Proc. Nati. Acad. Sci. USAVol. 91, pp. 11562-11566, November 1994Genetics

Reporter genes and highly regulated promoters as tools fortransformation experiments in Volvox carteri

(green algae/chimeric genes/arylsulfatase/sex pheromone/extraceliular glycoprotein ISG)

ARmIN HALLMANN* AND MANFRED SUMPERLehrstuhl Biochemie I, Universitlit Regensburg, D-93053 Regensburg, Germany

Communicated by Richard C. Starr, July 8, 1994

ABSTRACT The multicellular alga Volvox is an attractivemodel for the study of developmental processes. With therecent report of successfu transformation, regulated promot-ers as well as reporter genes working in this organism are nowrequired. The Volvox genes encoding arylsulfatase and theextracellular glycoprotein ISG are strictly regulated. The for-mer is transcribed only under conditions of sulfur starvation,whereas the latter operates under extreme developmentalcontrol-i.e., it is transcribed for only a few minutes in Volvoxembryos at the stage of embryonic inversion. The gene encod-ing the sexual pheromone of Volvox carteri was placed underthe control of the arylsulfatase promoter. In response to sulfurdeprivation, V. carteri tnsormed by this construct synthe-sized and secreted biologically active pheromone. In addition,the gene encoding Volvox arylsulfatase was placed under thecontrol of the ISG promoter. Transformed algae synthesizedarylsulfatase mRNA only during embryonic inversion. Theseexperiments demonstrate the usefulness of both the arylsulfa-tase and the sexual pheromone reporter genes. In addition, thehighly regulated arylsulfatase promoter allows the constructionof inducible expression vectors for cloned genes.

Members of the genus Volvox are multicellular photoau-totrophic organisms and each individual is composed of onlytwo cell types: mortal somatic cells and immortal reproduc-tive cells. In addition, these haploid green algae are capableof both sexual and asexual reproduction. Its simple devel-opmental program makes Volvox an attractive model systemfor studying the mechanism of cellular determination anddifferentiation by physiological, biochemical, and geneticinvestigations (reviewed in refs. 1 and 2). A number of genesputatively involved in the control ofdevelopmental processeshave been cloned (3-6), and a large number ofdevelopmentalmutants have been described (7-9). However, a seriousdrawback for molecular biological investigations in this or-ganism was the lack of a reliable technique for genetictransformation. Recently, a Volvox transformation methodwas established by using a helium-flow device to bombardcells with DNA-coated gold particles (10). To allow theapplication of efficient molecular genetic approaches, re-porter genes as well as appropriate promoters working in thisorganism are now required.A strong candidate for a homologous reporter gene in

Volvox is the arylsulfatase gene (11). Volvox arylsulfatase isa periplasmic enzyme that cleaves sulfate from aromaticcompounds and is therefore readily assayed with chromo-genic substrates. Because this enzyme is stable in detergents,it is readily assayed even in crude cell lysates. Furthermore,the enzyme is expressed only under sulfur starvation and noactivity is detectable in cells grown in standard sulfate-containing medium. Since the arylsulfatase production is

regulated at the transcriptional level (11), the promoter of thearylsulfatase gene is likely to provide a tool for producinginducible expression vectors for cloned genes.Another highly regulated promoter, which might be useful

as an alternative to the inducible arylsulfatase promoter, isprovided by the gene encoding the extracellular glycoproteinISG. This gene, which is developmentally regulated, is tran-scribed only for about 10 min in the 48-hr life cycle of Volvoxcarteri (3, 12).The sexual pheromone of V. carteri is an attractive alter-

native to the arylsulfatase as a reporter gene. This sex-inducing pheromone is a glycoprotein synthesized and re-leased by sperm cells ofmale strains (4-7, 13-15). Extremelylow concentrations of the pheromone convert asexuallygrowing males and females to the sexual pathway. Thisallows sensitive detection of gene expression, as sexuallyinduced algae are easily indentified by inspection with astereo microscope.

In this paper we describe two reporter gene systems in V.carteri-the sexual pheromone expressed under the controlof the arylsulfatase promoter and arylsulfatase expressedunder the control of the ISG promoter-and thereby showthat these promoters and reporter genes can serve as tools fortransformation experiments in Volvox.

MATERIALS AND METHODSRecipient Strain. The strain 153-48 used as DNA recipient

is an F1 female progeny ofHB11A, a female strain of Volvoxcarteri f. nagariensis that has previously been described(16). This strain-with wild-type morphology inherited fromHB11A, a stable mutant allele that confers resistance tochlorate-has lost the ability to utilize nitrate as a nitrogensource and is therefore inferred to be the result of a stableloss-of-function mutation of nitA, the structural gene encod-ing nitrate reductase (17). Strain 153-48 was obtained from R.Schmitt, University of Regensburg.

Culture Conditions. Synchronous Volvox recipients weregrown in Volvox medium (18) at 280C in an 8-hr dark/16-hrlight (10,000 lx) cycle (14). The nonselective medium usedwas Volvox medium supplemented with 1 mM NH4Cl; se-lective medium was Volvox medium lacking NH4Cl, contain-ing only nitrate as a nitrogen source. In Volvox mediumlacking sulfate, MgSO4 was replaced by MgCl2.Gene Splicing by Overlap Extension (Gene SOEing). The

gene SOEing technique was performed as described byHorton et al. (19). To construct the arylsulfatase/sexualpheromone hybrid DNA fragment, the first polymerase chainreaction (PCR) was performed on arylsulfatase A phage cloneA5/2 (11) with a 20-mer 5' sense primer (5'-TTCCGACCT-TCCGACCGACG-3') and a 50-mer 3' antisense primer (5'-CAGAATTGACTACCACTACTGCCATCCTGCACGC-CGACATGGTGTTGTCC-3') with only half of the primer

Abbreviation: SOEing, splicing by overlap extension.*To whom reprint requests should be addressed.

11562

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Proc. Natl. Acad. Sci. USA 91 (1994) 11563

matching. The second PCR was performed on sexual pher-omone A clone Ind-28 (5) with a 20-mer 3' antisense primer(5'-ACAGCCATGAAGACCCTGCG-3') and a 50-mer 5'sense primer (5'-GGACAACACCATGTCGGCGTGCAG-GATGGCAGTAGTGGTAGTCAATTCTG-3'), again withonly half of the primer matching. The third PCR was carriedout with both these PCR products and only the flankingprimers. To construct the ISG/arylsulfatase hybrid DNAfragment, exactly the same strategy was applied. Therefore,the first PCR was performed with a genomic A clone encodingISG (3), a 19-mer 5' sense primer (5'-GACGAAGCGCTG-GCATGTC-3'), and a 34-mer 3' antisense primer (5'-CGACCAATCGTTGCAACATCCTAACCCAAACGGC-3'). The second PCR was performed with the arylsulfataseclone A5/2 (11), a 17-mer 3' antisense primer (5'-TCTTGAGCTCAATGCCG-3') and a 34-mer 5' sense primer(5'-GCCGTTTGGGTTAGGATGTTGCAACGATTG-GTCG-3'). The third PCR was performed in the presence ofboth these PCR products and the flanking primers only. PCRswere carried out in PCR buffer (50 mM Tris HCl, pH 8.5/50mM NaCl/2.5 mM MgCl2/2 mM dithiothreitol) containing 50pmol of sense and antisense primers. Thirty cycles of PCRamplification (94TC, 45 sec; 500(, 30 sec; 720(, 40 sec) wereperformed.

Cloning. The final construction of the arylsulfatase/sexualpheromone chimeric gene containing a 2.3-kb fragment ofthearylsulfatase 5' region derived from arylsulfatase clone A5/2(11) and the coding region for the sexual pheromone (3.6 kb)derived from A clone Ind-28 (5) was performed by standardtechniques (20), yielding a plasmid designated pArInK2/1.The ISG/arylsulfatase chimeric gene was generated by usinga 2.9-kb fragment of the 5' region derived from the ISGgenomic A clone (3) that was fused to a 10.0-kb fragmentcontaining the coding region of the arylsulfatase genomicsequence (11) in pUC18, yielding a plasmid designated pISG-ArK2/40. In both cases, the fusion regions were generated bythe gene SOEing technique. Products of cloning were se-quenced by the chain-termination method (21).

Preparation ofPlasmid DNA. Plasmid DNAs were preparedas described by Hattori and Sakaki (22). Final purification ofthe plasmids was achieved by CsCl density gradient centrif-ugation (20).

Transformation. V. carteri strain 153-48 was transformedby using flowing helium to bombard cells with DNA-coatedgold particles (10, 23). Plasmid pArInK2/1, carrying thesexual pheromone coding sequence under the control of thearylsulfatase promoter, and plasmid pISGArK2/40, carryingthe arylsulfatase coding sequence under the control of theISG promoter, were each introduced into V. carteri strain153-48 by cotransformation with plasmid pVcNR1 (10, 24).Plasmid pVcNR1 contains =5.8 kb ofthe coding region oftheV. carteri nitA gene plus =1 kb of downstream and =1 kb ofupstream DNA in the vector pBS(+) (Stratagene) (24) andwas therefore used to complement the stable nitA mutation inV. carteri strain 153-48.

Particles for transformation were prepared for use bymixing the plasmids and a sterile aqueous suspension of goldparticles (1-3 ,um in diameter; Aldrich) in the desired pro-portions. Then, 0.1 volume of 3 M NaOAc and 2.5 volumesof ethanol were added, and after incubation at -20°C for atleast 1 hr, particles were collected by centrifugation, washedonce with 70% ethanol, and finally resuspended in ethanol.Recipient cultures of strain 15348 were collected on a100-,um nylon screen shortly before or after the onset ofembryonic cleavages. The spheroids were broken up byforcing them through a 0.5-mm hypodermic needle. The cellsuspension was filtered through a 100-gim nylon screenthrough which only free gonidia, free embryos, and singlesomatic cells can pass. Gonidia and embryos were thencollected by low-speed centrifugation. The centrifugation

step was repeated several times and the supernatant, whichcontained some somatic cell sheets, was discarded each timeand replaced with fresh medium. The resulting target cellswere resuspended in selective Volvox medium lackingNH4Cl. They were then bombarded by the method of Ta-keuchi et al. (23). Bombarded cultures were observed fromthe sixth day after transformation on, and each green orga-nism was transferred into a microtiter well with fresh selec-tive Volvox medium. Putative transformants were tested forrestoration of chlorate sensitivity by cultivation in 8 mMpotassium chlorate in Volvox medium (10).

Assay of Sexual Pheromone Activity. Volvox transformantswere collected on a nylon screen. After extensive washingwith Volvox medium lacking sulfate, the algae were incubatedin sulfate-free medium (500 p1) under standard conditions for9 hr in microtiter wells. At the end of this period, sulfate wasadded and the algae were further incubated. Alternatively,the sulfur-starved algae were removed and 0.1 volume of theculture medium was added to algae grown in sulfur-sufficientmedium. Sexually induced algae were indentified by inspec-tion under a stereo microscope.

Assay of Arylsulfatase Activity. Volvox transformants werecultivated in 500 A4 in microtiter wells. Four microliters of 30mM 5-bromo4-chloro-3-indolyl sulfate was added and cul-tures were further incubated at 280C. Algae expressing aryl-sulfatase were identified by their blue color.PCR with RNA from 20 Volvox Spheroids. Twenty Volvox

spheroids after their release from the mother spheroid wereselected under a stereo microscope and transferred into 20 p1 ofsterile lysis buffer (50 mM Tris HCl, pH 8.0/300 mM NaCl/5mM EGTA/2% SDS). After 10 min at 300C, Volvox spheroidswere removed under the stereo microscope and RNA wasprecipitated with 60 p1 of ethanol. The precipitate was washedin 70%o ethanol and dissolved in 10 A1 of reverse transcriptasebuffer [50 mM Tris HCl, pH 8.3/40 mM KC1/6 mM MgCl2/1mM dithiothreitol/l mM dNTPs with RNAguard (Pharmacia)at 1 unit/p1]. Antisense primers 5'-CGTGCAGAGCCCAA-CAG-3' (sexual pheromone) and 5'-GGATGCGTGGAGT-TCTG-3' (arylsulfatase) (50 pmol of each) were added to RNAderived from transformants containing the arylsuifatase pro-moter/sexual pheromone chimeric gene. Antisense primers5'-GTTCTGTAGCCAGACAG-3' (arylsulfatase) and 5'-GGGAGTAGACTGTCCTC-3' (ISG) (50 pmol of each) wereadded to RNA derived from transformants containing the ISGpromoter/arylsulfatase chimeric gene. Reverse transcriptionwas carried out with 100 units of Moloney murine leukemiavirus reverse transcriptase (Pharmacia) for 60 min at 40WC; then90 A1 of PCR buffer containing 100 pmol of sense primer(5'-TGCTGCAACTGCGGAGG-3', for transformants contain-ing the arylsulfatase promoter/sexual pheromone chimericgene, or5'-TAAGTAGTAACACGTACG-3', for transformantscontaining the ISG promoter/arylsulfatase chimeric gene) wasadded, and 38 cycles of PCR amplification (94°C, 45 sec; 54°C,30 sec; 720C, 45 sec) were performed. Products ofPCR ampli-fication were ligated into the Sma I site of pUC18 and se-quenced by the chain-termination method (21).

RESULTS AND DISCUSSIONArylsulfatase Promoter/Sexual Pheromone Construct. V.

carteri genomic clones encoding arylsulfatase (11) and thesexual pheromone (5) were used to construct a chimeric geneconsisting of the promoter region of the arylsulfatase geneand the coding region of the sexual pheromone gene. Thefusion region (between the Xho I and Apa I restriction sites)was generated by the gene SOEing technique (19). Thegeneral mechanism is illustrated in Fig. 1. The gene SOEingtechnique is a fast and extremely powerful way of recom-bining and modifying nucleotide sequences. The completeconstruct, pArInK2/1, is shown in Fig. 2A. The arylsulfatase

Genetics: Hallmann and Sumper

11564 Genetics: Hallmann and Sumper

- Gene Ia

1- , IATG Gene ll

|- I

dPCR 1 ATG

ATG PCR

ATG

TG.

a ; ~PCR 3

ATGI ..

.... ,._... .

FIG. 1. Construction of the overlap region in chimeric geneconstructs by gene SOEing. The segments to bejoined (fragment a-bfrom gene I and fragment c-d from gene II) were amplified in separatePCRs (PCRs 1 and 2). Primers b and c are complementary to oneanother; half of their nucleotide sequence is derived from gene I andthe other half from gene II. This causes both PCR products to sharehomologous sequences at the ends to bejoined. The presence ofboththese products and the primers a and d in the third PCR mixtureallows the amplification of the recombinant product. The PCRproduct is digested with the restriction enzymes RE 1 and RE 2 asindicated and cloned as described in the text.

part of this construct starts 2.3 kb upstream of the start codonand ends with the base preceding the ATG start codon of thearylsulfatase coding sequence. The sexual pheromone genecontributes the ATG start codon followed by the completecoding region and, in addition, 3' untranslated sequenceending 0.1 kb downstream of the transcription terminationpoint.ISG Promoter/Arylsulfatase Construct. The chimeric gene

consisting of the promoter region of the ISG gene (3) and thecoding region of the arylsulfatase gene (11) was constructedin the same manner by using the corresponding genomicclones. Again, the fusion region (between the BamHI andEcoRI restriction sites) was generated by the gene SOEingtechnique (Fig. 1). The resulting construct, pISGArK2/40, is

A arylsulfatase5'sequence

shown in Fig. 2B. The ISG part of the construct starts 2.9 kbupstream of the start codon and ends with the base precedingthe ATG start codon of the ISG coding sequence. Thearylsulfatase part starts with the ATG start codon of thearylsulfatase sequence and ends 2.2 kb downstream of thestop codon.

Transformation. For transformation, flowing helium wasused to bombard the reproductive cells with DNA-coatedgold particles (23). Plasmids pArInK2/1 and pISGArK2/40were each introduced into the V. carteri nitrate-utilizingmutant strain 153-48 by cotransformation with pVcNR1 (10,24). The latter plasmid contains the nitrate reductase gene,which complements the loss-of-function mutation ofnitA andenables transformants of 153-48 to grow on medium contain-ing nitrate as a sole nitrogen source (10).

Sexual Pheromone Activity in Response to Sulfur Depriva-tion. To identify cotransformants containing the arylsulfatasepromoter/sexual pheromone chimeric gene, transformantswere incubated in sulfate-free medium for 9 hr. After thatstarvation period, the algae were further incubated in growthmedium containing sulfate. Expression of the sexual phero-mone under the control of the arylsulfatase promoter wouldresult in self-induction of the female strain. Although somestress situations [heat shock, aldehyde treatment, proteasedigestion of matrix, etc. (reviewed in ref. 2)] can inducepheromone production, sulfate deprivation does not causeany self-induction in the female recipient strain 153-48 (datanot shown). Therefore, we looked for sexually inducedtransformants, which are easily recognized by microscopicinspection. Five self-induced female transformants wereidentified and one of them, T1/44/2, was further character-ized. This clone produces gonidia and reproduces asexuallyin sulfate-containing medium (Fig. 3A) but produces egg-bearing sexual females after having been exposed to sulfate-free medium for 9 hr (Fig. 3B). The sexual pheromoneproduced under these conditions is secreted into the culturemedium, as aliquots of this medium are able to induce sexualdevelopment of female wild-type strain HK10 or male wild-type strain 69-lb.

Arylsulfatase Synthesis Under Developmental Control. Toidentify cotransformants containing the ISG promoter/arylsulfatase chimeric construct, the chromogenic substrate

sexual pheromonegenomic sequence

1 kb

IVpUC18-4 a* p*-UC18

tsp

ATG

la I

TGA

arylsulfatasegenomic sequence

1 kb

tsp

H-11 1ATG

FIG. 2. Structure of chimeric genes. (A) Structure of the arylsulfatase/sexual pheromone chimeric gene of plasmid pArInK2/1, containingthe arylsulfatase promoter region and the sexual pheromone coding region. (B) Structure of the ISG/arylsulfatase chimeric gene of plasmidpISGArK2/40, containing the ISG promoter region and the arylsulfatase coding region. Intron/exon structure is given below the physical map.Gene SOEing was performed as described in the text to create the fusion region. tsp, Transcription start point.

ISG5'sequencel r

B

pUC18--IW

I I:r~~~~~ ~~~ ~~~ ~~~ -~~pUCiS

TAA

,-- l ::

Proc. NatL Acad. Sci. USA 91 (1994)

- - - --

b A

Proc. NatL. Acad. Sci. USA 91 (1994) 11565

A B

FIG. 3. In vivo effect in transformant T1/44/2 with the sexualpheromone gene expressed under the control of the arylsulfatasepromoter. Clone T1/44/2 develops vegetatively when incubated insulfate-containing medium (A) and sexually when incubated for 9 hrin sulfate-free medium (B).

5-bromo-4chloro-3-indolyl sulfate was added to the sulfate-containing growth medium to allow easy detection of algaeexpressing arylsulfatase by their blue color. Since wild-typearylsulfatase is expressed only in sulfate-free medium, anydetected arylsulfatase activity identifies a cotransformant.Several cotransformants were obtained, and one of them,T3/5/2, was further characterized. When the chromogenicsubstrate 5-bromo-4-chloro-3-indolyl sulfate was added toisolated embryos from this clone, arylsulfatase activity couldbe detected immediately after the inversion process wascompleted (Fig. 4).PCR Amplification of the Chimeric Transcripts. Reverse

transcription-PCR was used to verify the existence of hybridmRNA in transformants and both the degree of expressionand regulation. For this purpose, RNA was extracted from 20Volvox spheroids, reverse transcribed, and subsequentlyamplified by PCR. Oligonucleotide primers were selectedthat allowed amplification of the fusion region of the corre-sponding chimeric construct. To determine the ratio ofhybridmRNA and the corresponding endogenous mRNA, cDNAsderived from both transcripts were simultaneously amplifiedin the same reaction tube. Referring to clone T1/44/2 con-taining the arylsulfatase promoter/sexual pheromone con-struct, a 200-bp and a 147-bp PCR product were predicted tobe recovered if both the endogenous gene and the trans-formed gene were transcribed and processed properly. Like-wise, for clone T3/5/2 containing the ISG promoter/arylsulfatase construct, a 256-bp and a 399-bp PCR productwere expected. These predictions were made from the se-

A B-_L

_r_s

_

-

0.

FIG. 4. In vivo effect in transformant T3/5/2 with the arylsulfa-tase gene expressed under the control of the ISG promoter. Isolatedembryos of wild-type strain HK10 (A) and of clone T3/5/2 (B) weregrown in standard medium containing the chromogenic substrate5-bromo-4chloro-3-indolyl sulfate, immediately after inversion wascompleted. The blue color indicates arylsulfatase activity.

quence data and the known intron/exon boundaries of theparent genes.Accumulation of mRNA derived from the arylsulfatase

promoter/sexual pheromone construct was analyzed aftergrowth of clone T1/44/2 in sulfate-free medium for varioustimes. RNA was extracted from transformants after sulfatestarvation for 1, 3, and 6 hr. Reverse transcription andsubsequent PCR amplification yielded both the expectedchimeric cDNA and the endogenous arylsulfatase cDNA in aratio of 1:1. Both cDNAs appeared as early as 3 hr after theinitiation of sulfate deprivation (Fig. 5A). mRNA levelsreached a maximum 6 hr after the initiation of sulfate depri-vation. DNA sequence analysis of the chimeric cDNA frag-ment (147 bp) is shown in Fig. 6A. All introns within theconstruct were excised by the splicing machinery of Volvoxexactly in the same manner as known for the parent genes.Thus, the arylsulfatase promoter allowed the strictly con-trolled expression of a gene.The same strategy was applied to demonstrate the produc-

tion of hybrid mRNA derived from the ISG promoter/arylsulfatase construct in clone T3/5/2 (Fig. SB). Reversetranscription and subsequent PCR amplification of both thechimeric cDNA and the endogenous ISG cDNA yielded thetwo fragments in a ratio of =1:1. Both mRNA species weredetectable only during the short period of embryonic inver-sion (Fig. SB). Therefore, the ISG promoter fragment usedwas able to mediate this extreme type of developmentalcontrol of gene expression. The result of a DNA sequenceanalysis of the chimeric cDNA fragment (399 bp) is shown inFig. 6B. Again, all introns were correctly excised in themanner known for the parent genes. This particular constructshould allow a detailed analysis of this ISG promoter systemby deletion analysis and site-directed mutagenesis. At the

A B

_399 bp-256 bp

- 1 hp_ J

14' b

FIG. 5. Reverse transcription and subsequent PCR amplificationof both the chimeric mRNA and the corresponding endogenousmRNA. (A) RNA was extracted from 20 Volvox transformants of thefemale clone T1/44/2, containing arylsulfatase/sexual pheromonehybrid DNA, grown in sulfate-sufficient medium (lane 1) and sub-sequently starved for sulfate for 1 hr (lane 2), 3 hr (lane 3), and 6 hr(lane 4). Reverse transcription and subsequent PCR amplification ofboth the chimeric cDNA and the corresponding endogenous aryl-sulfatase cDNA in one reaction tube yielded 147-bp (derived from thechimeric gene) and 200-bp (derived from the endogenous arylsulfa-tase gene) DNA fragments in a ratio of -1:1 as early as 3 hr after theinitiation of sulfate deprivation. (B) RNA was extracted from 20Volvox embryos of the transformant T3/5/2, containing the ISG/arylsulfatase hybrid DNA, 5 hr (lane 1) or 1 hr (lane 2) prior toinversion, during inversion (lane 3), and 1 hr after inversion (lane 4).Reverse transcription and subsequent PCR amplification of both thechimeric cDNA and the corresponding endogenous ISG cDNA inone reaction tube yielded 399-bp (chimeric gene) and 256-bp (endog-enous gene) DNA fragments in a ratio of -1:1 only during theinversion process. Sizes of the PCR products were determined byusing a 123-bp ladder as size marker and by DNA sequencing.

Genetics: HaUmann and Sumper

I

11566 Genetics: Hallmann and Sumper

A5'-TGC3CACACT GCGGAGGTAT CAGAGCATCA GCCATTTGGA AGGACAACAC

CATGTCGGCG TGCAG G CAGTAGTGGT AGTCAATTCT GCAACCGCCTCACITTTGGC GG GTCTTCATGG CTOTGGGCT CTGCACd-3'

B5'- TAAGTAGTAA CACGTACGGT ATTATTTGCC GTTTGGGTTA G&TTTGCA

ACGATTGGTC GTTGCATTAT GCCTGCTTGG GTITGCGGCC TTGACTGCGGCCGCCGCACA TCAGCGTCCA AACTTCGTCG TiTATrITCAC ¶ATGACCAAGATGGAATTC AGAACTCCAC GCATCCGCGC TACCAGCCCA AGCTGCATGA

GCACATCCGC TACCCCGGCA TTGAGCTCAA GAACTACTTC GTCACGACTCCGGTGTGCTG CCCATCGCGC ACCAACCTCT GGCGCGGCCA ATTCAGCCACAACACCAACT TCACGGACGT CCTTGGGCCC CACd;CG0CT ACGCAAAGTGGAAGTCGCTG GGCATCGATA AGTCCTACCT GCCTGTCTGG CTACAGAAC-3'

FIG. 6. DNA sequences from reverse transcription and subse-quent PCR amplification of the fusion region of the arylsulfatase/sexual pheromone gene from clone T1/44/2 (A) and the fusion regionof the ISG/arylsulfatase gene from clone T3/5/2 (B). Positions ofintrons are indicated by vertical arrowheads. An asterisk denotes thelast base contributed by the arylsulfatase or ISG 5' sequence; thefollowing base is the first contributed by the structural gene sequenceof the sexual pheromone or of the arylsulfatase. In addition, thisposition is the translation initiation site. PCR primers are representedby horizontal arrows.

time of ISG transcription, embryonic cells undergo drasticchanges in shape. It is possible that the reorganization of thecytoskeleton delivers signals responsible for the activationand inactivation of the ISG promoter.These experiments demonstrate that both the sexual pher-

omone gene and the arylsulfatase gene are adequate reportergenes. Moreover, the pheromone protein exerts full biologicalactivity at concentrations as low as 0.1 fM. This would allowthe analysis of very weak promoters. In addition, both of theregulated promoters used in this study work in chimeric geneconstructs. The controlled expression of cloned genes allowsthe analysis of proteins with a putative regulatory function indevelopmental processes. Techniques such as antisense RNAtechnology are now applicable in Volvox to inhibit expressionof cloned genes at defined developmental stages.

This work was supported by the Deutsche Forschungsgemein-schaft (SFB 43).

1. Kirk, D. L. & Harper, J. F. (1986) Int. Rev. Cytol. 99, 217-293.2. Schmitt, R., Fabry, S. & Kirk, D. L. (1992) Int. Rev. Cytol.

139, 189-265.3. Ertl, H., Haflmann, A., Wenzl, S. & Sumper, M. (1992)EMBO

J. 11, 2055-2062.4. Sumper, M., Berg, E., Wenzl, S. & Godl, K. (1993) EMBO J.

12, 831-836.5. Tschochner, H., Lottspeich, F. & Sumper, M. (1987)EMBO J.

6, 2203-2207.6. Mages, H.-W., Tschochner, H. & Sumper, M. (1988) FEBS

Lett. 234, 407-410.7. Starr, R. C. (1970) Dev. Biol. Suppl. 4, 59-100.8. Huskey, R. J., Griffin, B. E., Cecil, P. O. & Calaan, A. M.

(1979) Genetics 91, 229-244.9. allahan, A. M. & Huskey, R. J. (1960) Dcv. Biol. 8, 419-435.

10. Schiedlmeier, B., Schmitt, R., MOller, W., Kirk, M. M., Gru-ber, H., Mages, W. & Kirk, D. L. (1994) Proc. Natl. Acad. Sci.USA 91, 5080-5084.

11. Hallmann, A. & Sumper, M. (1994) Eur. J. Biochem. 221,143-150.

12. Schlipfenbacher, R., Wenzl, S., Lottspeich, F. & Sumper, M.(1986) FEBS Lett. 209, 57-62.

13. Starr, R. C. (1969) Arch. Protistenk. 111, 204-222.14. Starr, R. C. & Jaenicke, L. (1974) Proc. Nati. Acad. Sci. USA

71, 1050-1054.15. Gilles, R., Bittner, C. & Jaenicke, L. (1981) FEBS Lett. 124,

57-61.16. Adams, C. R., Stamer, K. A., Miller, J. K., McNally, J. G.,

Kirk, M. M. & Kirk, D. L. (1990) Curr. Genet. 18, 141-153.17. Kindle, K. L., Schnell, R. A., Fernandez, E. & Lefebvre,

P. A. (1989) J. Cell Biol. 109, 2589-2601.18. Provasoli, L. & Pintner, I. J. (1959) in The Ecology ofAlgae,

eds. Tyron, C. A. & Hartman, R. T. (Univ. of Pittsburgh,Pittsburgh), Spec. Publ. No. 2, pp. 84-96.

19. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K. & Pease,L. R. (1989) Gene 77, 61-68.

20. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) MolecularCloning: A Laboratory Manual (Cold Spring Harbor Lab.Press, Plainview, NY), 2nd Ed.

21. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl.Acad. Sci. USA 74, 5463-5467.

22. Hattori, M. & Sakaki, Y. (1986) Anal. Biochem. 152, 232-238.23. Takeuchi, Y., Dotson, M. & Keen, N. T. (1992) Plant Mol.

Biol. 18, 835-839.24. Gruber, H., Goetinck, S., Kirk, D. L. & Schmitt, R. (1992)

Gene 120, 75-83.

Proc. Nad. Acad. Sci. USA 91 (1994)