Identification of Staphylococcus species, Micrococcus species and ...
Reliability of ITS in Species Identification by Surachit Waengsothorn.
-
Upload
rosanna-simpson -
Category
Documents
-
view
218 -
download
2
Transcript of Reliability of ITS in Species Identification by Surachit Waengsothorn.
![Page 1: Reliability of ITS in Species Identification by Surachit Waengsothorn.](https://reader036.fdocuments.in/reader036/viewer/2022062407/56649d215503460f949f7131/html5/thumbnails/1.jpg)
Reliability of ITS in Species Identification
by
Surachit Waengsothorn
![Page 2: Reliability of ITS in Species Identification by Surachit Waengsothorn.](https://reader036.fdocuments.in/reader036/viewer/2022062407/56649d215503460f949f7131/html5/thumbnails/2.jpg)
What’s ITS
ITS stands for Internal Transcribed Spacer regions
Where are they?
These regions are located in ribosome.
![Page 3: Reliability of ITS in Species Identification by Surachit Waengsothorn.](https://reader036.fdocuments.in/reader036/viewer/2022062407/56649d215503460f949f7131/html5/thumbnails/3.jpg)
![Page 4: Reliability of ITS in Species Identification by Surachit Waengsothorn.](https://reader036.fdocuments.in/reader036/viewer/2022062407/56649d215503460f949f7131/html5/thumbnails/4.jpg)
![Page 5: Reliability of ITS in Species Identification by Surachit Waengsothorn.](https://reader036.fdocuments.in/reader036/viewer/2022062407/56649d215503460f949f7131/html5/thumbnails/5.jpg)
Ribosomal RNA
5S rRNS 5.8s rRNA 18s rRNS
120bp 160bp ~1900bp
ITS1 ITS2
![Page 6: Reliability of ITS in Species Identification by Surachit Waengsothorn.](https://reader036.fdocuments.in/reader036/viewer/2022062407/56649d215503460f949f7131/html5/thumbnails/6.jpg)
What’s ITS
ITS stands for Internal Transcribed Spacer regions
Where are they?
These regions are located in ribosome.
Why do I pick ITS?
rRNA is highly conserved across texa while the ITS may be species-specific.
![Page 7: Reliability of ITS in Species Identification by Surachit Waengsothorn.](https://reader036.fdocuments.in/reader036/viewer/2022062407/56649d215503460f949f7131/html5/thumbnails/7.jpg)
rRNA evolution rate use
Small-subunit very slow distantly related organisms
Mitocondrial more rapidly family level
ITS fastest variation among species
![Page 8: Reliability of ITS in Species Identification by Surachit Waengsothorn.](https://reader036.fdocuments.in/reader036/viewer/2022062407/56649d215503460f949f7131/html5/thumbnails/8.jpg)
Species
In the past 30 years, over six concepts have been proposed.
Species is a very simple word BUT its definition is not that easy.
Three majors concepts:
-The biological species concept
- The phylogenetic species concept
- The morphospeceis concept
![Page 9: Reliability of ITS in Species Identification by Surachit Waengsothorn.](https://reader036.fdocuments.in/reader036/viewer/2022062407/56649d215503460f949f7131/html5/thumbnails/9.jpg)
The biological species concept• proposed in 1942 by Ernst Mayr
• used by many zoologists
• defined “species” in Endangered Species Act
Criterion: reproductive isolation (lack of gene flow)
• populations do not hybridize
• populations fail to produce fertile offspring
Cons:
• can be applied to only living organisms
• difficult to keep tract on all populations
![Page 10: Reliability of ITS in Species Identification by Surachit Waengsothorn.](https://reader036.fdocuments.in/reader036/viewer/2022062407/56649d215503460f949f7131/html5/thumbnails/10.jpg)
The phylogenetic species concept
Criterion: monophyly
Populations contain all the know descendants of a single common ancestor.
Species are the smallest diagnosable monophyletic groups.
The morphospeceis concept: used by paleontologists
They define species on the basis of morphological differences among fossils.
![Page 11: Reliability of ITS in Species Identification by Surachit Waengsothorn.](https://reader036.fdocuments.in/reader036/viewer/2022062407/56649d215503460f949f7131/html5/thumbnails/11.jpg)
All concepts share three things in common:
1) Species consist of interbreeding populations.
2) Species are a fundamental unit of evolution.
3) Species share a distinguishing characteristic.
![Page 12: Reliability of ITS in Species Identification by Surachit Waengsothorn.](https://reader036.fdocuments.in/reader036/viewer/2022062407/56649d215503460f949f7131/html5/thumbnails/12.jpg)
Why is species identification so important?
Species plays a major role in all conservation aspects.
Species identification is a starting point of life science disciplines i.e. biology, ecology, forestry, biotechnology, etc.
Species identification is daily used in many careers such as farmers, foresters, lawyers, gardeners, researchers, scientists, curators, ete.
![Page 13: Reliability of ITS in Species Identification by Surachit Waengsothorn.](https://reader036.fdocuments.in/reader036/viewer/2022062407/56649d215503460f949f7131/html5/thumbnails/13.jpg)
MethodData collections:
Lab work:- extract DNA from a sugar maple sample.
- amplify ITS region using PCR technique.
- perform fragment sequencing.
5s RNA 5.8s RNA 18s RNA
ITS1 primer:TCCGTAGGTGAACCTGCGG
ITS4 primer: TCCTCCGCTTATTGATATGC
![Page 14: Reliability of ITS in Species Identification by Surachit Waengsothorn.](https://reader036.fdocuments.in/reader036/viewer/2022062407/56649d215503460f949f7131/html5/thumbnails/14.jpg)
Method (cont.)
Office work:
- search around the cool web (NCBI home page) and collect ITS data of maples.
- use GCG to perform pileup, pretty - consensus, tofasta.
- put fasta file in clastalW, and get the tree from Treeview
Data collections:
![Page 15: Reliability of ITS in Species Identification by Surachit Waengsothorn.](https://reader036.fdocuments.in/reader036/viewer/2022062407/56649d215503460f949f7131/html5/thumbnails/15.jpg)
Results
• 15 species of maples (genus Acer)
• 3 sample per species except sugar maple has only 2 samples + 1 sample of mine.
Pretty -consensus
![Page 16: Reliability of ITS in Species Identification by Surachit Waengsothorn.](https://reader036.fdocuments.in/reader036/viewer/2022062407/56649d215503460f949f7131/html5/thumbnails/16.jpg)
Results
•15 species of maples (genus Acer)
•3 sample per species except sugar maple has only 2 samples + 1 sample of mine.
Pretty -consensus
Clustal W
![Page 17: Reliability of ITS in Species Identification by Surachit Waengsothorn.](https://reader036.fdocuments.in/reader036/viewer/2022062407/56649d215503460f949f7131/html5/thumbnails/17.jpg)
Treeview
![Page 18: Reliability of ITS in Species Identification by Surachit Waengsothorn.](https://reader036.fdocuments.in/reader036/viewer/2022062407/56649d215503460f949f7131/html5/thumbnails/18.jpg)
Data Interpretation
Recommendations
Unknown sample(s) is(are) recommended to compare with at least three sequences of a known species, and several species in the same genus or different genus in the same family.
ITS is a powerful tool to discriminate species. 42 of 45 sequences (>93%) support the hypothesis.