent the 8-bp sequences flanking transposable element termini. Open and solid ar- rowheads are as given in Figure 1. Specific element ends and flanking sequences are identified by number. (E) Sequences around the junction points of inversions. Progenitor sequences show junctions of element ends and flanking sequences. Element ends (underlined by arrows) and flanking sequences (under- lined) are numbered as given in (A). Positions and orientations of primers are indicated. Predicted sequences would result if the flank- ing sequences were joined exactly. Sequences obtained are shown below.

carrying a double Ds element. DNA was extracted from maize seeds carrying the sh-m5933 allele with and without Ac pres- ent. PCR was performed with primers D82 and D83 and with primers D84 and D85, which would amplify 4 9 0 - and -237-bp fragments, respectively, if the inversion occurred (primer se- quences are provided in Methods). Double Ds in shm5933 and the primers are represented schematically in Figure 1OA. Products of the predicted sizes were obtained only when Ac was present in the genome (data not shown). PCR products were cloned and sequenced. Sequences around the junction point of the inversion are shown in Figure 106. The predicted sequence would occur if the inversion was exact (as defined above). The sequences obtained are consistent with Ds and Ac empty sites that have been reported previously (Coen et

510 The Plant Cell

083 8 7 - 085 6 5 - 0 8 1 400-fold higher rate of reversion of SPT than does eDDs -3 4

when inserted in the 5' untranslated leader of SPT (Table 1). Thus, eDDs behaves like a chromosome-breaking (state I) Ds

082 0 8 3 6 - 7 5 - element, as has been defined in maize, and the simple Ds ele- m- - ments behave like nonbreaking (state II) elements (McClintock,

If the different promoter fusions to AcTPase act as different

085 D84

1949).

0 8 3 O r o w t o r s e a w states or doses of Ac, the different patterns of somatic exci- 6

~ > . . . ~ T A G G G A T G A A A . . . 0 8 3 - > . . . W T A G G G A T G A A A . . . 1 * * 3 4 4 sion of Ds observed with the SPT assay (Scofield et al., 1992)

should be reflected in the pattern of instability of SPT expres- sion caused by eDDs. In other words, the white sectors on a green background in eDDslSPTseedlings would have the same pattern as the green sectorson a white background in SPT::Ds seedlings with each Ac TPase fusion. This was indeed the case (Figure 3) and is a parallel between our system and the obser- vations of state I and state II Ds behavior in c-ml alleles described by McClintock (1951).

m t C T C T G C T C T C C R C T T C G T G G C R G G T T G T G T L C R T T C . - .D82 0 8 9 , ~ ~ G G G c T c T G c T c T & &&GCRGGTIGTGTACATTC,, , 0 8 2

::;::;;;;;E;;;= cA e;;;;;;;:;:;",;;;;: : 0 8 3 . , , G G G C T C T G C T C T ~ EÇCUTGCAGGTTGTCTACnTTC..

5 4 9 5 5601 5591 5581 5611

083 . . . G G G C T C T G C T C T m AC E Ç C U T G C A G G T T G T G T R C A T ' T C . . . 082

-085.. . T ' T T C A T C C C A V . . . < - D a 4

m C G T A G C C G G C T A G C v -ACGGGCGCTCTGC. . - 0 8 4

8 , ' g P 5

5571 5 5 4 8

085 . . . AGTCGTAGCCGGCTAGCSGIU&TGCC S C A G C A C A C G G G C G C T C T G C . . . 0 8 4 D O 5 . . . A G T C G T A G C C G G C T A G C W m A C G G G C G C T C T G C - - - 0 8 4

Figure 10. PCR Experiments to Detect lnversion of a Half Os in the Maize shm5933 Allele.

(A) Schematic representation of double Os at sh-m5933 before and afler bolh possible inversions. Primers are shown as small arrowheads. Primer D82 is homologous to the shrunken sequence. Primer D84 is homologous to a sequence within the 30-kb insert. Open boxes rep- resent the Bbp sequences flanking transposable element termini. Open and filled arrowheads are as given in Figure 1. Specific element ends and flanking sequences are identified by number. (E) Sequences around lhe junction points of inversions. Element ends (underlined by arrows) and flanking sequences (underlined) are num- bered as given in (A). Progenitor sequences show junctions of element ends and flanking sequences. Predicted sequences would result if lhe flanking sequences were joined exactly. Sequences recovered are shown below; bases in italics are insertions.

al., 1989; Fedoroff, 1989). Again, there are small deletions around the junction points. In products 5601, 5581, and 5571, there are additional complementary bases inserted at the junc- tion, a characteristic feature of transposable element empty sites (Coen et al., 1989).

DISCUSSION

We have established a system for assaying double Ds and other related structures for their ability to cause marker gene insta- bility in tobacco. T-DNA vectors carrying the cell-autonomous markers SPTand GUS were constructed. Structures to be as- sayed were cloned adjacent to SPT; and the resulting constructs were used to generate transgenic tobacco lines. We have characterized this system with respect to marker loss and marker gene reversion dueto a double Ds element (eDDs) and simple Ds elements (Ds4087 and Ds4735). The eDDs element causes instability of SPT and GUS expression when Ac activ- ity is present. Simple Ds does not. Simple Ds produces an

Our results strongly support the inference from work with maize that double Ds is involved in specific chromosome break- age (Courage-lebbe et al., 1983; Doring et al., 1989). In maize, where there are many (30 to 50) copies of Ds sequences pres- ent in most genomes (Geiser et al., 1982; Fedoroff et al., 1983), it is difficult to prove that a particular Ds element confers a given phenotype. The allele sh-m5933 is associated with chro- mosome breakage (Courage-Tebbe et al., 1983). Severa1 derivatives of sh-m5933 have been isolated that give an al- tered (later, less frequent) pattern of chromosome breakage. Molecular analysis of these derivatives showed that they no longer carried a double Ds structure (Courage-Tebbe et al., 1983; Doring et al., 1989). Only a half Ds element remained at the position where the double Ds-like structure, which is presumed to be responsible for chromosome breakage, had been. The interpretation of these experiments was that dou- ble Ds is responsible for chromosome breakage. We have shown that a half Ds element does not induce marker gene instability in tobacco. This is in agreement with the finding of Ralston et al. (1989), who showed that a 2.5-kb terminally deleted Ac element at the bronze locus in maize was not in- volved in chromosome breakage unless a closely linked, intact Ac element was present. These data suggest that the half Ds in the sh-m5933 derivatives could be interacting with a nearby, undetected element.

Experiments in which we dissected double Ds showed that the structural feature responsible for the marker loss observed was a left end and a right end of Ds in directorientation. Marker loss was not dependent on how the Ds ends were oriented relative to the marker gene. In L€,RE/SPT; the Ds ends point away from the SPT gene. In RE,L€/SPT; the Ds ends point to- ward the SPT gene. Thus, i f adjacent deletions extending out of the transposon were responsible for the instability observed, R€,L€/SPTwould give marker loss and Lf,R€/SPTwould not. This suggests that more complex events, such as the formation of acentric and dicentric chromatids leading to breakage-fusion- bridge cycles, are responsible for the marker loss observed.

Twenty independent transformants that carried left and right ends of Ds in direct orientation and were interpretable with

.

Os-lnduced Chromosome Breakage in Tobacco 51 1

respect to Ac-dependent instability of SPT expression were analyzed. In 18 of these, SPT expression was unstable when Ac activity was present. It is unlikely that all 18 had the SPT marker gene distal to the Os-derived elements that were be- ing assayed. This suggests that markers proximal as well as distal to the element can be lost, consistent with the idea that breakage-fusion-bridge cycles may be involved with the marker loss observed.

The frequency with which eDDslSPTgave rise to white sec- tors in response to Ac TPase was two- to threefold lower than the frequencyof green sectors with SPT::Ds. This could mean that not all events give rise to marker loss. For example, only half of the events that caused a deletion and a duplication would give rise to white sectors.

The observation that a left end and a right end of Os in di- rect orientation can induce marker gene instability dependent on the presence of Ac activity suggests that this type of struc- ture can participate in aberrant transposition events. DNA gel blot analysis of eDDslSPT plants that had lost SPT germinally (Figure 5) showed that DNA rearrangements accompanied marker loss, thereby supporting this idea.

Two models for double Ds-induced chromosome breakage based on aberrant transposition of directly repeated left and right Os ends have been proposed previously. The first, shown in Figure 7, is similar to the one proposed by Doring and Starlinger (1984). It predicts that a left end and a right end of Os in direct orientation, in unreplicated DNA or on the same chromatid, can participate in aberrant transposition events. The version presented here extends this idea, showing an in- sertion event associated with the aberrant transposition. One outcome would be formation of acentric and dicentric chro- matids leading to chromosome breakage. An alternative outcome is a sister chromatid exchange that would result in a deletion in one strand and a duplication in the other. If the element ends were inserted somewhere other than a sister chromatid, more complicated outcomes, including transloca- tions and ring chromosomes, would be predicted.

The second model, which is shown in Figure 8, assumes that there is an active strand selectivity mechanism associated with Ac TPase that can distinguish between the asymmetric DNA strands immediately following replication. Strand asym- metry could be mediated by hemimethylation of newly replicated DNA on opposite strands. In vitro experiments have shown that Ac TPase binds more strongly to hexamer motifs (AAACGG) methylated on a particular strand (Kunze and Starlinger, 1989). However, it is not known if this is of biologi- cal significance. Moreover, genomic sequencing experiments suggest that cytosine residues between positions 73 and 220 (at the 5‘ end) of Ac are not methylated in transgenic tobacco (Ott et al., 1992).

A strand selectivity mechanism would ensure that, when the substrate for transposition is a simple element, only element ends on the same DNA strand could be used. This would be consistent with genetic (Greenblatt, 1968, 1984) and molecu- lar (Chen et al., 1987, 1992) data from the P locus in maize, which also suggest that Ac transposition follows DNA replica-

tion. Directly repeated left and right Ds ends would be predicted to disrupt the strand selectivity of Ac TPase such that Os ends on different DNA strands could act as a substrate for transpo- sition. This would result in aberrant transposition events that would lead to chromosome breakage and the other types of chromosomal rearrangements mentioned above.

If aberrant transposition events involving directly repeated left and right Ds ends occurred, the formation of an empty site dueto ligation of flanking sequences after excision would be predicted. A consequence of this would be inversion of a half Ds element. PCR experiments detected this type of inversion in both tobacco and maize only when Ac activity was present. These results suggest that aberrant transposition events in- volving directly repeated left and right ends occur in both systems.

It is not clear why marker gene loss due to these aberrant transposition events occurs more frequently than simple exci- sion when the double Os structure is present. Apparently, directly repeated left and right Ds ends are preferred to ends in normal orientation as substrates for AC TPase when they are present together in double Os elements.

Dooner and Belachew (1991) have provided strong genetic evidence showing that closely linked Ac and Os elements can cause breakage of maize chromosome 9s. A model based on transposition of a macrotransposon spanning two closely linked elements and the intervening DNA explains these results (Ralston et al., 1989).

The models presented here can also be applied to closely linked Ac and Os elements. Both models can be applied to closely linked elements in opposite orientation. Two Os ele- ments that are closely linked and in opposite orientation contain left and right ends of Os in direct orientation. If these Os ends acted as a substrate for Ac TPase, either model would predict the same types of outcomes as for double Os.

The strand selectivity model would not apply to closely linked elements in direct orientation, because there are no left and right ends of Os in direct orientation present to disrupt the strand selectivity of Ac TPase. However, a variation of the model il- lustrated in Figure 7 could be applied to this type of structure. If the interna1 left and right ends of a pair of elements in direct orientation served as a substrate for Ac TPase, acentric and dicentric chromatids could be formed leading to chromosome breakage. lnstead of inverting a half Os, formation of an empty site would produce a circle including the sequence between the two elements.

None of the models described here is mutually exclusive. However, they do make different predictions about the struc- tures that may give rise to chromosome breakage and about the structures that may result. The recovery of “post break- age” or “post rearrangement” structures from known starting structures would permit further testing of these models.

Experiments designed to elucidate the mechanism of dou- ble Os-induced chromosome breakage should be very interesting. In addition to answering a historically interesting question, these experiments may have broader implications with regard to the mechanism of normal AclDs transposition.

512 The Plant Cell

The aberrant events that result in chromosome breakage and other rearrangements probably follow the same rules as sim- ple transposition. When these rules are applied to the directly repeated left and right Ds ends present in double Ds, some fundamental property of the transposition process is altered such that aberrant outcomes result. The models described here provide possible explanations for how this might happen, but they make different assumptions about the rules of normal transposition. The strand selectivity model requires that AclDs transposition is intimately associated with DNA replication and that A c TPase can distinguish between the newly replicated strands in some way. If we can deduce the mechanism of dou- ble Ds-induced chromosomal rearrangements, it will allow us to address these fundamental aspects of AclDs behavior from a new and different point of view; this may help us to better understand normal AclDs transposition.

METHODS

DNA Constructions

Recombinant plasmids were constructed by standard techniques (Sambrook et al., 1989).

Activator Transposase Sources

pSW1804 (sAc) was derived from pSLJ10512 (Scofield et al., 1992) by digesting with Clal and recircularizing to remove the P-glucuronidase (GUS) coding sequence. A cauliflower mosaic virus (CaMV) 35s pro- moter fusion to the Activator (Ac) transposase gene pSW1811 (35S:TPase) was derived from pSLJl l l l (Scofield et al., 1992) in the same way. A polymerase chain reaction (PCR)-generated cDNA copy of the Ac transposase gene (J. English, unpublished data) was cloned as a 25-kb Sstl-Bglll fragment behind a CaMV 35s promoter in pSLJ532 (Jones et al., 1992) digested with BamHl and Sstl, resulting in pSLJ177B2 (35S:Ac DNA).

Dissociation Elements

A 3-kb Dissociation (Ds) element, pSLJ1231, was made by digesting pSLJ7C3 with Hindlll and recircularizing. This Ds element was cloned as a 3-kb EcoRl (Klenow fragment of DNA polymerase I fill in)-Sal1 fragment into pSLJ7C3 between Nrul (Klenow fragment fill in) and Xhol to yield pSW1324 (engineered double Os, eDDs). pSW13019 was made by inserting the GUS coding sequence from pSLJ4J8 (Jones et al., 1992) as a Clal fragment into pCLOlOl (Dean et al., 1992) behind the Agrobacterium tumefaciens 2' promoter (Velten et al., 1984). pSLJ1336 (e0Dslstreptomycin phosphotransferase [Sm) was constructed by clon- ing eDDs from pSLJ1324 as an EcoRI-Sal1 (Klenow fragment fill in) fragment into the Hpal site of pSLJ13019. pSLJ1856 (SPT::eDDs) was made by cloning eDDs as an Sstl-Sal1 fragment into pSW1502 (Jones et al., 1992) digested with Sstl and Xhol. pJJ4081 (SPPDs) has been described previously (Jones et al., 1990).

was then cloned as a 680-bp Haell (T4 DNA polymerase plus deoxy- ribonucleotide triphosphates) fragment into the Hpal site. The series of constructs based on pSLJ4061 was made by cloning fragments of Ac and Os, as indicated below, into the appropriate sites of the dBS+ polylinker.

pSLJ4074 (L€,L€/SP7) was made by a three-way ligation of a pJJ4368 (Jones et al., 1992) Sstl-Mlul (Klenow fill in) 0.5-kb fragment and a pJJ4361 (Jones et al., 1992) Sall-Pvull 1.3-kb fragment into pSLJ4061 between the Sstl and Xhol sites. pSLJ40813 (R€,R€/SPT) was made by a three-way ligation of a pJJ4368 Sall-EcoRI (Klenow fill in) 2-kb fragment and a pJJ4361 Sstl-Pvul10.8-kb fragment into pSLJ4061 be- tween the Sstl and Xhol sites. pSLJ4092 (Ds::Ac/SPT) was made by inserting the 6.2-kb Sstl-Sal1 fragment carrying Ac in Dsfrom pSLJ13510, which is analogous to pSLJ1324, into pSLJ4061 between the Sstl and Xhol sites. pSLJ41018 (AcISPT) was made by inserting the 4.6-kb Sstl- Sal1 fragment from pJJ4368 into pSLJ4061 between the Sstl and Xhol sites. pSLJ4115 (AcISPT) was made by inserting the 4.6-kb Sstl-Sal1 fragment from pJJ4361 into pSLJ4061 between the Sstl and Xhol sites. pSLJ4123 (eDDslSP7) was made by inserting the 4.6-kb Sstl-Sal1 frag- ment from pSLJ1324 into pSW4061 between the Sstl and Xhol sites. pSLJ4135 (DsISPT) was made by inserting the 3-kb Sstl-Sal1 fragment from pSW1231 into pSW4061 between the Sstl and Xhol sites. pSW4146 (L€,R€/SPT) was made by inserting the 3.5-kb EcoRI-Sstl fragment from pSLJ13510 into pSLJ4061 between the Sstl and EcoRl sites. pSW4156 (R€,L€/SPT) was made by inserting the 2.6-kb EcoRI- Sal1 fragment from pSLJ13510 into pSLJ4061 between the EcoRl and Xhol sites. pSLJ4168 (REISPT) was made by inserting the 2-kb EcoRI- Sal1 fragment from pJJ4368 into pSLJ4061 between the EcoRl and Xhol sites. pSLJ4177 (L€/SfT) was made by inserting the 2.6-kb EcoRI- Sal1 fragment from pJJ4361 into pSW4061 between the EcoRl and Xhol sites.

Plant Transformation

All transformations were performed with the streptomycin-sensitive tobacco (Nicotiana tabacum) cultivar Petite Havana. Binary T-DNA con- structs were mobilized into A. tumefaciens LBA4404 (Hoekema et al., 1983). Transgenic tobacco plants were regenerated as described by Horsch et al. (1985).

Visualization of the Streptomycin Resistance Phenotype

Transgenic seed were germinated on medium consisting of Murashige and Skoog salts (ICN Biomedicals Inc., Costa Mesa, CA), 0.8% agar with 1% glucose, and 300 pglmL streptomycin (Maliga et al., 1988; Jones et al., 1989). Variegation was visualized 10 to 14 days after plat- ing of seed.

GUS Staining

Histochemical staining of seedlings for GUS activity was performed using 5-bromo-4-chloro-3-indolyl glucuronide (X-gluc) as described by Jefferson et al. (1987).

Constructs Used to Dissect Double Ds .. ' ,

pSLJ4061 was made by digesting pSLJ13Oi9 with Sstl and Xhol, treating with T4 DNA polymerase to remove those restriction sites, and recir- cularizing; a darkBluescript (dBS+) lacZ region (Jones et al., 1992)

DNA Gel Blot Analysis

Large-scale DNA preparations were performed as described below (E. Ralston, persónal communication). Leaf materral(l0 to 15 g) was

Ds-lnduced Chromosome Breakage in Tobacco 513

harvested and immersed in liquid nitrogen. The frozen leaves were then ground in a coffee grinder in the presence of dry ice and trans- ferred to an ice-cold beaker; 15 to 20 mL of ice-cold extraction buffer was added (100 mM Tris-HCI, pH 9.0, 100 mM NaCI, 10 mM MgCI2, 0.5 M sucrose, 0.1% [vlv] P-mercaptoethanol, and 0.4% [wlv] sodium diethyldithiocarbamate). The sample was then transferred to a plastic centrifuge tube and centrifuged for 2 min at 10,000 rpm in a Sorvall SS34 rotor at 4OC. The supernatant was discarded and the pellet resuspended in 1 to 2 mL of extraction buffer before the addition of 7 mL of lysis buffer (100 mM Tris-HCI, pH 8.3, 100 mM NaCI, 50 mM EMA, 1.5% [w/v] SDS, and 15% [vlv] phenol). After a 5-min incuba- tion at 55OC, 3 mL of 5 M potassium acetate was added, and the tubes were immersed in ice for 10 min. After a 10-min centrifugation at 4OC in a bench top centrifuge, 1 mL of 10 M ammonium acetate and 5 mL of chloroformlisoamyl alcohol were added to the supernatant. The tubes were extensively vortexed and the phases were separated by centrifu- gation (5 min in a bench top centrifuge). Nucleic acids were precipitated by the addition of an equal volume of isopropanol, spooled out with a heat-sealed Pasteur pipette, washed in 80% ethanol, and dissolved in 4 mL of water. RNA was removed by adding 2 mL of 10 M ammo- nium acetate, incubating on ice for 10 min, and centrifuging in a bench top centrifuge (5 min at 4OC). DNAwas precipitated from the superna- tant with isopropanol, spooled out, washed in 80% ethanol, and finally dissolved in 10 mM Tris, pH 8, 1 mM EDTA.

Genomic DNA (10 pg) was digested with the appropriate restriction enzyme and separated on 1% agarose gels. DNA was transferred to GeneScreen Plus hybridization membranes (Du Pont-New England Nuclear) by capillary blotting. The resulting filters were probed with gel-purified DNA fragments that were labeled with phosphorus-32 by the random priming method (Feinberg and Vogelstein, 1983).

PCR Analysis

Steve Scofield, Cliff Weil, Sue Wessler, and Enrico Coen for helpful discussion; Hugo Dooner for training and helpful discussions; and Advanced Genetic Sciences (now DNA Plant Technology, Oakland, CA) for its generous help in making available DNA plasmids made while J.D.G.J. was an employee. We also thank Barry Allen, Andrew Davies, &ter Scott, and Nigel Hannant for their excellent photographic work. Research at the Sainsbury Laboratory is supported by a grant from the Gatsby Charitable Foundation.

Received January 19, 1993; accepted March 8, 1993.

REFERENCES

Chen, J., Greenblatt, I.M., and Dellaporta, S.L. (1987). Transposi- tion of Ac from the P locus of maize into unreplicated chromosomal sites. Genetics 117, 109-116.

Chen, J., Greenblatt, I.M., and Dellaporta, S.L. (1992). Molecular analysis of Ac transposition and DNA replication. Genetics 130,

Clausen, R.E., and Cameron, D.R. (1944). lnheritance in Nicotiana tabacum. XVIII. Monosomic analysis. Genetics 29, 447-476.

Coen, E.S., Robbins, T.P., Almeida, J., Hudson, A., and Carpenter, R. (1989). Consequences and mechanisms of transposition in An- tirrhinum majus. In Mobile DNA, D.E. Berg, and M.M. Howe, eds (Washington, DC: American Society for Microbiology), pp. 413-436.

Courage-Tebbe, U., Doring, H.-P., Fedoroff, N.V., and Starlinger, P. (1983). The controlling element Ds at the Shrunken locus in Zea mays: Structure of the unstable sh-m5933 allele and severa1 revertants. Cell 34, 383-393.

665-676.

To isolate DNA for PCR analysis, the protocol of Lassner et a!. (1989) Dean, c‘, ’iodin, ‘., Jones, J’D*G., and Lister, (lgg2)‘ Behaviour of the maize transposable element Ac in Arabidopsis fhaliana, ‘Iant J‘ 2’ 69-81’

Dooner, H.K.9 and Belachew, A. (1991). Chromosome breakage by pairs of closely linked transposable elements of the Ac-Ds family in maize. Genetics 129, 855-862.

was followed. PCR was performed in a thermocycler using the condi- tions recommended by the manufacturer (Perkin-Elmer-Cetus). A thermal profile of 35 cycles of 94OC for 15 sec, 55OC for 15 sec, and 72OC for 1 min followed by 10 min at 72OC was used. PCR primers used are as follows: D82, CAATGAGGATCTTCGGAGTG (Ds flanking sequence nucleotides 4265 to 4284 as numbered in Doring et al., 1984); D83, CAGGTGCTCACAAGEACAG (Ac nucleotides 3280 to 3299); D84, GCAGAAAGGGTAACTTCGTTC (Ds flanking sequence nucleotides 39 to 58 as numbered in Doring et al., 1984); D85, GCAAATTAATAGCC- CATGCAC (Ac nucleotides 991 to 1011); M13+, M13 “forward” sequencing primer; J1, CGACAGCAAACAGCCCATG (Ac nucleotides 863 to 881); M13-, M13 “reverse” sequencing primer; J2, GCAGACGCCGCCATCCACG (Ac nucleotides 4002 to 4020).

Maize Stocks

Maize seed carrying the shrunken (sh)-m5933 allele (McClintock, 1953b; Courage-Tebbe et al., 1983) was kindly provided by Peter Starlinger, University of Cologne, Germany.

ACKNOWLEDGMENTS

This paper is dedicated to the memory of Barbara McClintock in honor of her incomparable contribution to this and other fields. We thank

Dooner, H.K., English, J., and Ralston, E.J. (1988). The frequency of transposition of the maize element Acfivator is not affected by an adjacent deletion. MOI. Gen. Genet. 211, 485-491.

Doring, H.-P., and Starlinger, P. (1984). Barbara McClintocks con- trolling elements: Now at the DNA level. Cell 39, 253-259.

Doring, H.-P., Tillmann, E., and Starlinger, P. (1984). DNA sequence of the maize transposable element Dissociation. Nature 307,127-131.

Dbring, H.-P., Nelsen-Salz, B., Garber, R., and Tillmann, E. (1989). Double Ds elements are involved in specific chromosome break- age. MOI. Gen. Genet. 219, 299-305.

Doring, H.-P., Pahl, I., and Durany, M. (1990). Chromosomal rear- rangements caused by the aberrant transposition of double Ds elements are formed by Ds and adjacent non-Ds sequences. MOI. Gen. Genet. 224, 40-48.

Fedoroff, N. (1983). Controlling elements in maize. In Mobile Genetic Elements, J. Shapiro, ed (New York: Academic Press), pp. 1-63.

Fedoroff, N.V. (1989). Maize transposable elements. In Mobile DNA, D.E. Berg and M.M. Howe, eds (Washington, DC: American Soci- ety for Microbiology), pp. 375-411.

Fedoroff, N., Wessler, S., and Shure, M. (1983). lsolation of the trans- posable maize controlling elements Ac and Ds. Cell 35, 235-242.

514 The Plant Cell

Feinberg, A.P., and Vogelstein, 5 (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6-13.

Geiser, M., Weck, E., Doring, H.-P., Werr, W., Courage-Tebbe, U., Tillmann, E., and Starlinger, P. (1982). Genomic clones of a wild type allele and a transposable element-induced mutant allele of the sucrose synthase gene of Zea mays L. EMBO J. 1, 1455-1460.

Greenblatt, I.M. (1968). The mechanism of Modulator transposition in maize. Genetics 85, 585-597.

Greenblatt, I.M. (1984). A chromosome replication pattern deduced from pericarp phenotypes resulting from movements of the trans- posable element, Modulator, in maize. Genetics 108, 471-485.

Hobbs, S.L.A., Kpodar, P., and Delong, C.M.O. (1990). The effect of T-DNA copy number, position and methylation on reporter gene expression in tobacco transformants. Plant MOI. Biol. 15, 851-864.

Hoekema, A., Hirsch, P.R., Hooykaas, P.J.J., and Schilpemort, R.A, (1983). A binary plant vector strategy based on separation of vir- and T-region of the Agrobacterium tumefaciens Ti-plasmid. Nature

Horsch,R.B., Fry, J.E.,Hoffmann, N.L., Eichholtz,D., Rogers,S.G., and Fraley, R.T. (1985). A simple and general method of transfer- ring genes into plants. Science 227, 1229-1231.

Jefferson, R.A., Kavanagh, T.A., and Bevan, M.W. (1987). GUS fu- sions: P-Glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EM60 J. 6, 3901-3907.

Jones, J.D.G., Carland, F., Maliga, P., and Dooner, H.K. (1989). Vi- sual detection of transposition of the maize element Activator (Ac) in tobacco seedlings. Science 244, 204-207.

Jones, J.D.G., Carland, F., Lim, E., Ralston, E., and Dooner, H.K. (1990). Preferential transposition of the maize element Activator to linked chromosomal locations in tobacco. Plant Cell 2, 701-707.

Jones, J.D.G., Shlumukov, L., Carland, F., English, J., Scofield, S., Bishop, G., and Harrison, K. (1992). Effective vectors for trans- formation, expression of heterologous genes, and assaying transposon excision in transgenic plants. Transgenet. Res. 1,

Kunze, R., and Starlinger, P. (1989). The putative transposase of trans- posable element Ac from Zea mays L. interacts with subterminal sequences of Ac. EM60 J. 8, 3177-3185.

Lassner, M.W., Peterson, P., and Yoder, J.I. (1989). Simultaneous amplification of multiple DNA fragments by polymerase chain reac- tion in the analysis of transgenic plants and their progeny. Plant MOI. Biol. Rep. 7, 116-128.

Maliga, P., Svab, Z., Harper, E.C., and Jones, J.D.G. (1988). lmprwed expression of streptomycin resistance in plants due to a deletion

303, 179-180.

285-297.

in the streptomycin phosphotransferase coding sequence. MOI. Gen. Genet. 214, 456-459.

Matzke, M.A., Primig, M., Trnovsky, J., and Matzke, A.J.M. (1989). Reversible methylation and inactivation of marker genes in sequen- tially transformed tobacco plants. EM60 J. 8, 643-649.

McClintock, 6. (1947). Cytogenetic studies of maize and Neumspora. Carnegie Inst. Washington Yearbook 46, 146-152.

McCllntock, B. (1948). Mutable loci in maize. Carnegie Inst. Washington Yearbook 47, 155-169.

McClintock, 6. (1949). Mutable loci in maize. Carnegie Inst. Washington Yearbook 48, 142-154.

McClintock, 6. (1951). Mutable loci in maize. Carnegie Inst. Washington Yearbook 50, 174-181.

McClintock, 6. (1953a). lnduction of instability at selected loci in maize. Genetics 38, 579-599.

McClintock, B. (1953b). Mutation in maize. Carnegie Inst. Washing- ton Yearbook 52, 227-237.

Napoli, C., Lemieux, C., and Jorgensen, R. (1990). lntroduction of a chimeric chalcone synthase gene into petunia results in revers- ible co-suppression of homologous genes in trans. Plant Cell 2,

Ott, T., Nelsen-Salz, E., and Doring, H.-P. (1992). PCR-aided genomic sequencing of 5’subterminal sequences of the maize transposable element Activator (Ac) in transgenic tobacco plants. Plant J. 2,

Ralston, E., English, J., and Dooner, H.K. (1989). Chromosome- breaking structure in maize involving a fractured Ac element. Proc. Natl. Acad. Sci. USA 86, 9451-9455.

Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular Clon- ing: A Laboratory Manual, 2nd ed. (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press).

Scofield, S.R., Harrison, K., Nurrish, S.J., and Jones, J.D.G. (1992). Promoter fusions to the Acfivator transposase gene cause distinct patterns of Dissociation excision in tobacco cotyledons. Plant Cell

Velten, J., Velten, L., and Schell, J. (1984). lsolation of a dual plant promoter fragment from the Ti plasmid of Agrobacterium tumefa- ciens. EM60 J. 3, 2723-2730.

Weck, E., Courage, U., Doring, H.-P., Fedoroff, N.V., and Starllnger, P. (1984). Analysis of shm6233, a mutation induced by the-trans- posable element Ds in the sucrose synthase gene of Zea mays.

Well, C:F., and Wessler, S.R. (1993). Molecular evidence that chro- mosome breakage by Ds elements is caused by aberrant transposition. Plant Cell 5, 515-522.

279-289.

705-712.

4, 573-582.

EMBO J. 3, 1713-1716.

DOI 10.1105/tpc.5.5.501 1993;5;501-514Plant Cell

J English, K Harrison and J D JonesA genetic analysis of DNA sequence requirements for Dissociation state I activity in tobacco.

 This information is current as of June 22, 2017

 

Permissions https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298X

eTOCs http://www.plantcell.org/cgi/alerts/ctmain

Sign up for eTOCs at:

CiteTrack Alerts http://www.plantcell.org/cgi/alerts/ctmain

Sign up for CiteTrack Alerts at:

Subscription Information http://www.aspb.org/publications/subscriptions.cfm

is available at:Plant Physiology and The Plant CellSubscription Information for

ADVANCING THE SCIENCE OF PLANT BIOLOGY © American Society of Plant Biologists